ID: 1092586780

View in Genome Browser
Species Human (GRCh38)
Location 12:9908637-9908659
Sequence CCTTCCACTCATGACTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 5, 1: 18, 2: 8, 3: 34, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092586780_1092586783 3 Left 1092586780 12:9908637-9908659 CCTCAAAAGTCATGAGTGGAAGG 0: 5
1: 18
2: 8
3: 34
4: 293
Right 1092586783 12:9908663-9908685 TCTTTTTATTTTTCCCATGCGGG 0: 1
1: 0
2: 14
3: 313
4: 3925
1092586780_1092586782 2 Left 1092586780 12:9908637-9908659 CCTCAAAAGTCATGAGTGGAAGG 0: 5
1: 18
2: 8
3: 34
4: 293
Right 1092586782 12:9908662-9908684 TTCTTTTTATTTTTCCCATGCGG 0: 1
1: 0
2: 18
3: 236
4: 2332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092586780 Original CRISPR CCTTCCACTCATGACTTTTG AGG (reversed) Intronic
901192216 1:7419463-7419485 TCCTTGACTCATGACTTTTGGGG + Intronic
901260925 1:7870124-7870146 CCTTCAACATATGAGTTTTGGGG - Intergenic
901946837 1:12711115-12711137 CCTTCCACTCATGACTTTTGAGG - Intergenic
902529369 1:17080748-17080770 CATTCCTCTCATGGCTTTTGGGG + Intronic
903396885 1:23008318-23008340 CCTTCCACTTATGCCTTATAAGG + Intergenic
903820857 1:26101453-26101475 CCTTCCACTTCTGCCTTGTGAGG + Intergenic
904495938 1:30886709-30886731 CCTTCCACTGAGCACTTTTCTGG + Intronic
906135789 1:43499934-43499956 ACTTCCATTCATGACTTTTGAGG + Intergenic
906695625 1:47821472-47821494 CCTTCCAGTCCTGATATTTGGGG - Intronic
909115229 1:71525298-71525320 CCTTCCTCTTAGGAATTTTGGGG + Intronic
909294050 1:73923218-73923240 CCTTCAACATATGAATTTTGTGG - Intergenic
910275169 1:85441944-85441966 CCTACCACTCAAGACTTTCACGG - Intronic
911797377 1:102091680-102091702 CCTTCCACTCATGACTTTCAAGG - Intergenic
912255988 1:108058687-108058709 ACTTCAACACATGAATTTTGTGG - Intergenic
912579933 1:110711406-110711428 GCTTCAACTTATGAATTTTGGGG + Intergenic
912599205 1:110910735-110910757 CCTGCTCCTGATGACTTTTGGGG + Intergenic
917152797 1:171962758-171962780 GCTTCAACACATGAATTTTGGGG + Intronic
917312088 1:173689104-173689126 CCTTCCACTCATGACTTTAGAGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917784127 1:178433971-178433993 CCTTCTACCCATTACTTTTATGG + Intronic
917842995 1:178997556-178997578 CCTTCCACTCATACACTTTGAGG + Intergenic
918167942 1:181968802-181968824 CCTTCCAGCCATGACTTAGGTGG - Intergenic
918805787 1:189041766-189041788 TATTCCACTCATGACTCTTTGGG - Intergenic
919575285 1:199301062-199301084 CCTTCCAAGCAGGATTTTTGAGG + Intergenic
921441908 1:215197615-215197637 GCTTCAACATATGACTTTTGGGG + Intronic
921741241 1:218687514-218687536 GCTTCAACACATGAATTTTGAGG + Intergenic
1062966414 10:1610933-1610955 GCTTTAACTCATGAATTTTGGGG + Intronic
1063017748 10:2095518-2095540 ACTTCGACTTATGAATTTTGGGG - Intergenic
1064771782 10:18730729-18730751 GCTTCCACATATGAATTTTGGGG + Intergenic
1065002256 10:21347753-21347775 CCTTCCACACATGACTTCCAAGG + Intergenic
1066064637 10:31753161-31753183 ACTTCAACACATGAATTTTGGGG - Intergenic
1066208497 10:33213271-33213293 CCTTCCAGCCATGACATTAGAGG - Intronic
1067156298 10:43783736-43783758 CATTCCACTCCTGACTCTGGAGG + Intergenic
1069656858 10:70096322-70096344 TCTACCACTGATGACATTTGGGG + Intronic
1073394696 10:103208190-103208212 CCTTGCCCTCATAACTGTTGTGG + Intergenic
1077289982 11:1784599-1784621 GCTTCAACACATGAATTTTGGGG + Intergenic
