ID: 1092581976

View in Genome Browser
Species Human (GRCh38)
Location 12:9851674-9851696
Sequence ATTTGTAACTACATTTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 2, 2: 4, 3: 28, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092581974_1092581976 -3 Left 1092581974 12:9851654-9851676 CCTTTAAACTTTGAGAATCCATT 0: 1
1: 0
2: 3
3: 31
4: 300
Right 1092581976 12:9851674-9851696 ATTTGTAACTACATTTATCTAGG 0: 1
1: 2
2: 4
3: 28
4: 376
1092581972_1092581976 29 Left 1092581972 12:9851622-9851644 CCAGCTAGAGTCACAAAAAATAT 0: 1
1: 0
2: 0
3: 18
4: 190
Right 1092581976 12:9851674-9851696 ATTTGTAACTACATTTATCTAGG 0: 1
1: 2
2: 4
3: 28
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092581976 Original CRISPR ATTTGTAACTACATTTATCT AGG Intergenic
900771744 1:4550586-4550608 ATTTGAAACAACTTTTATCAGGG + Intergenic
903388477 1:22945689-22945711 ATTAGAAACTGCATTTGTCTTGG + Intergenic
905002639 1:34685114-34685136 ATTTGTAAGTGGATTTAACTGGG + Intergenic
905376314 1:37523458-37523480 TTTTGTGAATACACTTATCTTGG + Intergenic
905382231 1:37571038-37571060 ATTTATACATACATTTTTCTAGG + Intronic
905949174 1:41932551-41932573 ATTTGTATCTTCTTTTTTCTTGG + Intronic
907750427 1:57257898-57257920 ACTTGTGACTGCATTTATTTAGG + Intronic
909301889 1:74023076-74023098 ATTAGTTACTACATTCAGCTTGG + Intergenic
910154021 1:84192862-84192884 ATTTTTAACTAAATGTATTTAGG + Intronic
910687554 1:89932927-89932949 ATTTTCTACTACATTTATATTGG + Intronic
911495732 1:98628979-98629001 AATTCTCACTATATTTATCTAGG - Intergenic
912010733 1:104958258-104958280 ATTTGTAACTACTATTTTCATGG + Intergenic
912075130 1:105864688-105864710 ATGTGTAACTACAATAATATAGG + Intergenic
912086469 1:106012705-106012727 ATTTGTAACTCGTATTATCTGGG + Intergenic
913693291 1:121300129-121300151 ATTTGTATGCACATGTATCTAGG - Intronic
913705706 1:121420221-121420243 ATTTTTGCATACATTTATCTAGG + Intergenic
914144264 1:144979951-144979973 ATTTGTATGCACATGTATCTAGG + Intronic
917399871 1:174635566-174635588 ATTAGAAACTACATTTACCTTGG + Intronic
917808402 1:178634727-178634749 ATTTTTAAATATATCTATCTTGG - Intergenic
918790967 1:188828243-188828265 ATGTGTAACTACAGTTACATTGG + Intergenic
919084140 1:192900724-192900746 ATATGTATCTTCATTTATTTAGG - Intergenic
920480613 1:206318498-206318520 ATTTGTATGCACATGTATCTAGG - Intronic
921058777 1:211564863-211564885 GTTTGTAACTAGAGTTACCTGGG + Intergenic
924273116 1:242355042-242355064 ATTTGCATCTATATTTATCAAGG + Intronic
924431538 1:244001417-244001439 TTTTAAAACTACATTTGTCTGGG - Intergenic
924899967 1:248387441-248387463 ATTTGTAGCTTCCTTTTTCTTGG - Intergenic
924920068 1:248619673-248619695 ATTTGTATATACATATATATGGG - Intergenic
1063274783 10:4553608-4553630 ATTTCTAGCTACGTTTATCCAGG - Intergenic
1064643636 10:17438335-17438357 ATTTGTAAATAAATTTATCTAGG - Intronic
1065472475 10:26096400-26096422 ATTTTTTACTACATTTATGCTGG + Exonic
1065541589 10:26774684-26774706 ATTTGTATTTAAATATATCTGGG - Intronic
1066711602 10:38241616-38241638 ATTTGCATCTATATTTATCAAGG - Intergenic
1067291347 10:44945587-44945609 ATTTATTCCTACATTCATCTAGG + Intergenic
1069191123 10:65491868-65491890 ATTTTAAACTTCATTTATTTTGG - Intergenic
1069194681 10:65536024-65536046 ATATGTCTCTACATTTATTTGGG - Intergenic
1069276558 10:66597994-66598016 TTTTGCATCTACATTTATCAGGG - Intronic
1072275216 10:93816095-93816117 ATTTCTAACTGCAATTATTTAGG + Intergenic
1074588546 10:114790924-114790946 ATTTGTAAATGCATTTTTCAGGG + Intergenic
1074647324 10:115473266-115473288 ATTTGCATTTACATTTATCAAGG + Intronic
1077682478 11:4255737-4255759 ATATGTAATTACAGTTATATAGG - Intergenic
1077687555 11:4311002-4311024 ATATGTAATTACAGTTATATAGG + Intergenic
1077692723 11:4362190-4362212 ATATGTAATTACAGTTATATAGG + Intergenic
