ID: 1092591682

View in Genome Browser
Species Human (GRCh38)
Location 12:9957994-9958016
Sequence CTTCTTCATGAGCAGCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092591682_1092591683 -9 Left 1092591682 12:9957994-9958016 CCTCAAGGCTGCTCATGAAGAAG 0: 1
1: 0
2: 3
3: 19
4: 234
Right 1092591683 12:9958008-9958030 ATGAAGAAGAAAATTATGCCAGG 0: 1
1: 0
2: 8
3: 72
4: 648
1092591682_1092591686 20 Left 1092591682 12:9957994-9958016 CCTCAAGGCTGCTCATGAAGAAG 0: 1
1: 0
2: 3
3: 19
4: 234
Right 1092591686 12:9958037-9958059 GAAAGTACCTCTGAGATCTGTGG 0: 1
1: 8
2: 13
3: 51
4: 219
1092591682_1092591688 28 Left 1092591682 12:9957994-9958016 CCTCAAGGCTGCTCATGAAGAAG 0: 1
1: 0
2: 3
3: 19
4: 234
Right 1092591688 12:9958045-9958067 CTCTGAGATCTGTGGTTTCCTGG 0: 1
1: 0
2: 1
3: 26
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092591682 Original CRISPR CTTCTTCATGAGCAGCCTTG AGG (reversed) Intronic
900112669 1:1015118-1015140 CTCCTTCACGCACAGCCTTGAGG - Intergenic
903348679 1:22704498-22704520 CCACTTCATGACCAGCCTTCTGG - Intergenic
903569710 1:24295188-24295210 CTTGTTAATGAGCAGGCTTAGGG + Intergenic
904884776 1:33727853-33727875 CATCCTCATCATCAGCCTTGGGG - Intronic
906568742 1:46818717-46818739 CATCTTGATGGGCAGCCGTGAGG - Exonic
913090847 1:115475588-115475610 GTTCTCCATGAGCAGCCTTGGGG - Intergenic
913694730 1:121313915-121313937 CTTCTTCAGGAGTATCTTTGTGG + Intronic
913704256 1:121402963-121402985 CTTCTTCAGGAGTATCTTTGTGG - Intergenic
913989370 1:143596252-143596274 CTCTATCATGAGCAGCCTTCAGG - Intergenic
914208877 1:145560322-145560344 CTTCTCAATGAGCATCTTTGTGG + Intergenic
916372794 1:164118274-164118296 CTTCTTGATGAGTATCTTTGTGG - Intergenic
916434723 1:164767320-164767342 CTTCTGCATGAGGGGCCCTGGGG + Intronic
917634569 1:176922421-176922443 CTTTTTGATAAGCAGCCTGGGGG - Intronic
919261335 1:195198441-195198463 ATTATTCATGAGCAGACTTTCGG - Intergenic
919759426 1:201087980-201088002 AGTCTTAATGAGCAGACTTGGGG - Intronic
919850488 1:201668839-201668861 CATCTTCATTAGCTGCGTTGGGG + Intronic
920759910 1:208773298-208773320 CTTCTTCATCAGCCACTTTGAGG + Intergenic
923464354 1:234234968-234234990 TTTGTTCGTGAGCTGCCTTGTGG + Intronic
924740617 1:246792569-246792591 CTTCTTCATGAGCATTCTGGAGG + Intergenic
1062851901 10:750549-750571 CTTCTTCAGGAACAGGTTTGTGG - Intergenic
1067201126 10:44172873-44172895 CTTCTTCATGAGGGGTCTTGTGG + Intergenic
1067239922 10:44481963-44481985 CTTCTTGAGGAGCATCTTTGTGG - Intergenic
1069303557 10:66939183-66939205 CTTCTGCATGATCAGCTTTTAGG - Intronic
1069491135 10:68861517-68861539 CTTGTTTATGACCAGTCTTGAGG + Intronic