1079381624 11:19943278-19943300 CCTTCCCCTAATGACTTTGGAGG - Intronic
1079826151 11:25196721-25196743 ACTTCAACTTATGAATTTTGGGG + Intergenic
1080143344 11:28949017-28949039 ACTTCAACTTATGAATTTTGTGG + Intergenic
1080373093 11:31675219-31675241 ACTCCCTCTCATGACTCTTGGGG - Intronic
1080574214 11:33583559-33583581 CCTTTCCCTCTTGCCTTTTGAGG + Intronic
1080743528 11:35087171-35087193 ACTTCAACTTATGAATTTTGGGG + Intergenic
1080991958 11:37546917-37546939 CCTTCAACATATGAATTTTGGGG + Intergenic
1083375582 11:62217606-62217628 CCTTCCACTCATGACTTTTGAGG + Intergenic
1085169145 11:74433557-74433579 CATTTCCCTCATGACTATTGAGG - Intergenic
1085796749 11:79548299-79548321 CCTTTCCCTCATTCCTTTTGTGG + Intergenic
1086305721 11:85480024-85480046 ACTTCAACACATGAATTTTGTGG + Intronic
1086576191 11:88341317-88341339 CTCTCGACACATGACTTTTGGGG + Intergenic
1086938726 11:92772262-92772284 CCTTCCATACAGGACTTATGAGG + Intronic
1087779869 11:102290692-102290714 CCTTCAACATATGAATTTTGGGG + Intergenic
1088061410 11:105655559-105655581 ACTCCCACTTATGACTTATGTGG + Intronic
1088107685 11:106224631-106224653 CCTCACACTCATGACTTTCGAGG + Intergenic
1088163655 11:106905523-106905545 CCTTCAACACATAACTTTTGGGG + Intronic
1088375059 11:109132033-109132055 GCTTCAACACATGAATTTTGGGG - Intergenic
1088432957 11:109778609-109778631 ACTTCAACACATGAATTTTGAGG + Intergenic
1089075370 11:115734273-115734295 CCTTCAACATATGAATTTTGCGG + Intergenic
1089163685 11:116458627-116458649 CCTTACACTCTTGACTTTCTAGG + Intergenic
1090324011 11:125869457-125869479 CCTTCCACTCGTGACTTTTGAGG - Intergenic
1090967964 11:131614971-131614993 CCTCCCACCCTTGACCTTTGTGG + Intronic
1091634259 12:2185412-2185434 GCTTCAACACATGAGTTTTGGGG - Intronic
1092442036 12:8512913-8512935 GCTTCCACCAATGAATTTTGAGG + Intronic
1092586780 12:9908637-9908659 CCTTCCACTCATGACTTTTGAGG - Intronic
1092728944 12:11510309-11510331 GCTTCCATACATGAATTTTGGGG + Intergenic
1092767129 12:11862778-11862800 ACTTCAACTTATGAATTTTGGGG + Intronic
1093184408 12:16003386-16003408 ACTTCCACCTATGAATTTTGGGG + Intronic
1094608964 12:31974665-31974687 GCTTTCACTTATGAATTTTGGGG + Intronic
1095447812 12:42299914-42299936 GCTTCAACACATGAATTTTGGGG + Intronic
1095666924 12:44813127-44813149 TCTGCCACTCATTGCTTTTGGGG - Intronic
1096018451 12:48300688-48300710 CTTTCCACATATGACTTTTAGGG - Intergenic
1096924812 12:55132284-55132306 GCTTCAACACATGAATTTTGAGG - Intergenic
1097669439 12:62518254-62518276 GCTTCAACACATGAATTTTGGGG + Intronic
1098304651 12:69090436-69090458 TCTTTTACTCATGACTTTTGTGG - Intergenic
1099104188 12:78479572-78479594 CATTCCACTCATGACTTTCAAGG + Intergenic
1099872867 12:88370299-88370321 CCTTGCCCCCATAACTTTTGTGG + Intergenic
1102605924 12:114067140-114067162 CCTTCGACTCATGACTTTTGAGG + Intergenic
1104604942 12:130180852-130180874 CCTTCAACACATGAATTCTGGGG + Intergenic
1105212160 13:18263363-18263385 CCTTCCAGTTCTGACTTTTGAGG + Intergenic
1105225292 13:18426140-18426162 CCTTCCACTCATGGCTTTTGAGG + Intergenic
1106693399 13:32144850-32144872 CCTTCCACTCCTTACCTATGGGG - Intronic
1107401379 13:40072958-40072980 CCCTCCACTGATGACCTCTGTGG - Intergenic
1107799386 13:44089997-44090019 ACTTCAACTCATGGATTTTGGGG + Intergenic
1108040658 13:46336976-46336998 TCTTCAACACATGACTTTTGAGG - Intergenic