1078924153 11:15859005-15859027 ATTGGTAAAAACATTTCTCTTGG - Intergenic
1078961954 11:16286020-16286042 ATTTGTGAGTACTTTTACCTTGG - Intronic
1079180265 11:18187165-18187187 ATATGTAATTACATTTAGATGGG + Intronic
1079746217 11:24134010-24134032 ATTTTGAAATACATTTATTTTGG - Intergenic
1079828343 11:25228399-25228421 ATTTATAATTACATTTTGCTTGG - Intergenic
1079949163 11:26780310-26780332 ATGTGTAAATACACTTTTCTTGG - Intergenic
1080695498 11:34600108-34600130 ATATCTAAGTACATTTTTCTAGG + Intergenic
1081220754 11:40457982-40458004 GAATGTAACTACATCTATCTGGG - Intronic
1085363299 11:75912619-75912641 ATTTGGAATTGCATTTATTTTGG - Intronic
1086455080 11:86953304-86953326 ATTTTTAATTACATGTATCCTGG - Intronic
1086675242 11:89598006-89598028 ATTTATACCTAGATATATCTAGG - Intergenic
1087154651 11:94889098-94889120 ATGTGTCACGGCATTTATCTAGG - Intergenic
1087296075 11:96375734-96375756 ATGTGTAACAATATTTAACTAGG - Intronic
1087586526 11:100128761-100128783 ATGTGCTACTACATCTATCTGGG + Intronic
1087819597 11:102696957-102696979 ATATGTACCACCATTTATCTGGG + Intronic
1090450104 11:126798560-126798582 ATTTGTAAGTACATTTAGCCTGG + Intronic
1091427120 12:400875-400897 ATTTGTAAAAACAGTTACCTGGG + Intronic
1091607702 12:1970119-1970141 ATTTGTATCAACAGTTTTCTTGG - Intronic
1092373339 12:7935133-7935155 ATTTTTAGTTAAATTTATCTTGG + Intronic
1092514037 12:9189133-9189155 ATTTTTAAATAGTTTTATCTAGG - Intronic
1092581976 12:9851674-9851696 ATTTGTAACTACATTTATCTAGG + Intergenic
1092629201 12:10360455-10360477 ATTTGTAACTAAATTTATTTAGG + Intergenic
1093111360 12:15156247-15156269 ATTTGTTTCTACATTCATCATGG + Intronic
1093227811 12:16506620-16506642 TTTTGTAAATACAATTTTCTTGG + Intronic
1093734976 12:22610620-22610642 ATTGGTAATTACATTCATTTGGG + Intergenic
1093830758 12:23754561-23754583 ATTTGGAATTACATGTATTTAGG - Intronic
1094559154 12:31534091-31534113 ATTTAAAAATACATTTCTCTTGG + Intronic
1095664060 12:44774154-44774176 ATCTGTAACTACCCTTAACTGGG - Intronic
1096363744 12:51010639-51010661 ATTTGTAATTAGGTTTATGTTGG - Intronic
1097485987 12:60201280-60201302 TTTTGTGATTACATTTTTCTAGG - Intergenic
1097960564 12:65528280-65528302 ATTTGTCAGCACCTTTATCTAGG + Intergenic
1098074297 12:66711320-66711342 ATTAGTAAATACATGTCTCTGGG + Intronic
1098969768 12:76839526-76839548 ATTTTTAAACAAATTTATCTAGG - Intronic
1100036344 12:90257187-90257209 CTTTGTAACCACATTTACCTGGG - Intergenic
1100218279 12:92476604-92476626 ATCTGTCAGTACATTGATCTTGG + Intergenic
1100538104 12:95530585-95530607 ATTTGAAAATACATTTATAAAGG + Intronic
1101420283 12:104545134-104545156 ATTTGTAACGAAATTCACCTTGG - Intronic
1102835144 12:116050123-116050145 ATTTATAACTAGATTGTTCTAGG + Intronic
1105562104 13:21501978-21502000 ATTTGTAACTGCAGTAAACTTGG + Intronic
1106972105 13:35153830-35153852 ATTTATAACCACAATTTTCTTGG + Intronic
1107704422 13:43085828-43085850 AATTCTACCTACCTTTATCTGGG - Exonic
1108233334 13:48373305-48373327 ATTTGAAGATACATTTAACTTGG + Intronic
1109000590 13:56797893-56797915 ATAAATAACTACATTTCTCTAGG - Intergenic
1109063148 13:57646788-57646810 ATTTATATCCACATTTGTCTAGG + Intronic
1110011761 13:70344777-70344799 ATTTATTACTGCATTTGTCTTGG + Intergenic
1110109879 13:71732680-71732702 ATTTGTAAATACAGTTTTATTGG + Intronic
1110126953 13:71955831-71955853 ATATGTATATAAATTTATCTAGG - Intergenic
1110565330 13:76951985-76952007 ATTAGTAACTTCAGTTCTCTAGG + Intronic
1110740195 13:78986026-78986048 ATTTGTAAATACTGTTATTTTGG + Intergenic
1111236834 13:85419915-85419937 ATTTTTAATTACTTCTATCTTGG - Intergenic
1111579367 13:90202811-90202833 ATTTGGAGCCACATTTATCGTGG - Intergenic
1111611244 13:90610628-90610650 ATTTGTATATATATTTATATAGG - Intergenic
