ID: 1092580179

View in Genome Browser
Species Human (GRCh38)
Location 12:9832982-9833004
Sequence CTGCAGAAAAACATTAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 1, 2: 3, 3: 49, 4: 443}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092580179 Original CRISPR CTGCAGAAAAACATTAAGAA AGG Intronic
900797298 1:4716044-4716066 CTGCAGATAAATATTTAGAAGGG + Intronic
901375255 1:8833620-8833642 ATTCAGAAATACATGAAGAAAGG + Intergenic
902354178 1:15884472-15884494 GTGAGGAAAACCATTAAGAATGG + Intronic
903018802 1:20379387-20379409 CTGTAGACAAACATTGAGATGGG + Intergenic
903573497 1:24323099-24323121 CTACAGAAAAATAGGAAGAATGG - Intronic
904276138 1:29385526-29385548 CCCCAGAAAAACCTTAAAAATGG + Intergenic
905384493 1:37591982-37592004 CTGCAGAGAAGCATTTAGCATGG - Intronic
906091146 1:43180713-43180735 CTGCTGAAAAATTTTAGGAAGGG + Intronic
906439809 1:45831541-45831563 CTGCAGAAAAATAGACAGAATGG + Intronic
908063539 1:60377555-60377577 TTGCAGAAAAATCTTCAGAATGG + Intergenic
908553287 1:65231372-65231394 CTGCAGTAAAACATTTCTAAAGG + Exonic
908701184 1:66902698-66902720 CTGCAAAAATAAATTCAGAATGG - Intronic
909141436 1:71871046-71871068 TTGCAGGATTACATTAAGAAGGG + Intronic
910081416 1:83347061-83347083 AAGCTGAAAAACATTTAGAATGG - Intergenic
910092372 1:83480373-83480395 TTGCAGAAAAACATTTAGAAAGG + Intergenic
910103818 1:83608692-83608714 TTGGAGAAAAAAATTAAGAGCGG + Intergenic
911121302 1:94299818-94299840 CTCCAGATAAACATAAGGAAAGG - Intergenic
911285656 1:95988768-95988790 CTGCTGACAATCAGTAAGAAGGG + Intergenic
911939986 1:104032886-104032908 ATGCAGAAAAAAAGTCAGAAGGG - Intergenic
912925510 1:113909625-113909647 CTGCATTAAAATATTAAGAATGG - Intronic
912989935 1:114475367-114475389 CTGCTAAAAAACAGTAATAAAGG + Intronic
913311750 1:117504334-117504356 CTTCAGAAAAACTGTAAGATAGG + Intronic
913518763 1:119626141-119626163 CTCCAGAAAAACACAAAGAAAGG + Intronic
914412900 1:147448701-147448723 CTACAGAGAAAGGTTAAGAAGGG - Intergenic
916076665 1:161204046-161204068 TTGCAGAAGAAAATAAAGAATGG + Intronic
916271061 1:162942175-162942197 CTGAAGAAGAAAATTAAGCATGG + Intergenic
916394501 1:164370953-164370975 CATCAGCAAAACCTTAAGAAAGG + Intergenic
916685442 1:167140929-167140951 CTGCAGAACACCATTAACACGGG - Intergenic
916924588 1:169504546-169504568 CTGCAGAATATCATTAGAAAGGG + Intergenic
917024291 1:170625408-170625430 CTACAGAAAAACAAAAACAAAGG + Intergenic
918643388 1:186872188-186872210 CTTCAGAAAAATATTAATAAAGG - Intronic
918893529 1:190308752-190308774 CTGAAGAAAGATATTAACAAAGG + Intronic
919199778 1:194341250-194341272 ATGCAGAAAAACAATAATAAAGG - Intergenic
920769812 1:208872057-208872079 GTACAGATAAACATTAAGATAGG - Intergenic
920815074 1:209323653-209323675 CTGCAGAAAGAGATCATGAAAGG - Intergenic
921259955 1:213377472-213377494 ATGCAGAAAAACAATGACAAAGG - Intergenic
921320453 1:213933530-213933552 CTGCAGTGAAACATAAATAATGG + Intergenic
921454698 1:215355780-215355802 CTTCGGAAAAACATTCAGCAAGG + Intergenic
922121254 1:222671302-222671324 CTGCAGAAAAAAGCTAAAAATGG + Intronic
922386241 1:225086728-225086750 CAGCAGAAAAACAGCAAAAAGGG + Intronic
923949229 1:238928526-238928548 CTAAAGGAAAACAGTAAGAAAGG - Intergenic
924169382 1:241321602-241321624 GTGCAGAACAACATGAAGATGGG + Intronic
924364090 1:243271136-243271158 TTGCAGAAAAAATTTAAGCATGG + Intronic
924750031 1:246878591-246878613 CTGAAGATATACACTAAGAATGG + Intronic
1062887053 10:1024581-1024603 CTGAACGAAAACATTGAGAAAGG - Exonic
1062949990 10:1491692-1491714 ATACACAAAAACATAAAGAAAGG - Intronic
1063215184 10:3918472-3918494 CTTCAGAAAAGACTTAAGAATGG - Intergenic
1063281884 10:4638384-4638406 AGGCAGAACAACATTCAGAAGGG - Intergenic
1063289357 10:4727752-4727774 CTGCAGAAAAACAGCAATTAGGG + Intergenic
1063327051 10:5114604-5114626 ATGGAGAAAAACATTAAAAATGG + Intronic
1063684339 10:8222202-8222224 ATAGAGAAGAACATTAAGAAGGG + Intergenic
1064472261 10:15648220-15648242 CTGCAGACAAACTTTAATAGAGG - Intronic
1064547036 10:16461227-16461249 CTGCAGTAAAATATTTAGAAAGG - Intronic
1064859574 10:19813661-19813683 CTTCAGAATAAAATTAAGATAGG + Intergenic
1065282727 10:24156115-24156137 ATGGAGAAAAACATTAAAAATGG - Intronic
1065332929 10:24621981-24622003 AGGCAGAAAAACATGAAAAAAGG + Intronic
1067326682 10:45275143-45275165 CTACTGAAAAACTTAAAGAAAGG - Intergenic
1067581855 10:47451355-47451377 CTGCAGAAAGACAAGAAGCAGGG + Intergenic
1068032923 10:51725503-51725525 ATGCAGAAATCCATTAAGCATGG - Intronic