1070917863 10:80166583-80166605 CCTCTTCATGACCACCCTGGGGG - Intronic
1072784616 10:98271058-98271080 CTTCCTCCTCAGCAGCCTTCAGG + Intergenic
1072914098 10:99526678-99526700 CATTTTCCTGAGCAGCCCTGAGG + Intergenic
1073116335 10:101093940-101093962 CTGCTCCCTGAGAAGCCTTGAGG + Intronic
1074299702 10:112222745-112222767 CTAGATCATGAGCTGCCTTGAGG + Intergenic
1075971340 10:126656356-126656378 CTTCTTCTTGTGCTGCTTTGAGG - Intronic
1077696609 11:4398512-4398534 CTTCTTGATGAGTATCTTTGTGG - Intergenic
1077896699 11:6458169-6458191 CTTCTTCATCAGCAGCCTCATGG - Exonic
1079136797 11:17779959-17779981 CATCTGCAAGAGCAGCCTGGGGG - Intronic
1079338661 11:19593984-19594006 CTTCTTCATGAGTTGTCGTGAGG - Intronic
1081319847 11:41678811-41678833 CTTCTTCTTGAGCATTCTTCAGG + Intergenic
1083061539 11:59877876-59877898 CTCCTTCATCAGCAGCCCTGAGG + Intergenic
1087003296 11:93443532-93443554 CTTCTTGAGGAGCATCTTTGTGG + Intergenic
1088806570 11:113358453-113358475 CTGCTTGCTGAGCAGTCTTGGGG - Intronic
1090585033 11:128202092-128202114 CTTCTCCATGGCCAGCCGTGTGG - Intergenic
1092591682 12:9957994-9958016 CTTCTTCATGAGCAGCCTTGAGG - Intronic
1092816012 12:12312905-12312927 TTTCTCCCTGAGCAGCCTGGAGG + Intergenic
1093664162 12:21792448-21792470 CTTCTTCATTAGCTGGCTAGTGG + Intergenic
1095913791 12:47456290-47456312 CTTCTTGAGGAGCATCTTTGTGG + Intergenic
1099053290 12:77807666-77807688 CTTCTTCAGGAGTATCTTTGTGG + Intergenic
1099147237 12:79062098-79062120 CATGTTATTGAGCAGCCTTGAGG - Intronic
1101706970 12:107229878-107229900 GTTCTTCAGGAGAAGCCTTTGGG + Intergenic
1104982740 12:132581551-132581573 CTGGTTCCTCAGCAGCCTTGTGG + Intronic
1106426412 13:29635142-29635164 CTTCTTGATGAGTATCTTTGTGG + Intergenic
1107149439 13:37094642-37094664 CTTCTTCATAAGGAATCTTGGGG + Intergenic
1108026843 13:46186875-46186897 GTGTTTCATGAGAAGCCTTGAGG - Intronic
1108064384 13:46562735-46562757 CTCCTGCAAGAGCAGCATTGAGG - Intronic
1110944021 13:81390315-81390337 TTTCTTTATGAGCATCCTTTGGG - Intergenic
1112058475 13:95713662-95713684 CTTCTTCATGAGTTGCCTTGTGG + Intronic
1113102701 13:106737310-106737332 ATTCCTCATCAGCAGCTTTGAGG + Intergenic
1113931957 13:113973370-113973392 GTTTTTCATGAGCAGCCCAGAGG - Intergenic
1115067364 14:29280437-29280459 CATGTTCATGAGCTGTCTTGTGG - Intergenic
1115497676 14:34022934-34022956 CCTCTTTATGAACACCCTTGAGG - Intronic
1115596441 14:34914332-34914354 TTTCTTCATCAGCAACCTGGAGG - Intergenic
1115743351 14:36411037-36411059 CTTCTTGAGGAGCATCTTTGTGG - Intergenic
1116781623 14:49243520-49243542 CTTTATCATGTGCAGCCATGAGG + Intergenic
1119193017 14:72697119-72697141 CTTCTTCATGAAGAGCCCTCTGG + Intronic