1112518170 13:100074088-100074110 ATTTGTAAATACTGTTATTTAGG - Intergenic
1113233923 13:108248076-108248098 TTTTGTACCTATATTTATATGGG - Intergenic
1114299606 14:21363199-21363221 ATTTTAAATTACATTGATCTCGG - Intronic
1114904624 14:27111309-27111331 ATATATATCTTCATTTATCTTGG + Intergenic
1114936530 14:27545950-27545972 ATTTGTTCTCACATTTATCTTGG - Intergenic
1115890189 14:38017830-38017852 ATGTGTAACTACATTAACCCAGG - Intronic
1116006956 14:39303622-39303644 ATTTGTAAATATATTTATATGGG - Intronic
1116007940 14:39316706-39316728 ATTTGTTACTAAATTAAGCTGGG + Intronic
1116250739 14:42480204-42480226 TAAGGTAACTACATTTATCTAGG - Intergenic
1116333066 14:43619290-43619312 ATCTGTAACTGTATTTATGTAGG + Intergenic
1116347496 14:43812996-43813018 ATTTGTGACAACATCTGTCTGGG + Intergenic
1116662207 14:47725032-47725054 ATTTGTAACTAGGTTTGTTTTGG - Intergenic
1117258058 14:54000459-54000481 ATTTGAAACTGTATTTTTCTTGG - Intergenic
1118804893 14:69227479-69227501 TTTTGTATGTACATTTTTCTAGG + Intronic
1119602755 14:75988102-75988124 ATTTGTAACTGCATTTCTTTGGG + Intronic
1119967040 14:78928232-78928254 ATCTGTAACTACCTTTGCCTGGG - Intronic
1120527873 14:85598721-85598743 TGTTGTCACTTCATTTATCTAGG - Intronic
1121354911 14:93206504-93206526 ATTTATCACTATATTTATTTGGG - Intronic
1121397493 14:93639407-93639429 AATTGTGTCTTCATTTATCTTGG + Intronic
1121913900 14:97818734-97818756 ATTTGTAAATGTATTTATTTAGG + Intergenic
1126360272 15:47838392-47838414 CTATGTATTTACATTTATCTGGG + Intergenic
1127514673 15:59681331-59681353 ATTTGTATTTACAATTATATTGG - Intronic
1128962040 15:72016318-72016340 ATTTGGAACTACATAGATTTTGG - Intronic
1129032142 15:72627171-72627193 CTTTTTAAATACATTTATTTAGG - Intergenic
1129406910 15:75325911-75325933 CTTTTTAAATACATTTATTTAGG - Intergenic
1129470111 15:75748775-75748797 CTTTTTAAATACATTTATTTAGG - Intergenic
1129649562 15:77473206-77473228 ATATATAATTACATTTATATAGG - Intronic
1129734913 15:77954361-77954383 CTTTTTAAATACATTTATTTAGG + Intergenic
1129840678 15:78741635-78741657 CTTTTTAAGTACATTTATTTAGG - Intergenic
1130765003 15:86860996-86861018 ACTTGGAACTGCATTGATCTAGG - Intronic
1131644002 15:94322527-94322549 TTTTGTAAATAAATTTATATTGG - Intronic
1131700128 15:94926342-94926364 ATTTGTAAGTAAATTATTCTGGG + Intergenic
1131765662 15:95673125-95673147 AATTTTAACTCCATTTATATTGG + Intergenic
1131816331 15:96224704-96224726 ATTTGTAACCACCTTGCTCTAGG - Intergenic
1133569573 16:7027569-7027591 ATTTCTAAGTACATTAGTCTTGG - Intronic
1133601477 16:7343919-7343941 ACTTGTAAATACATTTATTGAGG - Intronic
1133718650 16:8473507-8473529 ACTTGTATTTTCATTTATCTTGG - Intergenic
1134391826 16:13826966-13826988 ATTTTTAGTTACATTTTTCTTGG - Intergenic
1134401724 16:13916284-13916306 ATTTATATCTAAATATATCTAGG + Intergenic
1135152506 16:20021303-20021325 ATGTGTAACTACTTTGATTTTGG + Intergenic
1135794466 16:25427851-25427873 ATTTGTAGCTACATTTAATAAGG + Intergenic
1138935594 16:61718047-61718069 ACTTGTAACTAGGCTTATCTGGG - Intronic
1139068747 16:63354187-63354209 GTTTGTAACTCAATTTATGTAGG - Intergenic
1139069667 16:63364844-63364866 ATTTGAAAATAAATTTATTTAGG + Intergenic
1139730883 16:68944225-68944247 ATTTGTAATTAAACTTATCTAGG + Intronic
1140101042 16:71917071-71917093 ATCTGTGTCTACATTGATCTGGG + Exonic
1140231864 16:73123911-73123933 ATTTGCCAGTACATTGATCTTGG + Intergenic
1140616501 16:76670899-76670921 ATTTGTTATTACAATTATCATGG + Intergenic
1145966265 17:28920151-28920173 ATTTGTAACTACAATACTCCTGG + Intronic
1148112236 17:45151741-45151763 ACTTGTATGTACATTTTTCTGGG + Exonic
1148571383 17:48672184-48672206 ATTTGTAATTATAATTATTTAGG - Intergenic
1149117696 17:53117775-53117797 TTTTGTATCTACATTCATCAGGG + Intergenic
1153553642 18:6287135-6287157 ATTTGTAACTAAATTTATCTAGG - Intronic