1068039351 10:51803239-51803261 TTGTAAAAAAACATTTAGAATGG + Intronic
1068087494 10:52392770-52392792 TTTCAGAAAAACATTAAGGTTGG + Intergenic
1068547722 10:58368885-58368907 CTTCAGAAACACATTTAAAATGG - Exonic
1068690531 10:59909140-59909162 CTGCAAAAACACATGAACAAAGG + Intergenic
1068750868 10:60590562-60590584 GTGAAGAACAACATGAAGAATGG + Intronic
1069180328 10:65351035-65351057 TTGCAGAAGAACATGAAGGATGG - Intergenic
1069399226 10:68024713-68024735 AGGTAGAAAAACATTAAGCAAGG + Intronic
1071574113 10:86713543-86713565 CTGCTAAAAAAGATTAAGATTGG - Intronic
1071848108 10:89540497-89540519 ATGGAGATATACATTAAGAAAGG - Intronic
1072091473 10:92132559-92132581 CTACAAAAAAACATTAAAGAGGG + Intronic
1073498569 10:103916287-103916309 CTGCAGAAGATCATTAAGCAAGG + Intronic
1074369277 10:112886564-112886586 CTGCTCAAACACATTAAGACTGG + Intergenic
1074693161 10:116025354-116025376 CTGCAGGAAAGCATAGAGAAGGG + Intergenic
1074926997 10:118083879-118083901 ATGCAGAAAAAGAAAAAGAAAGG - Intergenic
1075167563 10:120082990-120083012 CTGCAGTAAAATATTGAGAGGGG - Intergenic
1075194770 10:120346758-120346780 ATCAAGAAAAACGTTAAGAAAGG - Intergenic
1075870536 10:125769776-125769798 CTGCCAAAAAACTGTAAGAAAGG - Intronic
1076759626 10:132595739-132595761 CTGCAGAAAAATATTACAGAAGG - Intronic
1077049167 11:559040-559062 CTCCCGAAGAACATTGAGAATGG - Intronic
1078809167 11:14740982-14741004 CTGCAGAAAATGAATAAGAATGG - Intronic
1080382102 11:31782662-31782684 CTGCAGAAAAACAGTTGGGATGG + Intronic
1080634536 11:34112077-34112099 CTGCAGAAGAAAATAAAGAATGG + Exonic
1081100482 11:38995824-38995846 CTTCAGAAAAATATTCATAATGG + Intergenic
1081282694 11:41229704-41229726 CTGCAAGAAAACATTGAGACAGG - Intronic
1082270521 11:50164843-50164865 CTGTATAAAAACAATAATAATGG - Intergenic
1082633917 11:55573442-55573464 ATAAAGAAAACCATTAAGAAGGG - Intergenic
1085264441 11:75228929-75228951 CTCCACAAAAAAATTAAAAAAGG - Intergenic
1085903043 11:80724938-80724960 CTGCAGAGAAACATAAGGGAAGG - Intergenic
1086048201 11:82557955-82557977 CTGAACAAAAACATGAAGCAGGG + Intergenic
1087153134 11:94876749-94876771 CTGAAGCAAAACATTAAGTGGGG - Exonic
1087362539 11:97178727-97178749 TTGCAGAAAAACATTCACCATGG + Intergenic
1087837455 11:102889032-102889054 CTGAAGAAAAACACTAAATAAGG - Intergenic
1087892653 11:103552500-103552522 CCCCAGAAAAACCTTAAAAATGG + Intergenic
1088459449 11:110067193-110067215 GTGGATAAAAACATTAAAAAAGG + Intergenic
1089834171 11:121355661-121355683 CTCCATAAAAACACAAAGAATGG + Intergenic
1090815181 11:130287482-130287504 AAGCACAAAAACAGTAAGAATGG + Intronic
1090881511 11:130836068-130836090 CAGCAAAAAACCGTTAAGAATGG - Intergenic
1091119409 11:133044305-133044327 CTGTAGGAATACAATAAGAAAGG + Intronic
1092094856 12:5833136-5833158 CCTAAGAAAAACATAAAGAACGG - Intronic
1092580179 12:9832982-9833004 CTGCAGAAAAACATTAAGAAAGG + Intronic
1093239065 12:16646515-16646537 CTGCAACAAAACATTGAGAAAGG - Intergenic
1093248009 12:16764008-16764030 CTGCAGAATAACATCATGAAAGG - Intergenic
1093555137 12:20463758-20463780 ATGCAGAAAAACATTAAGAAGGG + Intronic
1094168995 12:27471561-27471583 CTCCAGCAAAATATTAATAAGGG + Intronic
1094601034 12:31909086-31909108 CTGCTGAAAAACTTACAGAAAGG + Intergenic
1094740563 12:33283489-33283511 CAGCAGCAAAACATCAAAAATGG + Intergenic
1095042699 12:37461009-37461031 CTACAAGAAAACATAAAGAAAGG - Intergenic
1095632732 12:44397373-44397395 CTGTAGAAAAACATAAAGAATGG - Intergenic
1096090329 12:48895358-48895380 CTGCAGAAACACATTCAGATAGG + Intergenic
1096503339 12:52078844-52078866 CTGCAGAAAAGCAGAAAGACTGG - Intergenic
1098432374 12:70434006-70434028 CAGCAGTCAAACATTAAAAACGG - Exonic
1098779607 12:74670212-74670234 CCCCACAAAAACATGAAGAAAGG - Intergenic
1098897206 12:76077546-76077568 CTGCAGTAAAATATTAATACAGG - Intronic
1099249031 12:80229575-80229597 CTGCACACAAGCATTAGGAAGGG - Intronic
1099318366 12:81112995-81113017 CTGTACAAAAACCTTAATAAAGG - Intronic
1099909023 12:88806900-88806922 CCACAGAAAAACAGAAAGAAAGG - Intergenic
1099929610 12:89058525-89058547 ATGCAGAAAAAAAGAAAGAATGG + Intergenic
1100066866 12:90658236-90658258 ATGAAGAAAAAAATTAAAAATGG - Intergenic
1101341863 12:103849197-103849219 CTGTAGTAAAAGATGAAGAATGG - Intergenic
1101749346 12:107570634-107570656 TTGGAAAAAAACATCAAGAATGG - Intronic
1103132445 12:118480960-118480982 CTGCTTAAAAACTTAAAGAAAGG - Intergenic