1119505420 14:75168728-75168750 AGTCTTCTTGAGAAGCCTTGTGG - Intronic
1119749470 14:77067153-77067175 CTGCTTCAAGGGCAGCCTGGAGG + Intergenic
1120966824 14:90174950-90174972 GTTCTTCCTGAGCATCCTGGAGG - Intronic
1123185087 14:106508986-106509008 CCTCCTCATGTGCAGCCCTGAGG + Intergenic
1123205905 14:106713210-106713232 CCTCCTCATGTGCAGCCCTGAGG + Intergenic
1123208295 14:106735227-106735249 CCTCCTCATGTGCAGCCCTGAGG + Intergenic
1123210985 14:106760615-106760637 CCTCCTCATGTGCAGCCCTGAGG + Intergenic
1123398688 15:19962952-19962974 CCTCCTCATGTGCAGCCCTGAGG + Intergenic
1124722310 15:32120902-32120924 CTTCATCATGAGCTGCCTGAGGG + Intronic
1125495054 15:40185536-40185558 CTTCTTCATCTCCAGCCTCGTGG + Exonic
1128705518 15:69835083-69835105 CTTCCTCAAGAGCTGCCTTTGGG + Intergenic
1130719732 15:86374901-86374923 ATTCATCATGAGCTGTCTTGAGG + Intronic
1130729477 15:86475726-86475748 CTTCTTGATGAGTATCTTTGTGG - Intronic
1130770761 15:86921277-86921299 TTTCTTCTTGAGGAGCCTGGAGG - Intronic
1131729097 15:95260279-95260301 CTTTTTCACCAGCAGGCTTGAGG - Intergenic
1133190592 16:4130933-4130955 CTTTATCCTGAGTAGCCTTGAGG - Intergenic
1134360998 16:13530982-13531004 CCACTTCATGACCAGCCTAGGGG + Intergenic
1134500923 16:14768614-14768636 CGTCTTTAAGAACAGCCTTGGGG + Intronic
1134579659 16:15360435-15360457 CGTCTTTAAGAACAGCCTTGGGG - Intergenic
1134715045 16:16353763-16353785 CGTCTTTAAGAACAGCCTTGGGG + Intergenic
1134722923 16:16397124-16397146 CGTCTTTAAGAACAGCCTTGGGG + Intergenic
1134842021 16:17409356-17409378 CTTATGCATGAGGAGCCTGGAGG - Intronic
1134944505 16:18314747-18314769 CGTCTTTAAGAACAGCCTTGGGG - Intergenic
1134951770 16:18354896-18354918 CGTCTTTAAGAACAGCCTTGGGG - Intergenic
1136149695 16:28339294-28339316 CGTCTTTAAGAACAGCCTTGGGG - Intergenic
1136165931 16:28453105-28453127 CGTCTTTAAGAACAGCCTTGGGG - Intergenic
1136197041 16:28661915-28661937 CGTCTTTAAGAACAGCCTTGGGG + Intergenic
1136213380 16:28776038-28776060 CGTCTTTAAGAACAGCCTTGGGG + Intergenic
1136258113 16:29055955-29055977 CGTCTTTAAGAACAGCCTTGGGG + Intergenic
1136320382 16:29480354-29480376 CGTCTTTAAGAACAGCCTTGGGG - Intergenic
1136416630 16:30108249-30108271 CTTCCTCATGATCAGCCTGGGGG + Exonic
1136434955 16:30219694-30219716 CGTCTTTAAGAACAGCCTTGGGG - Intergenic
1137574996 16:49593681-49593703 CTTCTCTGTGAGCAGGCTTGGGG - Intronic
1139854985 16:69973078-69973100 CGTCTTTAAGAACAGCCTTGGGG - Intergenic
1139884706 16:70200211-70200233 CGTCTTTAAGAACAGCCTTGGGG - Intergenic
1140367817 16:74395317-74395339 CGTCTTTAAGAACAGCCTTGGGG + Intergenic
1140383709 16:74514292-74514314 CTTCTTGATGAGTATCTTTGTGG - Intronic