1153606001 18:6833767-6833789 TTTTGTAATTACTGTTATCTTGG + Intronic
1154077849 18:11222600-11222622 GTTAGTAACTACATTTCTGTGGG - Intergenic
1154148444 18:11886207-11886229 ATTTCTAAATACATTTAAGTTGG + Intronic
1155460390 18:26073879-26073901 ATTGTTAACTGTATTTATCTAGG + Intronic
1156695931 18:39767566-39767588 ATATGTATCTACATTTATTTCGG - Intergenic
1157629803 18:49083178-49083200 GTTTGTAAGTACAGTTTTCTTGG - Intronic
1157634933 18:49142865-49142887 ATTTATAACTTTATTTAACTGGG - Intronic
1159018684 18:63124740-63124762 GTGTGTAACCACATTTGTCTGGG + Exonic
1159220170 18:65450724-65450746 TTATGTGACTGCATTTATCTAGG - Intergenic
1159276554 18:66230205-66230227 ATTTGAAATTAAATTTAACTCGG + Intergenic
1159497830 18:69228921-69228943 ACATGTAACTATATTTACCTCGG - Intergenic
1159929941 18:74300138-74300160 ATTTGTAACTAAATTTATCTAGG - Intergenic
1161756511 19:6137963-6137985 ATTTGTAAACACTTTTATCGTGG + Intronic
1165682833 19:37792070-37792092 ATCTGTGTCTACATTGATCTGGG + Intronic
1166126651 19:40718772-40718794 ATTTGTATGTACATTTTTCTAGG + Intronic
1166260678 19:41638579-41638601 ATTTTTAGCTTCATTGATCTTGG + Intronic
925534035 2:4897022-4897044 ATTTGCATCTACATTCATCAGGG - Intergenic
926493207 2:13551237-13551259 AGTTGTGACTACTTTCATCTAGG + Intergenic
926583420 2:14657666-14657688 ATTTCTAACTAGATTCATCATGG - Intergenic
927071382 2:19533285-19533307 ATTAATAACAACATTTATTTTGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929126140 2:38524175-38524197 ATAAGCAACAACATTTATCTTGG - Intergenic
929182024 2:39051468-39051490 ATTTGCAAATACATTTCTCTAGG + Intronic
929207958 2:39319742-39319764 CTTTGTAATTTCATTTGTCTAGG - Intronic
929338908 2:40788355-40788377 AATTGTAACCACATCTATATTGG + Intergenic
929747376 2:44672872-44672894 ATTTTTAGCTATATTTTTCTAGG + Intronic
929985058 2:46721688-46721710 ATTTGTAACTACATATATTTTGG - Intronic
930539228 2:52683433-52683455 ATTTGTGTCTACATTCATCAAGG - Intergenic
931075643 2:58708572-58708594 ATTTGTAACTACATTAATATTGG + Intergenic
931354557 2:61524253-61524275 ATTTGTAACTATATTTATGGTGG - Intronic
932863685 2:75319954-75319976 ATTTTTAAATGCATTAATCTAGG - Intergenic
933210783 2:79566138-79566160 AATTGAAACAACATTTGTCTAGG + Intronic
933295228 2:80482537-80482559 TTTTGTAAATACAGTTTTCTTGG - Intronic
935813270 2:106821268-106821290 ATCTCTAACTTTATTTATCTGGG - Intronic
937512839 2:122617014-122617036 GTATGTAACTAAATTTAACTTGG - Intergenic
937556100 2:123158551-123158573 AATTGTAAATTCATTTATCCAGG + Intergenic
937705151 2:124911988-124912010 ATTTGCAACTACAGTTCTGTGGG - Intronic
938111131 2:128565810-128565832 ATCTGTAAATTCATTTAACTGGG - Intergenic
938638566 2:133255264-133255286 ATTTATAAGAACATTTATCCTGG - Intronic
940980000 2:159990851-159990873 ATTTGAAACCAGATTTATTTGGG + Intronic
941145371 2:161837448-161837470 ATGTGTATCTTCATTTATTTAGG - Intronic
942032323 2:171974987-171975009 ATTTGTATCTACATTCATGAGGG + Intronic
942937379 2:181574553-181574575 ATTTGATACTACAATTTTCTGGG + Intronic
943595469 2:189850085-189850107 ATCTTTAACTACTTTTATGTGGG + Intronic
943718307 2:191176550-191176572 ATTTATAAATACATTTATGCAGG + Intergenic
943861672 2:192872822-192872844 ATCAGTAGCTATATTTATCTAGG - Intergenic
943916318 2:193637957-193637979 ATATGTAACTATATTTTTCCAGG + Intergenic
943990889 2:194690746-194690768 ATCTGTAAATACATTAATTTTGG + Intergenic
944074248 2:195709695-195709717 TTTTGTTACTACATTTATTTTGG + Intronic
944498789 2:200336003-200336025 ATTTGTAAATCCAGTTAACTAGG - Intronic
944771405 2:202917692-202917714 ACAGGTAACTACATGTATCTTGG - Intronic
946624731 2:221598894-221598916 ATTTAAAACAACATTTATTTGGG - Intergenic
947099148 2:226600647-226600669 ATATGAAACTTCATTTATTTTGG - Intergenic