1103672007 12:122625102-122625124 CTGCAGAAAAAAAAGAAGTATGG + Intronic
1104212520 12:126703237-126703259 CCACAGAAAGACATTAAGTAAGG + Intergenic
1104997726 12:132669066-132669088 CAGAAGAAAAAAGTTAAGAAGGG + Intronic
1105554983 13:21438756-21438778 CTACAGAAAAATATTGTGAAAGG + Intronic
1105652320 13:22392985-22393007 CTGCAGATAAATTTTGAGAATGG + Intergenic
1106688498 13:32088093-32088115 GTGCAGAAAGACATTAAGGCTGG - Intronic
1109905734 13:68838361-68838383 CTGCAGAAATTCAATCAGAAAGG - Intergenic
1109988607 13:70023107-70023129 CCTCAGAAAAGCATAAAGAAAGG - Intronic
1110870853 13:80451230-80451252 CAACAGAAAAAAATTGAGAAAGG - Intergenic
1111007171 13:82263037-82263059 ATGCTGAAAAATTTTAAGAAGGG - Intergenic
1112428789 13:99331225-99331247 CAGAAGAAAAAAAATAAGAAAGG - Intronic
1112636850 13:101225722-101225744 CTGCTGAAAAACTTGAAGAAAGG + Intronic
1113310052 13:109122366-109122388 CTAAAGATAAAAATTAAGAATGG + Intronic
1114411325 14:22503208-22503230 ATGCAGAAAAAAAAAAAGAATGG + Intergenic
1115691919 14:35853123-35853145 AGACAGAAAAACATTAAAAAGGG + Intronic
1115984640 14:39091460-39091482 CTGCAGGTAAACAACAAGAATGG - Exonic
1116387755 14:44352854-44352876 CTTCAAAAAAATATTCAGAATGG + Intergenic
1116730995 14:48622500-48622522 CTGTAGATAAAAACTAAGAAAGG + Intergenic
1116985995 14:51221116-51221138 CTGGACAAAAGCAGTAAGAAGGG + Intergenic
1117754690 14:58961283-58961305 CTCCAGAAAACCATCCAGAATGG - Intergenic
1118673554 14:68157697-68157719 CTGAATAAAAACAATAATAATGG + Intronic
1118777632 14:68983177-68983199 CTGGAGAACAACACTTAGAAAGG + Intergenic
1119076938 14:71649690-71649712 CTGCAGAGAAACTTTAAAAGAGG - Intronic
1119644419 14:76338151-76338173 CTCCAGAAACGCATTAAAAAGGG + Intronic
1120217570 14:81696471-81696493 CAGCAGAGAATAATTAAGAAGGG - Intergenic
1120473547 14:84957936-84957958 CTGCATAGAAACATTTATAAGGG - Intergenic
1120606693 14:86587329-86587351 CTAAAGAAAAACATTTAGCAAGG + Intergenic
1121678450 14:95773213-95773235 CTGCAGGAAGCAATTAAGAAGGG - Intergenic
1121911210 14:97794165-97794187 CTGGAAGAAAACATCAAGAATGG - Intergenic
1122055022 14:99090521-99090543 TTGCAGAAAAAAAAAAAGAAAGG + Intergenic
1122573355 14:102724209-102724231 CTGCAAAACAAAATGAAGAATGG + Intronic
1202941235 14_KI270725v1_random:148644-148666 CTACAAGAAAACATAAAGAAAGG - Intergenic
1123792225 15:23733253-23733275 TAGCAGATAAAAATTAAGAAAGG - Intergenic
1123890642 15:24774972-24774994 CTGCAGCAAAACATGCACAAAGG - Intergenic
1124063819 15:26320995-26321017 CTGAAGATAAAGATTAAAAATGG + Intergenic
1124907828 15:33888074-33888096 CAGCAACAAAACCTTAAGAATGG + Intronic
1125337048 15:38637006-38637028 ATGCAGAGAAAGATAAAGAATGG - Intergenic
1125695543 15:41634108-41634130 CTACAGAAAAAAATAAAGCAGGG - Intronic
1125703578 15:41710614-41710636 CTCCATAAAAACACTAAAAATGG - Intronic
1125898366 15:43321981-43322003 CTTCTGAGATACATTAAGAATGG - Intergenic
1126292233 15:47094674-47094696 CTACAAGAAAACATAAAGAAAGG + Intergenic
1127268388 15:57379352-57379374 GTGAAGAAAAATATGAAGAAAGG + Intronic
1127647319 15:60971666-60971688 TTGCAGAAATGCTTTAAGAAAGG - Intronic
1128518123 15:68356592-68356614 TTGCAGAAGAGCATTTAGAATGG - Intronic
1128899706 15:71409161-71409183 CTGCAGAAGAACATTCTGAGGGG - Intronic
1128905054 15:71460062-71460084 CTCCAGAGAAACATGAAAAAGGG - Intronic
1129125613 15:73438330-73438352 CTACAGAAAAAAAAAAAGAAGGG + Intergenic
1129136570 15:73557656-73557678 CTGCAATAAAACAATAAGCAAGG + Intronic
1129494891 15:75969900-75969922 CTTTAGAAACACCTTAAGAATGG - Intronic
1130363330 15:83209830-83209852 GTGCAGAAATCCATGAAGAATGG + Intergenic
1130541587 15:84824093-84824115 CTGCAGAAAAAAATTTTAAAAGG - Intronic
1130771903 15:86932739-86932761 CTTCAGCAAAACATTCATAATGG - Intronic
1130895910 15:88170388-88170410 CTGCAGGAAAACTTGATGAAAGG - Intronic
1131023343 15:89118723-89118745 CTCCAGAAAAACATCATGTAAGG + Intronic
1131944366 15:97603243-97603265 CTGCAGAAAGACATTAAAAGAGG - Intergenic
1132165752 15:99587602-99587624 CTGCTGAAAGAAATTAAGGAAGG - Intronic
1132226421 15:100145555-100145577 CTCCAGAAAAACAGTACTAATGG - Intronic
1132334791 15:101039831-101039853 CTGAAGAAAAAAATTAACAGAGG - Intronic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1134064194 16:11216678-11216700 CTGCACAATAGCATTCAGAATGG + Intergenic
1134274691 16:12765508-12765530 GGGAAAAAAAACATTAAGAAAGG + Intronic
1135303691 16:21351473-21351495 CTGCAAATAAACATTTAGCAGGG + Intergenic