1141628609 16:85274964-85274986 TTTCTCCATCAGCAGCCTTGAGG + Intergenic
1143756888 17:9073824-9073846 CTTCGTCATGGGCAGCCTGTTGG + Intronic
1148233720 17:45953305-45953327 CATTTTCAGGAGCATCCTTGAGG - Intronic
1148981200 17:51576352-51576374 CTTCTTGAGGAGTATCCTTGTGG - Intergenic
1153057941 18:966431-966453 CTTCTCCATGGGGAGGCTTGTGG + Intergenic
1155381155 18:25224156-25224178 CTTCTTGATAAGCAGCATTTTGG - Intronic
1156894191 18:42226055-42226077 TTTTTTCATGACCAGCCTTCTGG - Intergenic
1160130383 18:76219902-76219924 CATCTTCAAGAGGAACCTTGTGG - Intergenic
1164954715 19:32372461-32372483 TTTCTTCATGTGGAGCGTTGTGG - Intronic
1167612875 19:50515595-50515617 CGTCCTCTGGAGCAGCCTTGAGG + Intergenic
926092197 2:10058337-10058359 CTCCCTAATGAGCAGCCTGGGGG - Exonic
926213191 2:10886723-10886745 CTTCTCCATGAGCAACTTTATGG + Intergenic
926806708 2:16717757-16717779 CTTCCTCATGAGGAACCTTGGGG - Intergenic
927875283 2:26651084-26651106 CTGATTCATGAGCAGCATGGGGG + Intergenic
928247938 2:29647584-29647606 CTTCTTCACAGGCTGCCTTGAGG - Intronic
928952093 2:36822217-36822239 CTTGTTCATGAGCAGATTAGGGG + Intergenic
929139841 2:38657063-38657085 CGTTTCCATGAGTAGCCTTGAGG + Intergenic
930203810 2:48568746-48568768 GTTGTTCTTGAGCAACCTTGGGG + Intronic
932706266 2:74027234-74027256 CATCTCCATAAGCAGCTTTGAGG - Intronic
933489796 2:82970812-82970834 CCTCTCCATGAGCAGCCTGGGGG + Intergenic
934250946 2:90354834-90354856 CTTCTTAAGGAGTATCCTTGTGG + Intergenic
934258617 2:91448576-91448598 CTTCTTAAGGAGTATCCTTGTGG - Intergenic
937285384 2:120747648-120747670 CTTTGTCATGGGCTGCCTTGTGG - Intronic
937359388 2:121218521-121218543 CTTCGTCCTGAGGAGCCCTGAGG - Exonic
938369484 2:130760388-130760410 CTTCTTCATGAGGACCCAGGGGG - Intronic
939840771 2:147184049-147184071 CCTCTTGAGGAGCAGCTTTGTGG - Intergenic
942884470 2:180906302-180906324 CTTCTGCATAGGCAGCCTTTGGG - Intergenic
946708403 2:222482090-222482112 CTACTTCACCAGCAGCTTTGAGG + Intronic
1170155492 20:13265390-13265412 CTCCTTCATGAGTATCCTTATGG + Intronic
1171342877 20:24444458-24444480 TTTCTTCTTGAGGAGCCTGGAGG - Intergenic
1172012887 20:31856720-31856742 CAGCTTGATGAGCAGGCTTGGGG + Intronic
1174312770 20:49671794-49671816 CTACTTTATGAGCACCCTTTAGG + Intronic
1174484072 20:50850669-50850691 CTTCTTCATGAGAAGCCACAAGG - Intronic
1176067844 20:63208388-63208410 GTTCTTCAGGAGAAGCCTTAGGG + Intronic
1176745379 21:10647695-10647717 CCTCCTCATGTGCAGCCCTGAGG + Intergenic
1176858952 21:13993950-13993972 CTTCTTGAGGAGCATCTTTGTGG + Intergenic
1177420176 21:20846035-20846057 GGTTTTCATGAGAAGCCTTGGGG + Intergenic