947167929 2:227281566-227281588 ATTTCTAAATACATTTTTCCAGG - Intronic
1169518746 20:6347959-6347981 AGTTGTCATTACATTTAGCTTGG + Intergenic
1170221396 20:13946129-13946151 ATTAGGAAATAAATTTATCTAGG + Intronic
1170399403 20:15964147-15964169 ATATGCAACTACATTTTTCAGGG + Intronic
1170708843 20:18770582-18770604 ATTTGTAACTGCCTTTCTTTTGG + Intergenic
1171301772 20:24067839-24067861 ATTTGTGTATACATTTTTCTGGG + Intergenic
1175311671 20:58016626-58016648 TTTTGTAACTATGTTAATCTTGG - Intergenic
1176691157 21:9911368-9911390 ATTTGTCAGTTCATTTATCTAGG - Intergenic
1177320273 21:19512162-19512184 ATTTGAAAATAAATGTATCTGGG + Intergenic
1177545468 21:22552106-22552128 TGTTTTAAGTACATTTATCTTGG - Intergenic
1177711694 21:24784067-24784089 ATTTGTTGCTACGTTGATCTTGG - Intergenic
1177747300 21:25233761-25233783 ATTTTTATCTACATTTATGAAGG + Intergenic
1180114757 21:45694647-45694669 ATTTGTAAATAAATTTAGCAAGG + Intronic
1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG + Intronic
1184350758 22:43942268-43942290 ATCTGTAGCTTCATTTTTCTTGG + Intronic
949225851 3:1694712-1694734 GTTTATATCTACATTTATGTAGG - Intergenic
952275841 3:31875830-31875852 ATTTCAAAATGCATTTATCTAGG - Intronic
954960119 3:54557152-54557174 ATTTGAAATAACACTTATCTTGG - Intronic
955444585 3:58996047-58996069 ATTAGTAATTATATTAATCTGGG - Intronic
955569499 3:60289325-60289347 TTCTGTAAATCCATTTATCTAGG - Intronic
956478475 3:69648862-69648884 ACTTGTGCATACATTTATCTGGG + Intergenic
956536647 3:70284247-70284269 ATTAGCAAGTACACTTATCTTGG - Intergenic
957943017 3:87028677-87028699 ATTTGAAAATAAATTCATCTGGG + Intergenic
958437919 3:94120939-94120961 AGTTGTAACTACATTCATTTTGG - Intronic
959763369 3:109995121-109995143 TTTAAAAACTACATTTATCTTGG - Intergenic
962412652 3:135154667-135154689 ATTTATAAATAAATTTATTTTGG - Intronic
963645488 3:147908588-147908610 ATTTGTTACTACTTCTGTCTTGG - Intergenic
964250494 3:154710861-154710883 ATTTGGAACCACATATACCTTGG + Intergenic
964366913 3:155960369-155960391 TTTTGTAACAACATTTGGCTGGG + Intergenic
964832765 3:160903904-160903926 ATTGATACCTATATTTATCTTGG + Intronic
964991346 3:162816142-162816164 ATTTCTAATTATACTTATCTGGG + Intergenic
965301119 3:167006180-167006202 ATTTGTAGTTATATTTATTTAGG - Intergenic
965515693 3:169619141-169619163 ATTTGTACCTGAATTTATCGTGG + Intronic
966473270 3:180316686-180316708 ATTAGTTACTTCATTTCTCTAGG + Intergenic
967583129 3:191183597-191183619 ATGTTTACCTACATTTATCATGG - Intergenic
972069054 4:34992019-34992041 GTTTGAAAATACATTTATATAGG + Intergenic
972336499 4:38111512-38111534 ATTTCTAACTAATTTTATTTTGG - Intronic
973283938 4:48393791-48393813 AATTGGAACCACTTTTATCTTGG + Intronic
974243069 4:59277267-59277289 ATTTCTAATTATATTTATTTGGG - Intergenic
974616593 4:64292481-64292503 ATTTCTTTCTAAATTTATCTGGG - Intronic
976021254 4:80629903-80629925 ATTTTTAAATAAATTTTTCTGGG - Intronic
976361861 4:84188971-84188993 ATTTAACACTACATTTTTCTAGG - Intergenic
977153661 4:93545989-93546011 ATTTGTAACCACATCTCTTTAGG - Intronic
977202836 4:94137130-94137152 ATTTGTATCTTCCTTTTTCTCGG - Intergenic
977470337 4:97435324-97435346 ATTTTAAAATACATTTATATTGG - Intronic
978322446 4:107512954-107512976 ATTTGTAAGTACATTTTTGCTGG + Intergenic
978935435 4:114369123-114369145 ATTTATTACTACAATTTTCTTGG + Intergenic
978937084 4:114390665-114390687 ATCTATAAATACATTTAACTGGG - Intergenic
980030197 4:127819286-127819308 AGTTATAACCACATTCATCTGGG - Intronic
980462368 4:133132238-133132260 CTTAGTAAATACAATTATCTGGG + Intergenic
980837139 4:138209325-138209347 ATTGGGAAACACATTTATCTTGG + Intronic
980940245 4:139267264-139267286 TTTTGCAAATACAATTATCTAGG - Intronic
981696136 4:147560936-147560958 ATATTTATCTACAGTTATCTGGG + Intergenic