1109360902 13:61293542-61293564 CCTTCCACTCACCCTTTTTGGGG + Intergenic
1112590499 13:100759819-100759841 GCTTCAACACATGAATTTTGAGG + Intergenic
1113078985 13:106496644-106496666 CCTTCCACTCCTCACTGCTGAGG - Intronic
1113525050 13:110968081-110968103 CCTTCCACTCATGACTTTCAAGG + Intergenic
1114009760 14:18354484-18354506 CCTTCCACTCATGGCTTTTGAGG + Intergenic
1114068684 14:19090028-19090050 CATTCCAATCATGAATCTTGGGG - Intergenic
1114093576 14:19309977-19309999 CATTCCAATCATGAATCTTGGGG + Intergenic
1116145898 14:41068942-41068964 CCTTCAACACATGAATTTTGAGG - Intergenic
1117977103 14:61309703-61309725 TCTTCCATTCATGACCTTTTGGG - Intronic
1118378779 14:65200858-65200880 CCTTCAACATATGAATTTTGGGG - Intergenic
1122245379 14:100399419-100399441 CCTTTCTCTCATGTCTTTTTCGG + Intronic
1124052335 15:26209132-26209154 GTTTCCACCCATGAATTTTGGGG + Intergenic
1124092855 15:26622877-26622899 CCTTCCACTCTTAATTTTTATGG - Intronic
1124506805 15:30284028-30284050 CATTCCATTCATGTCTTTAGGGG - Intergenic
1124613227 15:31223473-31223495 CCTTCCAATCCTGACTCTTTAGG + Intergenic
1124658011 15:31524371-31524393 CCTTCCATTTATCATTTTTGTGG + Intronic
1124736752 15:32254606-32254628 CATTCCATTCATGTCTTTAGGGG + Intergenic
1127053063 15:55105036-55105058 TCTGCCACTCATGACTTCTTTGG + Intergenic
1128471435 15:67957048-67957070 CCTTCCACAGACGACTTTGGAGG - Intergenic
1128558636 15:68649554-68649576 CTTTCCACTCTTGATTATTGAGG + Intronic
1128997232 15:72306140-72306162 CCTTCCTCTCATGGGTGTTGTGG + Intronic
1131853821 15:96570924-96570946 CCTTGCACTCATCAATTGTGTGG + Intergenic
1133714251 16:8431710-8431732 ACTTCAACATATGACTTTTGGGG + Intergenic
1134605813 16:15570385-15570407 CCTTCAACTATTGACATTTGGGG + Intronic
1136418011 16:30115133-30115155 CCTTGCACCCAGGAGTTTTGAGG + Intronic
1138315487 16:56066114-56066136 TCTTCCACCCATGACTTCTGTGG - Intergenic
1140451780 16:75076702-75076724 GCTTCAACACATGAATTTTGGGG - Intronic
1140694051 16:77514203-77514225 ACTTCAACCTATGACTTTTGAGG + Intergenic
1140764786 16:78146906-78146928 CCTTCCACGCGGGACTGTTGTGG + Intronic
1141667453 16:85473262-85473284 CTTTCCACTCATCACTTTTATGG - Intergenic
1144274214 17:13649410-13649432 GCTTCAACACATGAATTTTGGGG + Intergenic
1144826488 17:18108306-18108328 CCCTCTACTCCTGACTTCTGAGG - Intergenic
1144839303 17:18175836-18175858 CCTTCCTCCCATGACCTTTGTGG + Intronic
1145903585 17:28504326-28504348 CCTTCAACTTACAACTTTTGTGG + Intronic
1146285411 17:31571262-31571284 CCACCCACTGATGAATTTTGGGG + Exonic
1147437677 17:40427551-40427573 CTTTCCACACATGCTTTTTGAGG - Intergenic
1148171324 17:45523129-45523151 CCTACCTCTAATGAATTTTGAGG + Intergenic
1148278347 17:46326672-46326694 CCTACCTCTAATGAATTTTGAGG - Intronic
1148300558 17:46544527-46544549 CCTACCTCTAATGAATTTTGAGG - Intronic
1148364694 17:47045422-47045444 CCTACCTCTAATGAATTTTGAGG - Intronic
1150401946 17:64864729-64864751 CCTACCTCTAATGAATTTTGAGG + Intronic
1150782058 17:68132052-68132074 CCTACCTCTAATGAGTTTTGAGG + Intergenic
1151923046 17:77172283-77172305 CATTCTACTCATGACCTTGGAGG - Intronic
1152689353 17:81710997-81711019 TCTTCCGCTGATGACTTCTGGGG + Intergenic
1152728552 17:81959309-81959331 CCCTTCACTCTTGCCTTTTGGGG - Intronic
1153206093 18:2703340-2703362 GCCTCCACTCATCCCTTTTGTGG + Intronic