1178489856 21:33042597-33042619 CTTGTTCATGCCCAGCCTTTGGG + Intergenic
1179090588 21:38261834-38261856 CATCTTCCTGAGCAGACTTGAGG + Intronic
1179153156 21:38826876-38826898 CTTCATCAAGAGCATTCTTGAGG + Intergenic
1179537920 21:42064101-42064123 CTGATTCACCAGCAGCCTTGGGG - Intronic
1179547965 21:42125008-42125030 CTGCCTCTTGAGGAGCCTTGAGG + Intronic
1179984592 21:44913529-44913551 CTCCTCCATGAGCAGCCCTGGGG + Intronic
1182724070 22:32428483-32428505 CTTCTTCATTAGCTTCCTTTAGG - Intronic
1183625207 22:38997536-38997558 CTTCTGCATCAGCAGCTGTGTGG - Intergenic
1183976389 22:41514917-41514939 CTTCTTCCTCAGGGGCCTTGTGG + Intronic
1184461715 22:44641525-44641547 CTTCCTGATGAGGGGCCTTGGGG - Intergenic
1184548591 22:45191051-45191073 CATCTTCATGGGCTGCCTTTGGG + Intronic
1185299356 22:50071582-50071604 TTTCCTCATGATGAGCCTTGGGG + Intronic
1185331978 22:50256008-50256030 CTTCTTCACGGACAGCCCTGTGG - Intronic
949830026 3:8204415-8204437 CCTCTTCATTAGCACCCTTCTGG - Intergenic
952454112 3:33456972-33456994 TTTCTTCTTGAGGAGCCTGGAGG + Intergenic
953074229 3:39552855-39552877 CTTCTTGAGGAGCATCTTTGTGG - Intergenic
955933548 3:64080830-64080852 CTCCTGCATGAGAAGCTTTGAGG + Intergenic
956856579 3:73280984-73281006 CTGCTTCCCGAGCAGCCTTCTGG - Intergenic
959292059 3:104486599-104486621 CTTCTTCAGGAGTATCTTTGTGG - Intergenic
961696346 3:128707925-128707947 CATGTGCATGAGCAGCCCTGTGG + Intergenic
965025663 3:163298412-163298434 CTTCTTGATGAGTACCTTTGTGG - Intergenic
965393195 3:168129937-168129959 CTTCTTGATGAGTATCTTTGTGG - Intergenic
965515749 3:169619434-169619456 CTGCTTCATGAGCACCCAGGAGG - Intronic
967058089 3:185847762-185847784 CTTCTACAAGTGCAGCCTTTCGG - Intergenic
968601583 4:1512448-1512470 CTCCTTTAGGCGCAGCCTTGCGG + Intergenic
969855345 4:9994781-9994803 CTCCTTGAGGAGCAGCCTTGGGG + Intronic
970252119 4:14127441-14127463 CTGCTTCATGACAAGCCTTGAGG - Intergenic
970689068 4:18601615-18601637 CTTCTTGAGGAGCATCTTTGTGG + Intergenic
971487302 4:27173276-27173298 CTTCTTCAGATGCAGCCTGGTGG + Intergenic
972170684 4:36342109-36342131 CAACTTCATCAGCAGCCCTGCGG - Intronic
972196327 4:36657675-36657697 CTTCTTGAGGAGCATCCTTGTGG - Intergenic
973556653 4:52090775-52090797 CTTCTTGAAGAGCATCTTTGTGG + Intronic
975034398 4:69662455-69662477 CTTCTTGAGGAGTATCCTTGTGG - Intergenic
975096815 4:70465900-70465922 CTTCTCAATGAGTATCCTTGTGG - Intronic
978184788 4:105844291-105844313 CTTCTTCATTAACAGCCTTATGG - Intronic
981167578 4:141580578-141580600 TTTCTTAATGAGGAGGCTTGTGG + Intergenic
981273346 4:142869366-142869388 CTTCTTGATGAGTATCTTTGTGG - Intergenic