981793442 4:148566869-148566891 ATATGTATTTATATTTATCTAGG - Intergenic
982411749 4:155085599-155085621 ATTTGTAATTAGTTTCATCTGGG - Intergenic
983294464 4:165848692-165848714 ATTTGTCATTATCTTTATCTGGG + Intergenic
983670902 4:170236818-170236840 ATTTGAAACTTCTTTTGTCTTGG + Intergenic
983910174 4:173229859-173229881 ATTTTTATCTCCATTTTTCTTGG + Intronic
984132478 4:175895554-175895576 ATTAGTAACTATATATCTCTTGG - Intronic
984271647 4:177555423-177555445 CTATGTATCTCCATTTATCTAGG + Intergenic
984356141 4:178661523-178661545 GTTTGTAACTGTATTTATTTTGG + Intergenic
986220013 5:5760387-5760409 GGATGTAACTACATTTCTCTAGG - Intergenic
988038029 5:25852936-25852958 ATTTATTAATACATTTATCTTGG - Intergenic
989295310 5:39818702-39818724 ACATGTAAATAGATTTATCTTGG - Intergenic
989440682 5:41469296-41469318 TTTTGTTTCTACATTTATCAAGG + Intronic
989664674 5:43840304-43840326 ATTTGTAACTACCTGTAAATAGG - Intergenic
989716048 5:44464734-44464756 ATTTGCATCTACATTCATCAAGG + Intergenic
990660890 5:58014057-58014079 ATCTGTAAATACATTGAACTGGG + Intergenic
991318622 5:65341911-65341933 TTTTGTGTCTACATTTATCAGGG - Intronic
991475353 5:67012565-67012587 CTTTGTATCTACTTTCATCTAGG - Intronic
991986495 5:72292384-72292406 ATTTCTAAGTACTTTTATTTGGG - Intronic
992345425 5:75871354-75871376 ATTTGTTACTATATTTAGATGGG + Intergenic
992476443 5:77106735-77106757 ATTTGTACCTCCATTTATTTAGG + Intergenic
992482944 5:77169135-77169157 AGTTTTCACTACATTTACCTTGG + Intergenic
992921892 5:81533453-81533475 ATTTGTGTCTACATTTATGAGGG - Intronic
994334948 5:98553392-98553414 TTTTTTAACTATATTTTTCTTGG + Intergenic
994549665 5:101215351-101215373 TTTTGTAACTATAATTATCAGGG - Intergenic
994717024 5:103334089-103334111 ATTATTAACTACAGTTATTTGGG - Intergenic
994813408 5:104552848-104552870 ATTTGTAACTAAATGTATTGTGG - Intergenic
995911681 5:117195236-117195258 ATTTGTAAATACAGTTTTATTGG + Intergenic
996190255 5:120531627-120531649 GTTTGTATCTTCATTTATTTAGG + Intronic
996346897 5:122497384-122497406 ATTTATACCTACACTCATCTAGG + Intergenic
996832983 5:127760064-127760086 ATATGTAACTATATTTTGCTAGG - Intergenic
997059569 5:130485305-130485327 AATTTTAAATACATTTATCTTGG + Intergenic
998505828 5:142671653-142671675 ATTTCTAAATTCATTTTTCTTGG + Intronic
999487312 5:152010143-152010165 ATTTGGAGCTTCATTTATGTTGG + Intergenic
999623438 5:153495119-153495141 ATTTGTAACAACATTATTTTAGG - Intronic
1000378880 5:160611002-160611024 ATATGTAACTACATTAAACTAGG + Intronic
1000711721 5:164587788-164587810 ATTTGTATCTACATATATATGGG - Intergenic
1001907166 5:175482453-175482475 ATTTGAAATAAAATTTATCTTGG + Intronic
1003372999 6:5546794-5546816 ATTGATAAATACAGTTATCTGGG - Intronic
1004975684 6:20963562-20963584 ATTTATAAGTTCATTTATTTTGG - Intronic
1004980074 6:21013375-21013397 ACTTTTAAGTACATTTATGTGGG + Intronic
1005433039 6:25778739-25778761 ATTTCTAACTACAATGATCAAGG + Intronic
1005517333 6:26567397-26567419 AATTGAAAGTACATTTAACTTGG - Intergenic
1005893980 6:30162826-30162848 AGTTTCAACCACATTTATCTAGG - Intergenic
1006751717 6:36382297-36382319 ATTTTTAAAAATATTTATCTTGG + Intronic
1006877993 6:37315212-37315234 ATTTTTAAGTATATATATCTTGG + Intronic
1007697311 6:43741921-43741943 ATTTCTATCAACATTTGTCTTGG + Intergenic
1007902830 6:45426357-45426379 CTTTGTCACTAGAATTATCTAGG - Intronic
1008334788 6:50289501-50289523 ATGTGTATCTATATTTATATAGG - Intergenic
1009480181 6:64147343-64147365 ATTGGTAACTACATTTTATTTGG - Intronic
1009513898 6:64589178-64589200 ATTTGTAATTAATTTTATCATGG + Intronic
1009692159 6:67049226-67049248 ATCTGTAACTACAGTTAGATAGG - Intergenic
1009831229 6:68938642-68938664 ATATGTAATCACAGTTATCTAGG - Intronic
1009845985 6:69135420-69135442 AAAGGTAACTACATTTTTCTTGG - Intronic