1154528079 18:15313382-15313404 CCTTCCACTCATGGCTTTTGAGG - Intergenic
1155187979 18:23404261-23404283 ACTTCAACATATGACTTTTGAGG - Intronic
1156399781 18:36729759-36729781 GCTTCAACTTATGAATTTTGAGG + Intronic
1158261292 18:55608892-55608914 CCTTCAACACATGAATTTTGAGG - Intronic
1159476984 18:68934474-68934496 AATTCCACTCATGATTTCTGAGG + Intronic
1160060562 18:75525586-75525608 ACTTCAACACATGAATTTTGGGG + Intergenic
1160243167 18:77137252-77137274 CCCACACCTCATGACTTTTGTGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162268314 19:9594259-9594281 CCTTCCACTCATGACTTTCAAGG - Intergenic
1162306093 19:9874908-9874930 CCGTCCCCTAATGGCTTTTGAGG + Intronic
1162834006 19:13304210-13304232 GCTTCAACTCATGAATTTGGAGG - Intronic
1165668377 19:37654320-37654342 ACTTCCACTCATGAATTTCCTGG + Intronic
1166922008 19:46235051-46235073 ACTTCAACACATGAATTTTGCGG - Intergenic
1167201406 19:48067945-48067967 GCTTCCACATATGACTTTGGTGG - Intronic
1168708074 19:58480876-58480898 CCTTGCACCCAGGTCTTTTGGGG - Exonic
925824473 2:7833949-7833971 ACTTCAACACATGAATTTTGAGG - Intergenic
926266055 2:11321864-11321886 ACTTCAACTCGTGAATTTTGGGG - Intronic
926363255 2:12109987-12110009 AATTCAACTCATGACATTTGGGG + Intergenic
927451172 2:23210747-23210769 CCTTCAACATATGAATTTTGGGG - Intergenic
927461852 2:23306232-23306254 ACTTCAACACATGAATTTTGGGG - Intergenic
927803464 2:26122915-26122937 CCTAACACTCATGTCCTTTGTGG - Intronic
928926087 2:36580724-36580746 ACTTCAACACATGAATTTTGGGG - Intronic
930851715 2:55968282-55968304 GCTTCCACTCATGAATTGTCAGG - Intergenic
931483337 2:62665852-62665874 CATGCCTCTCAGGACTTTTGTGG - Intergenic
931883397 2:66590168-66590190 ACTTCAACACATGAATTTTGAGG - Intergenic
933389929 2:81655875-81655897 CCCTCCACTCATGACTTTCAAGG - Intergenic
934301465 2:91779040-91779062 CCTTCCAGTTCTGACTTTTGAGG - Intergenic
934973760 2:98786039-98786061 ACTTCCACATATGAATTTTGAGG + Intergenic
935048080 2:99499494-99499516 CCTTCCACTCATGACTTTTGAGG + Intergenic
936140511 2:109936065-109936087 ACTTCAACACATGAATTTTGAGG - Intergenic
936177202 2:110234010-110234032 ACTTCAACACATGAATTTTGAGG - Intergenic
936204183 2:110435421-110435443 ACTTCAACACATGAATTTTGAGG + Intronic
937138577 2:119577313-119577335 GCTTCCACATATGAATTTTGAGG + Intronic
937635295 2:124149217-124149239 CCTTCCAGTCATTACATTTTGGG + Intronic
937666159 2:124489526-124489548 CCTTCAACACATGAATTTAGAGG + Intronic
938527178 2:132144843-132144865 CCTTCCACTCATGGCTTTTGAGG - Intergenic
938721731 2:134073364-134073386 ACTTTCACTCATTACATTTGAGG + Intergenic
939259203 2:139784894-139784916 ACTTCCACACAGGAATTTTGAGG + Intergenic
939789707 2:146556547-146556569 CCTTCTACTGATGACCCTTGAGG - Intergenic
940352346 2:152703962-152703984 CCTTCCACTCATGACTTTCGAGG + Intronic
940477849 2:154189301-154189323 GCTTCCACATATGAATTTTGGGG - Intronic
940884913 2:158980937-158980959 CCTCCCATTCCTGACTTTTCTGG + Intronic
940977161 2:159958870-159958892 CCTTACACTATTGACATTTGGGG - Intronic
942717045 2:178904894-178904916 CCTTCCAGTTATGACCTTGGTGG - Intronic
944041172 2:195356925-195356947 CCTTCAACATATGAATTTTGGGG - Intergenic
946315985 2:218912859-218912881 ACTTCGACACATGAATTTTGGGG - Intergenic
947350423 2:229238176-229238198 AATTCCACTCATGACAATTGAGG - Intronic
948235029 2:236381022-236381044 GCTTCAACTCATGAGTTTTGGGG - Intronic