982820014 4:159933561-159933583 CTTCTTCAGGAGTATCTTTGTGG + Intergenic
984584758 4:181550637-181550659 CTTCTTCCTCTGCAACCTTGTGG - Intergenic
990187980 5:53228623-53228645 CTTCTTGAGGAGTATCCTTGTGG + Intergenic
992482873 5:77168601-77168623 CTTCTGCAGAAGCAGCCTTTAGG + Intergenic
992973284 5:82084484-82084506 CTTCTTGATGAGTATCTTTGTGG - Intronic
992980717 5:82168669-82168691 TTTCTCCATGAGCATCCTTCAGG - Intronic
993535772 5:89084413-89084435 CTTCTTCCTGAGAAGGCTTGAGG - Intergenic
994206165 5:97038199-97038221 TGTCTGCATGAGTAGCCTTGAGG + Intergenic
996773244 5:127107592-127107614 CTTCTTGAGGAGCATCTTTGTGG + Intergenic
998048394 5:139009952-139009974 CTTCTTGAGGAGCATCTTTGTGG + Intronic
1001908198 5:175490825-175490847 TTATTTCATGAGCATCCTTGTGG - Intronic
1002083329 5:176750452-176750474 ATCCTCCATGAGCAGCCCTGGGG - Intergenic
1003024362 6:2541101-2541123 CTACTTCATGAGCTGCTGTGAGG + Intergenic
1004315494 6:14583622-14583644 CCGTGTCATGAGCAGCCTTGTGG - Intergenic
1004856297 6:19754008-19754030 CAAATTCATGAGCAGCATTGGGG + Intergenic
1006794397 6:36722468-36722490 CTTCTGCGTGAGCAGTCGTGAGG - Exonic
1007749250 6:44062151-44062173 CAGCCTCATGGGCAGCCTTGTGG + Intergenic
1008221717 6:48862529-48862551 CTTCTTCCTGAGATGGCTTGTGG + Intergenic
1008595072 6:53034145-53034167 CTAGTGGATGAGCAGCCTTGGGG + Intronic
1010264771 6:73853489-73853511 ATTCTTTATGTGCAGACTTGAGG + Intergenic
1010594753 6:77749771-77749793 CTTCTTCAGGAGTATCTTTGTGG - Intronic
1012684978 6:102235200-102235222 CTTCTTCATCAGCAGCTCTTCGG - Intergenic
1012881974 6:104801369-104801391 CTTCTTGAGGAGCATCTTTGTGG - Intronic
1013351423 6:109309531-109309553 GTTCTCCATGAGCCACCTTGCGG - Intergenic
1013704347 6:112814536-112814558 CTTCTTGAGGAGCATCTTTGTGG - Intergenic
1014176870 6:118341030-118341052 CTTCTTGAGGAGCATCTTTGTGG + Intergenic
1014241657 6:119024738-119024760 CTTCTTCATGAGCATCTTTGAGG + Exonic
1015505141 6:133977607-133977629 CTTCTTCAGTAGTTGCCTTGTGG + Intronic
1015946799 6:138511129-138511151 CTTCTTCATCAGCATCATGGAGG + Intronic
1016121151 6:140342590-140342612 CTTCTTCATGGCCAGCCCTATGG + Intergenic
1016348357 6:143140576-143140598 CTTCTTCATGTGATTCCTTGTGG - Intronic
1017016934 6:150108658-150108680 CTACCTCATGAGAAGCATTGTGG + Intergenic
1018647799 6:165964147-165964169 CTTCTTCATTATCAGCCTGAAGG + Intronic
1019160045 6:170063481-170063503 TTTCTACATGAGCAGCCTGCCGG - Intergenic
1019735082 7:2646601-2646623 CTTCATGCTGTGCAGCCTTGAGG + Intronic
1020439512 7:8202183-8202205 TTTCTTCATGAGCAGCATGATGG - Intronic
1020833890 7:13125318-13125340 CTTCTTGAGGAGTAGCTTTGTGG + Intergenic