1135492858 16:22924952-22924974 CTGCAGAATAACCATGAGAAGGG + Intergenic
1135667463 16:24347865-24347887 TTTCAGAAAAAAATGAAGAAAGG - Intronic
1136244406 16:28965424-28965446 CTACAAAAAAAAATTAAAAAGGG + Exonic
1136300433 16:29330668-29330690 CTGCAAATAAACATTTAGCAGGG + Intergenic
1137346406 16:47666001-47666023 CTGCACTAAAACATTAGTAATGG - Intronic
1137628560 16:49924989-49925011 CTGCAGAAAATCCAAAAGAATGG + Intergenic
1138097688 16:54225169-54225191 ATGAAGAGAACCATTAAGAATGG + Intergenic
1138412154 16:56849269-56849291 CAGCAGGGAAACATTGAGAAGGG + Intronic
1138468482 16:57211915-57211937 GTGCAGAAAAACATTGTGGACGG + Intronic
1138873314 16:60919421-60919443 ATTAAGAAAAACATTAAAAAAGG + Intergenic
1139572269 16:67820774-67820796 ATGGAGAGAAACATTAGGAAGGG + Intronic
1139820493 16:69717319-69717341 CTGCAGGAACACATTCAGCAGGG + Intronic
1140324903 16:73992138-73992160 CCACACAAAAACATTCAGAAAGG + Intergenic
1140741879 16:77948661-77948683 CTCCAGAAAAATAGTGAGAAAGG - Intronic
1140755080 16:78059541-78059563 ATGTAGAAAAATTTTAAGAAGGG - Intronic
1142062152 16:88037435-88037457 CTGCAAATAAACATTTAGCAGGG + Intronic
1143073906 17:4323090-4323112 TTGCAGAAAACTATTAATAAAGG + Intronic
1143744361 17:8980323-8980345 CTACAAAAAAACAGAAAGAAAGG + Intergenic
1146906402 17:36621084-36621106 CTGCAGAATAACAATAACAGGGG + Intergenic
1148632563 17:49122629-49122651 CTGCTGAAAAATTTAAAGAAAGG - Intergenic
1149360728 17:55892801-55892823 CTCCATAAAAACAAAAAGAATGG - Intergenic
1149930609 17:60751061-60751083 CTACAGAAATACCTTTAGAAAGG - Intronic
1152330987 17:79672918-79672940 CTGCAGGGAAACAGTAAGAAGGG + Intergenic
1152686673 17:81697059-81697081 TTACAGAAAAGCAGTAAGAATGG + Intronic
1154318099 18:13322185-13322207 TTACATAAAAAAATTAAGAAGGG - Intronic
1155601561 18:27554564-27554586 CTACTGAAAAACATCAAGGATGG - Intergenic
1155639294 18:27994708-27994730 CTCCAGAAATCCCTTAAGAATGG - Intronic
1156014476 18:32532553-32532575 CTGAAGAAAAAAATAAAGCAAGG - Intergenic
1157181638 18:45503504-45503526 AGGCAGAAAAGCATTAAGACAGG - Intronic
1157651604 18:49338272-49338294 ATGAAGAAAAACATTTAAAAAGG + Intronic
1158122146 18:54060201-54060223 CTCCAGAGAAACATAAATAATGG + Intergenic
1158864399 18:61624264-61624286 CTGCTGAAAAACTTAAAGAAAGG + Intergenic
1158982334 18:62775459-62775481 CTGCACAAAAGTAATAAGAATGG - Intronic
1159071751 18:63630962-63630984 CTACAGAAAATCATTCACAAAGG + Intergenic
1160301141 18:77679695-77679717 ATGCAGAAAAATGTTAATAATGG + Intergenic
1160420535 18:78740892-78740914 CTGCAGGAAAACCTTAATAATGG + Intergenic
1161440177 19:4286885-4286907 AAACAAAAAAACATTAAGAAAGG + Intronic
1163481739 19:17560547-17560569 CTGCAAAACAACATTAAGGATGG - Intronic
1164070545 19:21764157-21764179 CTGCAGAAGAAATTTAATAACGG - Intronic
1164411292 19:28007866-28007888 CTGCAGAAAACCAGTATGAAAGG + Intergenic
1164765720 19:30765962-30765984 TTGCACATACACATTAAGAATGG + Intergenic
1164912631 19:32025292-32025314 TTTCAGAAAAACATCAGGAAAGG + Intergenic
1165090487 19:33385416-33385438 CAGCAGAAAACCTTAAAGAATGG + Intergenic
1165644566 19:37424433-37424455 CTGAGGAAAGAAATTAAGAATGG + Intronic
1166616209 19:44249612-44249634 TTGCAGAAAAATAGTAAGATTGG - Intronic
1167535378 19:50047581-50047603 CTGGAGAAAAACTGTAAAAAAGG - Exonic
1168134491 19:54341333-54341355 CTGCAGAAAAAAACTGAGATAGG - Intergenic
1168507566 19:56949506-56949528 GTGCAGAAAAATAGTTAGAAAGG - Intergenic
925375065 2:3378378-3378400 CTGCAGAAATGCATTAGGCATGG - Intergenic
928145347 2:28769602-28769624 CTGCAGAAAGAAATGAACAATGG + Intronic
928981020 2:37135212-37135234 CTGATGAAAAACTTAAAGAAAGG + Intronic
929037653 2:37710026-37710048 CTGCTGAAGAAAACTAAGAATGG + Intronic
931000756 2:57779496-57779518 CTGCAGAAGAACAGTAAGGATGG - Intergenic
931787648 2:65634754-65634776 CTGGAGAAAAACAGTCAGATTGG + Intergenic
933211664 2:79577588-79577610 CTACAAAAAAAAATTTAGAATGG - Intronic
935463445 2:103366083-103366105 GCCCAGAAAAACATTAAAAATGG - Intergenic
935871894 2:107459764-107459786 ATGCAGAAATACATTCAGTAGGG + Intergenic
937858119 2:126687349-126687371 CTGAAGAAAAACACTAGGACTGG - Intronic
938733798 2:134167727-134167749 CTGCAAATGAACATTAAAAATGG + Intronic
939240158 2:139547980-139548002 CTGTAAAAAAAAATTCAGAAGGG - Intergenic
939326355 2:140694496-140694518 CTGCAGAAGATCATGAAAAAGGG - Intronic
939921670 2:148123089-148123111 CTTCAGAAAACCATTAGGATTGG - Intronic
941220268 2:162769785-162769807 TTGAAGCAAAACATTAAAAACGG + Intronic
