ID: 1092589783

View in Genome Browser
Species Human (GRCh38)
Location 12:9941836-9941858
Sequence GAGAATGAGCATGAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092589778_1092589783 26 Left 1092589778 12:9941787-9941809 CCTACAAATTGTTAAAATTAGAA No data
Right 1092589783 12:9941836-9941858 GAGAATGAGCATGAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092589783 Original CRISPR GAGAATGAGCATGAGGAGAA TGG Intergenic
No off target data available for this crispr