1010643658 6:78360968-78360990 ATTTGCAACTACATTTTCCCTGG + Intergenic
1010706139 6:79113108-79113130 ATATTTACTTACATTTATCTAGG - Intergenic
1012133257 6:95521436-95521458 AATTCTAACTAAATTTATCTAGG - Intergenic
1012935245 6:105360788-105360810 TTTTGTAAAAACATTTATTTGGG - Intronic
1013565960 6:111362142-111362164 ATTTATCACTTAATTTATCTAGG + Intronic
1013707445 6:112854849-112854871 ATTTATCACTAGATTTCTCTGGG - Intergenic
1013950499 6:115775538-115775560 ATATATAACTACAGTTATATAGG - Intergenic
1014190522 6:118490601-118490623 ATGTGTGTCTTCATTTATCTTGG - Intronic
1014581357 6:123141323-123141345 ATTTGTAAAAACATTTTTTTAGG + Intergenic
1015295393 6:131585599-131585621 GTTAGCAGCTACATTTATCTAGG - Intronic
1015353343 6:132248350-132248372 ATGTGCACCTACATTTTTCTGGG + Intergenic
1015434926 6:133174101-133174123 ATATGTGAAAACATTTATCTAGG + Intergenic
1015555579 6:134458297-134458319 ATTTGTTGCTACATTTATTGAGG - Intergenic
1016345323 6:143106816-143106838 ATCTGTAAGTACCTTTATCTTGG - Intronic
1016408096 6:143752749-143752771 ATTTTTTACTACTCTTATCTTGG - Intronic
1016698520 6:147027096-147027118 ATTTGTAAATATATTTACTTAGG - Intergenic
1018749038 6:166786253-166786275 ATTTTTAAAGACATTTTTCTGGG - Intronic
1018781741 6:167074265-167074287 ATTTTTAACTTCATTGATTTTGG - Intergenic
1019214131 6:170431879-170431901 ATTTTTATAAACATTTATCTAGG + Intergenic
1019961159 7:4461020-4461042 ATTTGTAGCTTCATCTGTCTAGG + Intergenic
1020372994 7:7454882-7454904 ATTTATTTATACATTTATCTTGG + Intronic
1020695219 7:11405825-11405847 TGTTTTGACTACATTTATCTAGG + Intronic
1021618543 7:22527952-22527974 ATTTGTAACAACATTTCTTTAGG + Intronic
1021740097 7:23678372-23678394 ATGTGTAGCTAAATTGATCTAGG - Intergenic
1022147514 7:27559897-27559919 ATTTAAAACTACAGTTATATTGG - Intronic
1022928143 7:35077393-35077415 ATTTGTAACAACATTTCTTTAGG + Intergenic
1023740901 7:43279754-43279776 ATTTGTAAGTATATTTTTATTGG + Intronic
1024408325 7:49008435-49008457 TTTTGTAATTCCATTTATCAGGG - Intergenic
1025736484 7:64152590-64152612 ATAAGTAAATCCATTTATCTTGG + Intronic
1025765180 7:64439463-64439485 ATATGTAACTACATCAATTTTGG - Intergenic
1026421452 7:70241453-70241475 AGTAGTAAGTACTTTTATCTAGG - Intronic
1027435623 7:78161355-78161377 ATTTCTAATTACATTATTCTAGG - Intronic
1027837516 7:83264120-83264142 ATTAGTATCCAGATTTATCTTGG + Intergenic
1027839937 7:83296599-83296621 ATTTGTAACAACATCGATGTTGG - Intergenic
1028374140 7:90128192-90128214 ATTTGTAACAACATTTCTTTAGG - Intergenic
1029130486 7:98326566-98326588 ATTTGTGACTGCCTTTATTTTGG - Intronic
1029872556 7:103710332-103710354 AGTTGGAAATACATTTATTTTGG + Intronic
1030864821 7:114687672-114687694 ATTTTTAAGTACATATCTCTAGG + Intronic
1030959471 7:115898460-115898482 ATTTGTAAATAAAATTATTTGGG + Intergenic
1031008823 7:116502365-116502387 TTTTTTAACTATATTTATGTGGG + Intronic
1031356691 7:120796067-120796089 CTTTGTAAATACATTTTTTTTGG - Intronic
1031609182 7:123805091-123805113 AGTTGTAAGTCCATTTATTTAGG + Intergenic
1033066199 7:138156880-138156902 ATCTATAACTCCATTTATGTTGG + Intergenic
1033781574 7:144676451-144676473 ATTTTGAACTTCATTTAGCTGGG + Intronic
1035811370 8:2494327-2494349 TCTTGTAATTACCTTTATCTAGG + Intergenic
1035983342 8:4397986-4398008 ATTTTTAAATACCTTTGTCTAGG + Intronic
1036164267 8:6417730-6417752 ATTTATAACTACACTCATCGAGG - Intronic
1036568902 8:9962367-9962389 ATTTCTGACTACATGTATCTGGG + Intergenic
1036998707 8:13691080-13691102 AATTATACATACATTTATCTAGG - Intergenic
1040131049 8:43797163-43797185 ATTTGTTTCTAGTTTTATCTGGG - Intergenic
1040862417 8:52013272-52013294 ATCTGCAAATACATTTAACTAGG - Intergenic
1041038044 8:53815670-53815692 ATTTATAAATTCATTTAGCTGGG - Intronic
1041708421 8:60871174-60871196 ATTTATCATGACATTTATCTGGG - Intergenic