941439082 2:165511049-165511071 GTGAAGAAATACATCAAGAAAGG + Intronic
941617911 2:167742410-167742432 GTGTAGAAAATCTTTAAGAAAGG + Intergenic
942184650 2:173413623-173413645 CTGCAGCAAAACACCAACAATGG - Intergenic
942749514 2:179271811-179271833 ATGCAGAAAAATATCAGGAATGG + Intergenic
943232361 2:185271160-185271182 AGGCAGAAAAACATGAAAAAGGG + Intergenic
944312341 2:198247626-198247648 TTGCAGAAAATCATTTAGAAAGG + Intronic
944409130 2:199419897-199419919 CTGAAGAAAAAAATAAATAAAGG + Intronic
944409236 2:199421095-199421117 CTCCAGAAATACACTCAGAAGGG + Intronic
944969107 2:204971196-204971218 CTTCAGGAAAACGTAAAGAAAGG + Intronic
945001706 2:205358097-205358119 CAGGAGACAAAAATTAAGAATGG - Intronic
945439017 2:209855941-209855963 ATACAGAAAAATATTAATAAGGG - Intronic
946583214 2:221153318-221153340 TTGCAAAAAAGCATTAGGAAAGG - Intergenic
946830670 2:223725280-223725302 CTGCAGATAAAGCTTCAGAAAGG + Intergenic
947585773 2:231355775-231355797 CTGGAGAAAAACATGAAAAACGG - Intronic
948474174 2:238205978-238206000 CTGCTAAAAAACTTAAAGAAAGG - Intergenic
948564910 2:238878602-238878624 CTGCAGAAAAAGATCAACAGGGG - Intronic
1168992934 20:2110065-2110087 CAGCACAAAATCATTGAGAATGG + Intronic
1169718862 20:8650159-8650181 CTTAAAAAAAACATCAAGAAGGG - Intronic
1170589144 20:17758040-17758062 CTGCAGATAAGCAATAAGCAAGG + Intergenic
1171253332 20:23667382-23667404 CTGCAGAAAGCCAGCAAGAATGG + Intergenic
1171840080 20:30199239-30199261 CTACAAGAAAACATAAAGAAAGG - Intergenic
1172325232 20:34029431-34029453 CTGTTGCAAAACATAAAGAAAGG + Intronic
1172793505 20:37522035-37522057 CTGCAGAAAAAAATTAGACAAGG + Intronic
1172862360 20:38064678-38064700 GGGTGGAAAAACATTAAGAAAGG - Intronic
1173043504 20:39488212-39488234 CTGCTGAAAAAGTTAAAGAAAGG + Intergenic
1173393757 20:42659043-42659065 ATACAGAAAAACACTAAAAAAGG - Intronic
1173432194 20:42998335-42998357 CCGCAGAATCATATTAAGAAAGG - Intronic
1173597993 20:44272148-44272170 GTGCAGAACAACATGGAGAAGGG + Intronic
1174223121 20:48973468-48973490 CTGCAGAGAAAAATAAAGCAGGG + Intronic
1175035327 20:55995062-55995084 CTGCAGGAAGGCATTAAGATTGG - Intergenic
1175662705 20:60829685-60829707 AGGCAGAAAATCAGTAAGAAAGG - Intergenic
1175774881 20:61646765-61646787 CTGCAGAAACACTTCAAGGAAGG + Intronic
1176581927 21:8538283-8538305 CTACAAGAAAACATAAAGAAAGG + Intergenic
1177250956 21:18590335-18590357 CTGGAGAAAAACACTAAACAAGG + Intergenic
1178158974 21:29888578-29888600 CTGTAATAAAACCTTAAGAAGGG - Intronic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1180198807 21:46212815-46212837 CTGCAGACAGACATCGAGAACGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182932274 22:34186473-34186495 ATGGAAGAAAACATTAAGAATGG - Intergenic
1184186555 22:42868890-42868912 CTGCAGAGAAACAGGCAGAACGG - Intronic
949096980 3:97828-97850 CTGCAAAAAAAAATCAAGACAGG - Intergenic
951078072 3:18421369-18421391 CAGCAGAAACACTTTAATAAAGG + Intronic
951379964 3:21970778-21970800 CTAAAGACAAACATAAAGAAAGG + Intronic
951502972 3:23411096-23411118 CAGAACAAAAACATTAGGAAAGG + Intronic
951545851 3:23824453-23824475 CTGCAGAAAGATTTTAAGAGTGG - Intronic
951956493 3:28261259-28261281 CTACAGAAAAGCATGAAGAATGG - Intronic
952048479 3:29354169-29354191 TTGAAGAAAAACACTAAGAAAGG - Intronic
952511929 3:34066968-34066990 CGGGAGAAAAATATTAATAAGGG + Intergenic
952838346 3:37623963-37623985 ATGCAGAGAAATAGTAAGAAAGG + Intronic
953190441 3:40681709-40681731 AAGCAGAAAAACCTTTAGAATGG + Intergenic
953574263 3:44100387-44100409 CTGCAGAAAAACCCTCTGAAGGG + Intergenic
955090632 3:55747026-55747048 CTACAGAAAAAAATTGAAAAGGG - Intronic
955463207 3:59208336-59208358 CTACAGGAGAACAGTAAGAAAGG + Intergenic
955533995 3:59904006-59904028 CTGAAGAAAGATAATAAGAATGG + Intronic
956068015 3:65417656-65417678 ATACACAAAAACATCAAGAAAGG - Intronic
956135446 3:66093934-66093956 CTGCAGAAAATTAATAAGAGTGG - Intergenic
956402106 3:68891203-68891225 CAGCACCAAAACATTAAAAATGG + Intronic
956420386 3:69080577-69080599 CTGCAGAGCAACATTATGCACGG - Intergenic
956575785 3:70751541-70751563 CTGCAGGAAGACAGTAAGAAGGG + Intergenic
956881584 3:73516525-73516547 ATGTAGAAACACGTTAAGAAAGG + Intronic
956947655 3:74241461-74241483 AAGAAGAAATACATTAAGAAGGG - Intergenic
957348287 3:78990048-78990070 CTGCAGGAAAAAAGAAAGAAAGG + Intronic
957567625 3:81905193-81905215 ATAAAGAAATACATTAAGAAAGG - Intergenic
958188551 3:90154579-90154601 CAGCAGAAAAATATTTAGATAGG - Intergenic
