ID: 1092585023

View in Genome Browser
Species Human (GRCh38)
Location 12:9890829-9890851
Sequence TGCACCAGAGGCTGGACCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092585019_1092585023 8 Left 1092585019 12:9890798-9890820 CCATAGTTATGAAGAAATTACAC 0: 1
1: 0
2: 0
3: 21
4: 220
Right 1092585023 12:9890829-9890851 TGCACCAGAGGCTGGACCTATGG 0: 1
1: 0
2: 0
3: 11
4: 143
1092585018_1092585023 9 Left 1092585018 12:9890797-9890819 CCCATAGTTATGAAGAAATTACA 0: 1
1: 0
2: 0
3: 24
4: 320
Right 1092585023 12:9890829-9890851 TGCACCAGAGGCTGGACCTATGG 0: 1
1: 0
2: 0
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092585023 Original CRISPR TGCACCAGAGGCTGGACCTA TGG Intronic