1042970958 8:74408583-74408605 ATTTGTCAGTACCTTGATCTTGG + Intronic
1042971917 8:74418041-74418063 ATTTGTCTCTCCACTTATCTAGG - Intronic
1043715211 8:83475235-83475257 ATTTGTATCTACATTCAACAGGG - Intergenic
1045528389 8:102961162-102961184 ATTATTTATTACATTTATCTGGG - Intronic
1046227266 8:111299360-111299382 CTTTGCAACTGCAATTATCTAGG + Intergenic
1046922024 8:119740740-119740762 ATTTATAAATATATTTATTTTGG - Intronic
1047797079 8:128268497-128268519 ATTTGTAAGTGCATATCTCTGGG + Intergenic
1048172139 8:132117405-132117427 ATTTCTATCTACATTGATCATGG + Intergenic
1048908187 8:139108810-139108832 ATTTGGAACTACATTTCTATGGG + Intergenic
1050169713 9:2802725-2802747 ATATTTAACAACATTTATGTAGG + Intronic
1050936078 9:11397082-11397104 ATTAGTAATTACATTTATTAGGG - Intergenic
1051375247 9:16395769-16395791 ATGTGTAAGTACATTTTCCTTGG - Intergenic
1051821170 9:21170585-21170607 TTTTGTATCAACATTTATCATGG - Intergenic
1052552869 9:29973353-29973375 ATTTTTAGCTACCTTTATCCAGG - Intergenic
1052651221 9:31304017-31304039 ATTTGTTACTACATGTGCCTTGG - Intergenic
1052757955 9:32560398-32560420 AAATTTAACTACATTTTTCTGGG - Intronic
1052828662 9:33196950-33196972 ATTTGTAAGTGAATTTTTCTAGG + Intergenic
1052901168 9:33796006-33796028 AGTTCTAACTTCATTTGTCTGGG + Intronic
1053153969 9:35761286-35761308 AATTGTAAAGACATTTAGCTAGG - Intergenic
1053627959 9:39896183-39896205 ATTTGTCAGTTCGTTTATCTAGG - Intergenic
1053778101 9:41570142-41570164 ATTTGTCAGTTCGTTTATCTAGG + Intergenic
1054215928 9:62354519-62354541 ATTTGTCAGTTCGTTTATCTAGG + Intergenic
1054671554 9:67800830-67800852 ATTTGTCAGTTCGTTTATCTAGG - Intergenic
1055533465 9:77211723-77211745 ATTAGTAACTACTGTTATCACGG - Intronic
1055574890 9:77650824-77650846 ATTTTTAAATAAATTTATTTTGG - Intergenic
1056025231 9:82487395-82487417 ATGTGTAAATTTATTTATCTAGG - Intergenic
1056382238 9:86065720-86065742 ATTTCTAACTTCATTTCTTTAGG - Intronic
1056880981 9:90393521-90393543 AAGTGTAACTTCATTTAACTGGG + Intergenic
1060629963 9:125147331-125147353 ATTTGTTACTCCCTATATCTAGG - Exonic
1061652766 9:132064358-132064380 ATTTGTTATTCCTTTTATCTCGG - Intronic
1061813607 9:133179278-133179300 ATTTGGAACTACAGGAATCTTGG + Intergenic
1186711847 X:12206073-12206095 ATTTGTCACCAGGTTTATCTTGG - Intronic
1188067871 X:25683544-25683566 AATTGTAATTACATGCATCTGGG - Intergenic
1189719192 X:43897781-43897803 ATATGAAACTACAGTTATCCTGG + Intergenic
1189945093 X:46169769-46169791 ATTTTTAGCTACATGTATGTTGG + Intergenic
1191849609 X:65576455-65576477 ATTTGTTACCACATTCTTCTAGG + Intergenic
1192966060 X:76178169-76178191 ATTTGTAAATAAATTTCTTTTGG + Exonic
1193594269 X:83426725-83426747 ATTTGTAAATATTTTTTTCTAGG - Intergenic
1193824601 X:86207453-86207475 ATTTTTAGCCTCATTTATCTTGG + Intronic
1193877286 X:86876036-86876058 TTTTGTATCTATATTTATCAAGG + Intergenic
1194505506 X:94729314-94729336 AATTGTAACTCCATGTATCAAGG - Intergenic
1195245335 X:102990238-102990260 ATTGGAAACTGCATTTATTTTGG - Intergenic
1195294466 X:103462124-103462146 ATCTGTAATTATCTTTATCTTGG - Intergenic
1195315781 X:103676554-103676576 AATTGCATCTACATTTTTCTTGG + Exonic
1196506336 X:116448380-116448402 ATTTGTTTCTTCATTTATCTTGG + Intronic
1196515948 X:116611260-116611282 TTTTGTATCTATATTTATCAGGG + Intergenic
1196521390 X:116676926-116676948 ATTTGTTTCTTCATTTATCTTGG - Intergenic
1196834223 X:119799848-119799870 ATCTGTAACTAAAGTTTTCTTGG - Intergenic
1197143843 X:123148400-123148422 ATTTGTATCTAGGTTTATCAGGG - Intergenic
1197582554 X:128302073-128302095 ATTTGCATCTATATTTATCAGGG - Intergenic
1197912221 X:131495506-131495528 ACTTGCAACTACATATATCTGGG - Intergenic
1198139168 X:133785512-133785534 ATCTGTATCTATATTTATATTGG - Intronic