958411070 3:93816416-93816438 CAGCAGAAAAATATTTAGATAGG - Intergenic
958837368 3:99160883-99160905 CTTCTGTAAAATATTAAGAAGGG - Intergenic
959386804 3:105719244-105719266 GTGAAGAAAAAATTTAAGAAAGG - Intronic
959647546 3:108720899-108720921 CTTCAGAATAATAATAAGAAAGG + Intergenic
959818960 3:110709539-110709561 CTACAGAAAAACAGAAAGATTGG + Intergenic
959862636 3:111233432-111233454 CTACAGAAAAAAATTATAAAGGG + Intronic
960761382 3:121076754-121076776 ATGCTGAAAAACTTTAAAAAAGG - Intronic
962144138 3:132822043-132822065 CTGCAGATGAACAGGAAGAAGGG - Intergenic
962653234 3:137517054-137517076 CTGGAGAACAGCAGTAAGAATGG + Intergenic
964404248 3:156331893-156331915 AGCCAGACAAACATTAAGAAAGG + Intronic
964696498 3:159513794-159513816 CTGCAGAAATGCATTGATAAGGG + Intronic
964836708 3:160947255-160947277 CTGCTGAGGAACATTAAGGAAGG - Intronic
965890225 3:173504195-173504217 CTGCAGATAAACATTCTGAAGGG - Intronic
971309534 4:25513452-25513474 CTCCAAAAAAACAAAAAGAAAGG - Intergenic
971719016 4:30220571-30220593 CTTCAGAAAAGAATTCAGAAGGG - Intergenic
971943967 4:33250701-33250723 CTGCTGAAAAACTTAAAGAAAGG - Intergenic
971996483 4:33972253-33972275 CTGCAGAAAAAGGGTCAGAAGGG - Intergenic
972131248 4:35836688-35836710 TGGCAAAAAAAAATTAAGAATGG + Intergenic
972155282 4:36153603-36153625 GTGAAGAAAAACATTACGACAGG + Intronic
973996274 4:56462665-56462687 CTGAAGAACAACAGTATGAATGG + Intergenic
974563123 4:63547935-63547957 CTGCAGTCAAATATTAAAAATGG - Intergenic
975564251 4:75737241-75737263 CTTCACAAAAACAGTAAGATAGG - Intronic
976268515 4:83207363-83207385 CTGCTGAAAAACTTAAGGAAAGG + Intergenic
977087905 4:92628306-92628328 CAGCAGTAAAAGATTAAGAAGGG + Intronic
977315746 4:95445254-95445276 CAGGAGAAAAAAACTAAGAATGG - Intronic
978630283 4:110735953-110735975 CTGCAGCAGAAAATAAAGAAGGG - Intergenic
978886278 4:113769897-113769919 AAACAGAAAAACATTAAAAATGG - Intergenic
979889951 4:126079045-126079067 CAGCAGAAACATATTAAAAATGG - Intergenic
980171263 4:129292703-129292725 TTTCAGAAAAACATAAAAAATGG - Intergenic
980268983 4:130559312-130559334 ATGTATAAAAACATTAAGGAGGG - Intergenic
980452763 4:132997003-132997025 CTTCAGAAACACATAAAGCAAGG - Intergenic
981101701 4:140836144-140836166 GTGAAGAAAAACATTTAAAAGGG - Intergenic
981446383 4:144843265-144843287 ATGAAGAAAAACAGTAAGAAAGG + Intergenic
983087327 4:163463103-163463125 ATGAATAATAACATTAAGAATGG + Intergenic
983268973 4:165538951-165538973 CTACGGAAAAATATGAAGAAGGG - Intergenic
983464114 4:168065219-168065241 CTGAAGTAGAAAATTAAGAAAGG + Intergenic
984027229 4:174557695-174557717 CTGCATATAGACACTAAGAAAGG + Intergenic
984065765 4:175045737-175045759 CTGTACAAAAAAATTAAGATAGG - Intergenic
984985488 4:185325104-185325126 CTGCTGAAAAACTTAAAGAAAGG - Intronic
985215010 4:187642496-187642518 CTACAGAAAATCAATAACAAAGG + Intergenic
986920824 5:12677331-12677353 CTTCAGAAAAACTTCAAGGAAGG + Intergenic
987686004 5:21202562-21202584 CTGCAAAAAAGCAATCAGAAAGG - Intergenic
988231978 5:28491174-28491196 CTCCAGAGAAAAACTAAGAATGG - Intergenic
988382516 5:30516269-30516291 CTGCAGTAAGGCATTAAGAAAGG + Intergenic
988569976 5:32355289-32355311 CTGCTGTAAAATATTAAGAAGGG + Exonic
989026763 5:37076802-37076824 ATGGAGAAAATCATTATGAAAGG - Intergenic
991315818 5:65304752-65304774 CAGCAAAAAAAAATTAAGAAAGG + Intronic
992504719 5:77375615-77375637 CTGCAGGAGGACATTAAGGAGGG - Intronic
993947242 5:94130552-94130574 CTTCACAAAAACAATGAGAATGG + Intergenic
994541224 5:101100847-101100869 CTGAAGAAAAAAACAAAGAATGG - Intergenic
994587899 5:101734268-101734290 CTGAAGAAGAAAAATAAGAAAGG - Intergenic
994624538 5:102201548-102201570 CTGCTGAAAAACTTAAAGAAAGG - Intergenic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
995369637 5:111404758-111404780 CCCCAGAAAAACCTTAACAATGG - Intronic
995457630 5:112368802-112368824 GGGCAGAAAAAAATGAAGAAAGG - Intronic
996822233 5:127642664-127642686 CTGCAAAAATAAATTAATAAGGG + Intergenic
999935077 5:156477968-156477990 GTGCAGGAAATCATAAAGAATGG + Intronic
1000750149 5:165085424-165085446 CTGAAGATAAACTTTAAGACAGG - Intergenic
1000866655 5:166522629-166522651 CAGCAGAATAACATGAAAAAGGG - Intergenic
1000980626 5:167813011-167813033 CTGCAGCAAAATAGTTAGAAAGG - Intronic
1001712666 5:173790908-173790930 GTGCAGGAAAACATGAAGAACGG - Intergenic
1002767403 6:254287-254309 ATGCAGAAAAGCACTCAGAAAGG - Intergenic
1003006614 6:2388776-2388798 GTGCAGAGGGACATTAAGAATGG - Intergenic