948307527 2:236960336-236960358 CCTTCAACACGTGAATTTTGAGG - Intergenic
1168823722 20:794518-794540 CCTTTCACTCATGACTTTCAAGG + Intergenic
1170799212 20:19576643-19576665 CCAAGCACTCAGGACTTTTGAGG - Intronic
1171313737 20:24167452-24167474 TCTTCCACACATGGCTGTTGCGG + Intergenic
1173340440 20:42148348-42148370 CCTTCCAAATCTGACTTTTGAGG - Intronic
1173950954 20:46992995-46993017 CCTGTGACTCATGACTCTTGGGG - Intronic
1175529421 20:59664213-59664235 CCTTACACTCACTCCTTTTGTGG - Intronic
1175866331 20:62179132-62179154 CCTTTCACTCATTACTATAGGGG + Intronic
1176769348 21:13055159-13055181 CCTTCCACTCATGGCTTTTGAGG + Intergenic
1177401659 21:20613554-20613576 CCTTCCTCTCTTGACATGTGAGG - Intergenic
1177591651 21:23177907-23177929 ACTTCAACACATGAGTTTTGTGG + Intergenic
1179014201 21:37581347-37581369 ACTTCAACAGATGACTTTTGGGG - Intergenic
1180434260 22:15285293-15285315 CCTTCCACTCATGGCTTTTGAGG + Intergenic
1180487155 22:15812588-15812610 CATTCCAATCATGAATCTTGGGG - Intergenic
1180516446 22:16149103-16149125 CCTTCCACTCATGGCTTTTGAGG + Intergenic
1180814971 22:18783683-18783705 CCTTCCAGTTCTGACTTTTGAGG + Intergenic
1181201159 22:21218019-21218041 CCTTCCAGTTCTGACTTTTGAGG + Intronic
1181700583 22:24618948-24618970 CCTTCCAGTTCTGACTTTTGAGG - Intronic
1184064841 22:42112483-42112505 CCTTCAACTCATGACTTTTGAGG - Intergenic
1203225754 22_KI270731v1_random:77412-77434 CCTTCCAGTTCTGACTTTTGGGG - Intergenic
1203265074 22_KI270734v1_random:9372-9394 CCTTCCAGTTCTGACTTTTGGGG + Intergenic
950846597 3:16021548-16021570 CCTTCCACTCATGACTTTCGAGG - Intergenic
951628240 3:24690126-24690148 ATTTTCACACATGACTTTTGGGG + Intergenic
952502402 3:33976282-33976304 CCATCAACTTATGAATTTTGTGG + Intergenic
957497012 3:81005928-81005950 CATTCCACTCCTGATTCTTGAGG + Intergenic
958033413 3:88142338-88142360 CCTCCCACTAACCACTTTTGTGG + Exonic
958469111 3:94496090-94496112 ACTTCCACGTATGAATTTTGAGG - Intergenic
958824733 3:99016693-99016715 GCTTCAACACATGAATTTTGAGG + Intergenic
959513985 3:107245037-107245059 CCTTCAACATATGAATTTTGGGG + Intergenic
961352128 3:126310831-126310853 ACTTCAACACATGAATTTTGGGG + Intergenic
961582409 3:127893377-127893399 CCTTCCACTCATGACTTTCGAGG + Intergenic
962484967 3:135833423-135833445 GCTTCAACACATGAATTTTGAGG + Intergenic
962621758 3:137187276-137187298 ACATCCACTCAGGACTGTTGGGG + Intergenic
963147007 3:142004679-142004701 CCTTTCATTAAGGACTTTTGGGG - Intronic
963654587 3:148029577-148029599 ACTTCAACACATGAATTTTGGGG + Intergenic
965223169 3:165953747-165953769 CCTTTCATTCAGGAGTTTTGAGG - Intergenic
965676854 3:171206676-171206698 TCATCCACTAATGAGTTTTGAGG + Intronic
966273303 3:178134889-178134911 CCTTCCTCTCTTGACATGTGGGG + Intergenic
967747924 3:193080927-193080949 TCTACCAGTCATGCCTTTTGAGG - Intergenic
970172706 4:13305437-13305459 GCTTCAACACATGAATTTTGAGG + Intergenic
970367234 4:15372190-15372212 GCTTCAACACATGAATTTTGGGG - Intronic
970927756 4:21472599-21472621 TTTTTCACTCATGAGTTTTGAGG + Intronic
972349676 4:38225119-38225141 GTTTCCACATATGACTTTTGGGG + Intergenic
973719396 4:53707817-53707839 ACTTCAACACATGAATTTTGGGG + Intronic
973864113 4:55094622-55094644 GCTTCCACACTTCACTTTTGGGG + Intronic
974012101 4:56616404-56616426 ACTTCAACACATGAATTTTGTGG + Intergenic