1003697502 6:8424988-8425010 TTGCAGAAATAAATTCAGAAAGG + Intronic
1003774460 6:9344418-9344440 CTGCAGAAAAAGAAAAAGTAAGG + Intergenic
1004005996 6:11637686-11637708 CTGCAGAGATATTTTAAGAAAGG + Intergenic
1004139195 6:13000143-13000165 CTCCAGAAAGATATGAAGAAAGG + Intronic
1004323333 6:14650568-14650590 CTGCCGAAAAATATTATGAAGGG + Intergenic
1004995025 6:21182735-21182757 CAATTGAAAAACATTAAGAAAGG + Intronic
1006243479 6:32707986-32708008 CTGCCGAAAAACTTAAAGAAAGG + Intergenic
1006243818 6:32711657-32711679 CTGCAGATAAGCATTGAAAAAGG + Intergenic
1006699529 6:35960720-35960742 CTGCAGATACACATTTACAAAGG - Intronic
1006809621 6:36811391-36811413 CTGCAGAAAAAGCTCAATAATGG - Intronic
1008364845 6:50665661-50665683 CAGAAGAAAAACTTTATGAAAGG - Intergenic
1009494021 6:64327380-64327402 ATGCTGAAAAATTTTAAGAAAGG + Intronic
1010469404 6:76208553-76208575 ATGCAGAAAAACATTACAAGAGG - Intergenic
1010500867 6:76598342-76598364 TTTCAGATAAACATGAAGAAAGG + Intergenic
1010939671 6:81901500-81901522 CTGCAGAAACTAAATAAGAAAGG - Intergenic
1011347392 6:86386780-86386802 CTACAGAAATAAATTAAGCATGG - Intergenic
1011884027 6:92070411-92070433 CTGGAAAAAAACTTAAAGAAAGG - Intergenic
1012034488 6:94115172-94115194 CTTCAGCAAATAATTAAGAATGG + Intergenic
1012269798 6:97194466-97194488 CTACAGAATTACATTAATAAAGG + Intronic
1013144180 6:107371241-107371263 CTGTAAAACATCATTAAGAAAGG + Intronic
1014282094 6:119453045-119453067 CTGAAGAAAGACATTAGGATTGG + Intergenic
1014609940 6:123529934-123529956 CAGCAGAAGCAAATTAAGAAAGG - Intronic
1014995887 6:128143785-128143807 CTCCAGCAAAATATTAAGAGGGG - Intronic
1016814467 6:148290774-148290796 CAGCAGATAAACATGAACAAAGG - Intronic
1017186311 6:151604251-151604273 CAGGGGAAAAAAATTAAGAAAGG - Intronic
1017283407 6:152647382-152647404 CTGCAGAAAAAAATAAAGTATGG - Intergenic
1017464976 6:154686510-154686532 CTGCAAAAACACTTTAAAAATGG + Intergenic
1018039545 6:159909831-159909853 CTGCAGAAAAACAATAAATAGGG - Exonic
1018069583 6:160151869-160151891 CCACAAAAAAACATCAAGAAAGG + Intronic
1020589304 7:10114374-10114396 CTTGAGAAAAATATTATGAATGG + Intergenic
1020674611 7:11166699-11166721 GTGCAGAAAAGCATTATGAAGGG - Intronic
1021162074 7:17286676-17286698 ATACAGAAAAACATTTAAAAAGG - Intergenic
1021162292 7:17289878-17289900 ATACAGAAAAACATTAAAAAAGG + Intergenic
1023172690 7:37404917-37404939 ATTCAGAAAAAAATTAAAAATGG - Intronic
1024489889 7:49968461-49968483 CTGAAGAAAAACAATAAAATTGG + Intronic
1024514006 7:50228263-50228285 ATGCAGAAAAACAGCAAGACAGG - Intergenic
1025011025 7:55398683-55398705 CTGTAGAAAGATATTCAGAAAGG + Intronic
1025288598 7:57690667-57690689 CTACAAGAAAACATAAAGAAAGG - Intergenic
1026864881 7:73817400-73817422 CTGGAGAGAAAAATTAAGAAGGG - Intronic
1027298900 7:76809301-76809323 AAGCTGAAAAACATTTAGAATGG - Intergenic
1027309235 7:76936854-76936876 TTGCAGAAAAACATTTAGAAAGG + Intergenic
1028566481 7:92238244-92238266 TTCAGGAAAAACATTAAGAATGG - Intronic
1030286424 7:107831685-107831707 TTGCAGAATAACATTAAATATGG + Intergenic
1030872952 7:114780240-114780262 CTGAATAAAAACATAAAGGAAGG + Intergenic
1031772042 7:125856179-125856201 CAGCAGAAAAATAATAATAAAGG - Intergenic
1032258163 7:130313381-130313403 CTGCTGAAAAACTTTTAAAAAGG - Intronic
1032834833 7:135662777-135662799 CTGCAGAAAAATATTGGCAAAGG - Intronic
1034120258 7:148620438-148620460 CTACAGAAAAGCTTCAAGAATGG - Intergenic
1034227673 7:149496484-149496506 CTGCAGAGAGAGACTAAGAAGGG - Intronic
1034327776 7:150252981-150253003 CTGCAGAAAAGAGTCAAGAAGGG - Intronic
1034765432 7:153716452-153716474 CTGCAGAAAAGAGTCAAGAAGGG + Intergenic
1035092759 7:156328205-156328227 CTGGAGAAGAACATAAACAAGGG + Intergenic
1035165865 7:156989442-156989464 AAGAAGAAAAACATTGAGAATGG + Intergenic
1035774647 8:2178847-2178869 CTGCAGGAAAATATTAATATCGG - Intergenic
1036279728 8:7390464-7390486 CTTTAGAAAAACCTAAAGAAAGG + Intergenic
1036341792 8:7921419-7921441 CTTTAGAAAAACCTAAAGAAAGG - Intergenic
1036409549 8:8486467-8486489 CAGGAGAAAAACAATTAGAATGG - Intergenic
1036623132 8:10441233-10441255 AGACAGAAAAACATTAAAAAAGG - Intergenic
1036914473 8:12791761-12791783 CTGGAGAAAAACAAAAATAATGG + Intergenic
1037468103 8:19180564-19180586 ATACAGAAAAAAGTTAAGAATGG - Intergenic
1038273593 8:26098558-26098580 CGGCAGCCAAACATCAAGAATGG - Intergenic
1039402825 8:37285816-37285838 TAGCAGAAAAACATCCAGAAAGG + Intergenic