975905306 4:79204450-79204472 CATTCAACTTATGAATTTTGGGG - Intergenic
977279079 4:95016676-95016698 ACATCTACTCCTGACTTTTGCGG + Intronic
980474846 4:133299927-133299949 TCTTGGACTCATGTCTTTTGAGG - Intergenic
981841094 4:149113170-149113192 CATTCCACTCTTGCCTTGTGAGG + Intergenic
982036123 4:151347810-151347832 CCTTGTTCTCATGATTTTTGAGG - Intergenic
982180409 4:152744420-152744442 CCTTGCCCCCATAACTTTTGTGG - Intronic
982809982 4:159812977-159812999 CCTTCCTCTATTGACTTTTAAGG + Intergenic
984123538 4:175776482-175776504 CCTTGCACACCTGACTTTTTTGG - Intronic
985213444 4:187621105-187621127 GCTTCCACGAATGACTCTTGTGG + Intergenic
985383290 4:189418811-189418833 CCTTCAACACAAGAATTTTGAGG - Intergenic
986654875 5:10001088-10001110 CCTTCTCCTCATCTCTTTTGAGG - Intergenic
987872208 5:23635205-23635227 CCTTGCACTCTTGATCTTTGTGG - Intergenic
988108487 5:26781933-26781955 GCTTCAACATATGACTTTTGAGG + Intergenic
988417906 5:30969548-30969570 GGTGCCACTCATGCCTTTTGGGG - Intergenic
989615507 5:43333838-43333860 CCTTCCACTCATGACTTTCAAGG - Intergenic
991218457 5:64183903-64183925 CCTTCAACACATGAATTTGGGGG - Intronic
992882291 5:81122323-81122345 CCTTCCATTACTGAATTTTGGGG + Intronic
993550381 5:89266491-89266513 CCTTCAACACATGAATTCTGAGG - Intergenic
993829565 5:92738431-92738453 GCTTCAACATATGACTTTTGAGG + Intergenic
995507357 5:112874179-112874201 CCTGCCACTCTGAACTTTTGTGG - Intronic
996212218 5:120825372-120825394 ACTTCCACATATGAATTTTGAGG - Intergenic
998540637 5:142978206-142978228 CCTACCACTCATGGCCTTTGAGG - Intronic
998608513 5:143662514-143662536 CCTTCCACTCTTGTATTTTTGGG + Intergenic
999740252 5:154544421-154544443 GCTTCAATTTATGACTTTTGGGG - Intergenic
1000368174 5:160510262-160510284 CCTTCCTCTCCAGACCTTTGTGG + Intergenic
1000760240 5:165214913-165214935 CCTTCAACACATGAATTCTGGGG + Intergenic
1001581669 5:172802697-172802719 GCTTCCACATATGAATTTTGAGG - Intergenic
1003863452 6:10342652-10342674 GCTTCCACACATGAATTCTGGGG + Intergenic
1004061908 6:12205976-12205998 ACTTCCACACATAAATTTTGGGG - Intergenic
1004880636 6:20003937-20003959 ACTTCAACACATGACTTTTGGGG - Intergenic
1005027074 6:21473558-21473580 GCTTCCACATATGAATTTTGGGG - Intergenic
1005106815 6:22232724-22232746 ACTTCAACACATGAATTTTGAGG - Intergenic
1007077449 6:39076886-39076908 CCTTCCTCACATGACATATGAGG - Intronic
1007145374 6:39624818-39624840 CCTTCCACGCATCACTTATTAGG + Intronic
1007286613 6:40752454-40752476 CCTTCCACTCCTGCCTTCTGAGG + Intergenic
1007344235 6:41216351-41216373 CCTTGTAGTCATGAGTTTTGAGG - Intergenic
1008130982 6:47720157-47720179 CCCTCCACTCTGGACTTTGGAGG - Intronic
1009576464 6:65468290-65468312 CCTTCTTCTCATGCTTTTTGGGG + Intronic
1012731847 6:102893146-102893168 TCTTCAACACATGAATTTTGGGG + Intergenic
1012837905 6:104293760-104293782 ACTTCAACATATGACTTTTGGGG - Intergenic
1013930412 6:115524206-115524228 GCTTCCACATATGAATTTTGGGG - Intergenic
1015110329 6:129585715-129585737 CCTTACACTCATGACTTTGCTGG + Intronic
1016090376 6:139970601-139970623 CCTCCCATTCCTGACTTTTAAGG - Intergenic
1016806014 6:148212760-148212782 CCTTCCTCTCAAGATTCTTGTGG - Intergenic
1016992436 6:149939193-149939215 CCTTTCACACATGACTTTTCAGG - Intergenic
1017941328 6:159055698-159055720 GCTTCCACACAGGAATTTTGGGG + Intergenic
1019085215 6:169469076-169469098 CCTTCCACATATAAATTTTGAGG + Intronic
1020042556 7:5015248-5015270 CCTTCCACTCCTCATTCTTGAGG + Intronic
1020289289 7:6710505-6710527 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1020347476 7:7181823-7181845 CCCTCACCTCATGACTATTGTGG + Intronic
1020745001 7:12069413-12069435 CCTTCCGTTCATTACTTTTGAGG + Intergenic
1022803222 7:33795355-33795377 GCTTCAACACATGAATTTTGGGG + Intergenic
1024209303 7:47190252-47190274 CCTTCAGCCCATGGCTTTTGTGG - Intergenic
1024326884 7:48115813-48115835 ACTTCAATACATGACTTTTGAGG + Intergenic
1024904614 7:54362393-54362415 CCTTCAACACATGAATTTTGGGG + Intergenic
1026090218 7:67293410-67293432 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1026289217 7:68990895-68990917 CCTTCCATTTTTGCCTTTTGTGG - Intergenic
1026746224 7:73015451-73015473 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1026749875 7:73043594-73043616 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1026753523 7:73071704-73071726 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1026757174 7:73099740-73099762 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1027032327 7:74900009-74900031 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1027090230 7:75293746-75293768 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1027093875 7:75321674-75321696 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1027097518 7:75349641-75349663 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1027119812 7:75508725-75508747 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1027272016 7:76526882-76526904 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1027321829 7:77018031-77018053 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1027325463 7:77045951-77045973 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1028018506 7:85743497-85743519 CCTTCCACTCATGACTTTTGGGG - Intergenic
1028087619 7:86655715-86655737 CCTTCCACCCCTAACTTTGGAGG - Intronic
1028333705 7:89625965-89625987 CCTTCCACTCATGACTTTCAAGG + Intergenic
1028942937 7:96545144-96545166 TCTTCCACTCATGGTATTTGGGG + Intronic
1029398622 7:100326631-100326653 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1029717687 7:102341298-102341320 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1033097984 7:138447577-138447599 CCTTCCACTCATGACTTTCGAGG - Intergenic
1033488121 7:141811966-141811988 CATTCATCTCATCACTTTTGGGG - Intergenic
1034737767 7:153445062-153445084 CACTCCACTGCTGACTTTTGGGG + Intergenic
1035405754 7:158596058-158596080 CCTTCCAATAAAGTCTTTTGTGG + Intergenic
1036484573 8:9167580-9167602 ACTTCCACATATGAATTTTGGGG + Intronic
1036759231 8:11495747-11495769 TTTTCCACTAATGACCTTTGCGG - Intronic
1037024006 8:14009662-14009684 GCTTCAACACATGAATTTTGGGG - Intergenic
1038496751 8:28008673-28008695 ACTTCAACATATGACTTTTGGGG - Intergenic
1039301928 8:36218796-36218818 CCTTGGACTCTTTACTTTTGAGG - Intergenic
1039689637 8:39850197-39850219 CCTGCCCCTCATGACCTTTGAGG - Intergenic
1040623614 8:49118059-49118081 GCTTCCACGTATGAATTTTGGGG + Intergenic
1040799128 8:51321888-51321910 GCTTCAACTTATGAATTTTGGGG - Intronic
1042088186 8:65131521-65131543 CCTTCTACTCATGACTTTCAAGG - Intergenic
1042172767 8:66008534-66008556 ACTTCCACATATGAATTTTGGGG - Intergenic