1041525590 8:58801740-58801762 CTGGAGAAAGACATTCAGAGTGG + Intergenic
1042040634 8:64585398-64585420 CTGCTGAAAACCCTTTAGAAAGG - Intergenic
1042611525 8:70607100-70607122 CTCCAGAGAAAAATTAAAAAGGG + Intronic
1042918232 8:73896388-73896410 CTGCAGAAAAATAACATGAATGG + Intergenic
1044362295 8:91301256-91301278 ATGCTGAAAAGCATTGAGAAGGG - Intronic
1045565557 8:103310946-103310968 CAGAAAAAAAACATAAAGAATGG - Intronic
1046518422 8:115293206-115293228 CTGCAGAAAAACAGTTAAAGAGG + Intergenic
1046573854 8:116000669-116000691 CTGGTGAAAAACAATATGAAGGG + Intergenic
1046666314 8:117007371-117007393 CTTCAGAAAAACAATATGAGAGG - Intronic
1046802134 8:118440120-118440142 CTGCTGAAAAGCACAAAGAAAGG + Intronic
1048487201 8:134859401-134859423 GTGCAGAAGCCCATTAAGAATGG + Intergenic
1049060537 8:140273055-140273077 CTGTAAAATAACACTAAGAATGG - Intronic
1050339009 9:4617038-4617060 TTTCTGAAAAACACTAAGAAGGG + Intronic
1051508265 9:17848676-17848698 ATGCTGGAAAACATTAAGCAGGG - Intergenic
1051602439 9:18888779-18888801 CGGCACAAAAAGATGAAGAAAGG + Intronic
1051842172 9:21411005-21411027 ATCCAGAAAAATATTAATAAAGG - Intronic
1052829041 9:33199821-33199843 CCCCAGAAAAACCTTAAAAATGG + Intergenic
1053011992 9:34638817-34638839 CTACAGAAAACCTCTAAGAATGG + Intronic
1053271939 9:36756181-36756203 ATGCAGATAAACATGACGAACGG + Intergenic
1055657243 9:78463521-78463543 CTGCAGTAAACCATCAAGTAAGG - Intergenic
1056117697 9:83457332-83457354 CTGGTGAAAAAGATGAAGAAAGG + Intronic
1056926397 9:90838386-90838408 CTGCAGAGAAAAATTAGGCAGGG + Intronic
1057082677 9:92184907-92184929 CTGCAGTGAAATATGAAGAATGG + Intergenic
1057685743 9:97232836-97232858 CAGCAGGAAAACATGAACAAAGG - Intergenic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1058432646 9:104932137-104932159 CTCCAGAAAAACAGCAACAAAGG - Intergenic
1058462338 9:105194672-105194694 CTACAGTAAAAAATTAAGTAGGG - Intergenic
1058663469 9:107287186-107287208 TTGCTTAAAAACATTAAGAAAGG + Intronic
1059147533 9:111914064-111914086 CTGCAGCAGAAAATTATGAAAGG - Intronic
1203611944 Un_KI270749v1:16321-16343 CTACAAGAAAACATAAAGAAAGG + Intergenic
1185907029 X:3944454-3944476 ATGCATAAAAACGTTAAAAATGG - Intergenic
1186392830 X:9178445-9178467 CTGCTCAAAAAAATTAACAAGGG + Intergenic
1186808942 X:13167954-13167976 ATGCAGAAGGACATTCAGAACGG - Intergenic
1187114107 X:16331861-16331883 CTGCTGAAAAACATCAAGTTGGG - Intergenic
1187441511 X:19324925-19324947 ATGCACAAAATCATTAGGAATGG + Intergenic
1188764055 X:34068648-34068670 CTCCAGAAAAACATTACTAAGGG - Intergenic
1189288015 X:39865950-39865972 CTAAAAAAAAACAGTAAGAATGG + Intergenic
1191056295 X:56244654-56244676 CTGCAGCATGACATTAATAATGG - Intronic
1191595558 X:62940182-62940204 CTGCTTAAAAACAAAAAGAAAGG - Intergenic
1191617691 X:63187420-63187442 CAGCAGAAAAACAAAAATAATGG - Intergenic
1191958695 X:66675101-66675123 GAGCAGAAAAACAGTAAGAAGGG - Intergenic
1192154533 X:68734001-68734023 CTTTAGAAAAAAATTAAGCAGGG + Intergenic
1193423867 X:81316814-81316836 CTGCAGAAATACATTAGTAAAGG - Intergenic
1193535554 X:82710855-82710877 TTGCAGAGCAAAATTAAGAATGG + Intergenic
1193871280 X:86801910-86801932 CTGCAGAAAAACATGCATAATGG - Intronic
1194072410 X:89342784-89342806 CTGCAGAAAAACCATAAAGATGG + Intergenic
1194512563 X:94814130-94814152 CGGCAGAAAAACAACAAAAAGGG - Intergenic
1194740128 X:97562533-97562555 CTCAAAAAAAAAATTAAGAAAGG + Intronic
1195712802 X:107788029-107788051 TAGAAGAAAAACATGAAGAATGG - Intronic
1195802833 X:108733062-108733084 CTGCAAAGAAACTTTGAGAACGG + Exonic
1196965952 X:121055211-121055233 CTGCAGAAAAACAGAAATCAAGG - Intergenic
1198061673 X:133052111-133052133 CAGTAGAAAAGCATGAAGAATGG + Intronic
1198130033 X:133684569-133684591 GTACAGAAAAACATAAACAATGG - Intronic
1198554936 X:137782837-137782859 CTACAGAGAAACATAAAAAATGG - Intergenic
1198599843 X:138270597-138270619 GTGCATAAAAAAATTAAGCATGG - Intergenic
1198912180 X:141627051-141627073 CGGCAGACAAACATCAAAAACGG - Intronic
1199054813 X:143281094-143281116 CTGCAGAGAAACAAAAACAATGG - Intergenic
1200645014 Y:5771566-5771588 CTGGAGAAAAAAATTAAGTCTGG + Intergenic
1200658109 Y:5928384-5928406 CTGCAAAAAAAGGTTATGAAAGG - Intergenic
1200726649 Y:6678530-6678552 CTGCAGAAAAACCATAAAGATGG + Intergenic
1200727801 Y:6694306-6694328 CTGCAGAAAAACCATAAAGATGG + Intergenic
1201356259 Y:13099780-13099802 CTGCTGAAAAACTTAAGGAAAGG - Intergenic
1201377618 Y:13339959-13339981 ATGCTGAAAAACTTTAAAAAAGG + Intronic