1042264822 8:66897667-66897689 CCTTCGAGTCCTGACTTTAGGGG + Intronic
1043848056 8:85183798-85183820 CCTTCAACATATGAATTTTGGGG - Intronic
1046789642 8:118307336-118307358 CCTTCCACTCATGATTTAGTTGG + Intronic
1046858565 8:119065075-119065097 ACTTCAACACATGAATTTTGAGG - Intronic
1048159362 8:131999717-131999739 TCTCCCACTCATCCCTTTTGTGG - Intronic
1049158185 8:141080004-141080026 GCTTCAACACATGAATTTTGGGG - Intergenic
1050025790 9:1333392-1333414 GCTTCAACACATGAGTTTTGGGG + Intergenic
1050717189 9:8543366-8543388 CCATCCACTCGTGGCTGTTGGGG - Intronic
1051411760 9:16796846-16796868 TCTTCAACTAATGCCTTTTGTGG + Intronic
1052302908 9:26973915-26973937 CCTTCCACTCATGACTTTCAAGG - Intronic
1053619948 9:39804699-39804721 CATTCCAAACATGAATTTTGTGG + Intergenic
1053705870 9:40752176-40752198 CCTTCCACTCATGGCTTTTGAGG - Intergenic
1053878126 9:42564001-42564023 CATTCCAAACATGAATTTTGTGG + Intergenic
1053894534 9:42730365-42730387 CATTCCAAACATGAATTTTGTGG - Intergenic
1054233568 9:62537693-62537715 CATTCCAAACATGAATTTTGTGG - Intergenic
1054264209 9:62902745-62902767 CATTCCAAACATGAATTTTGTGG - Intergenic
1054415947 9:64875780-64875802 CCTTCCACTCATGGCTTTTGAGG - Intergenic
1054859094 9:69931268-69931290 CCTACCACTCATGACTTTTGAGG - Intergenic
1055109751 9:72548100-72548122 CCTTCAACACAGGAATTTTGGGG + Intronic
1056414825 9:86366190-86366212 CCTTCCACTCATGACTTTCAAGG - Intergenic
1056830399 9:89912411-89912433 TCTTTCACACATGCCTTTTGAGG + Intergenic
1057862301 9:98650655-98650677 CCTCCCCCTCTTGGCTTTTGTGG - Intronic
1060764391 9:126282997-126283019 CCTTTCCCTCATGACTCCTGTGG - Intergenic
1061463977 9:130763301-130763323 CCATCCACTCAACATTTTTGTGG + Intronic
1186146800 X:6632559-6632581 TCTTCCACACATGAATTTTTGGG + Intergenic
1187047951 X:15666433-15666455 TCTGCCATTCATGACTTTTGAGG - Intergenic
1188458806 X:30398293-30398315 TCTTCCTCACAAGACTTTTGTGG - Intergenic
1189034283 X:37479842-37479864 CCTTCCACCCATAACTTTCGAGG + Intronic
1189478308 X:41374305-41374327 GCTTCAACACATGAGTTTTGGGG - Intergenic
1190074462 X:47306325-47306347 TCTTCAACACATGAATTTTGGGG - Intergenic
1190272590 X:48877690-48877712 GCTTCAACACATGAATTTTGGGG + Intergenic
1190739352 X:53279319-53279341 CCAACCACTCAGGCCTTTTGGGG + Intronic
1190792190 X:53710833-53710855 GCTTCCACATATGAATTTTGAGG - Intergenic
1190887174 X:54540295-54540317 CCTTCCATTCAACACTTCTGCGG - Intronic
1192682097 X:73262926-73262948 TTTCACACTCATGACTTTTGAGG - Intergenic
1194509060 X:94769733-94769755 TCTGCCACTTATGACCTTTGTGG - Intergenic
1194799111 X:98249498-98249520 CCTTCCTCACCTGAGTTTTGGGG + Intergenic
1196833381 X:119793416-119793438 GCTTCAACACATGAATTTTGGGG + Intergenic
1197326789 X:125104240-125104262 ACTTCCTCTCAATACTTTTGTGG + Intergenic
1198772828 X:140149084-140149106 CCTTCAACATATGACTTTTGAGG - Intergenic
1199062322 X:143373738-143373760 GCTACCAATCAAGACTTTTGGGG - Intergenic
1199195770 X:145028049-145028071 ACTTCAATACATGACTTTTGGGG + Intergenic
1201232873 Y:11881834-11881856 CGTTCAACACATGAATTTTGGGG + Intergenic
1201380446 Y:13371084-13371106 CCTTCCATTTATAATTTTTGAGG - Intronic
1201603434 Y:15757710-15757732 CCTATCACTCATAACTTTTATGG + Intergenic
1201627992 Y:16036021-16036043 ACTTCCACACATGAGTTTTAGGG + Intergenic
1201962624 Y:19698835-19698857 CCTTCAACATATGAATTTTGGGG + Intergenic