1021059606 7:16094764-16094786 CTTCCTCATGATTAGCCTGGAGG - Intronic
1023349860 7:39309491-39309513 CTTCTTTATGGACAGCCATGGGG - Intronic
1023818297 7:43966384-43966406 CTTCTTCATGATCTGCCCAGAGG + Intergenic
1024023507 7:45391708-45391730 CTTCTGCAGGAGCAGTGTTGGGG + Intergenic
1024902124 7:54331543-54331565 CTACTTCAACAGCTGCCTTGAGG - Intergenic
1026346816 7:69481673-69481695 CTTCTTCCTGAGGAGCTTGGAGG + Intergenic
1027013814 7:74767056-74767078 CTACTTCATGGGCTGCCGTGAGG - Intergenic
1028892179 7:96000745-96000767 CTTCTTCATGAGTTGCTTTTTGG - Intronic
1031286568 7:119876958-119876980 CTTCTTCATGATCAATTTTGAGG + Intergenic
1032052860 7:128659877-128659899 CCATGTCATGAGCAGCCTTGTGG - Intergenic
1032945723 7:136849965-136849987 ATTCATCAGGAGCAGCCTTATGG + Intergenic
1033559897 7:142521132-142521154 CCTCTTCATTAGCAACTTTGAGG + Intergenic
1035047926 7:155981316-155981338 CTTCTGCATAGGCAGCTTTGTGG + Intergenic
1035111167 7:156483288-156483310 CTTCTTCAGGTGCAGGCGTGAGG - Intergenic
1035676052 8:1456252-1456274 CTTCCTCATTGGCAGCATTGTGG + Intergenic
1038525821 8:28272414-28272436 TTTTTTCATGGGCAGCCTTTAGG - Intergenic
1039006508 8:33044010-33044032 CTTCTTTCTGTGCTGCCTTGAGG + Intergenic
1040085205 8:43332764-43332786 CTTCTTGAGGAGTAGCTTTGTGG + Intergenic
1040488950 8:47901542-47901564 CTTCCTCAAGAGCAGACTAGAGG + Intronic
1040557932 8:48497447-48497469 CTTCTTCATCTGCAGACTTGCGG + Intergenic
1040977080 8:53205437-53205459 CTTGTTACTGAGCAGCCCTGAGG - Intergenic
1042119971 8:65476093-65476115 CTTCTTGAGGAGCAGCATTGTGG - Intergenic
1042887736 8:73570602-73570624 CTTCTTGAGGAGCATCTTTGTGG - Intronic
1045894913 8:107203205-107203227 CTTGTTGATGAGCATCTTTGTGG - Intergenic
1046821219 8:118636314-118636336 CTTCTTCATGTCCATCCTTCAGG - Intergenic
1048557687 8:135496589-135496611 CTCCTTCATGTTCAGCCTAGTGG - Intronic
1049096637 8:140552048-140552070 CAACCTCATGAGCAGCCTGGAGG + Intronic
1049324170 8:142013343-142013365 CTTGTTCCTCAGCAGCCCTGGGG - Intergenic
1049731112 8:144179006-144179028 GTTTTTCCTTAGCAGCCTTGGGG + Intronic
1050060244 9:1701221-1701243 CTTCTTCATGAACAGGATTCAGG + Intergenic
1050713306 9:8490707-8490729 TTTCTTCAGAAGCATCCTTGAGG + Intronic
1052145553 9:25044455-25044477 CTTCTTGAGGAGTATCCTTGTGG + Intergenic
1059739645 9:117137209-117137231 CTTCTTCCTGAGAGGCCTGGTGG - Intronic
1060688590 9:125635526-125635548 CTGCTTCATGAACGGTCTTGTGG - Intronic
1186982597 X:14973483-14973505 CTTCTTGAGGAGCATCTTTGTGG + Intergenic
1187975723 X:24702926-24702948 ATTCTTCATTAGCTGCTTTGGGG - Intronic
1189375947 X:40466466-40466488 CTTCTTCATGAGCCTACTTGGGG - Intergenic
1189867746 X:45349053-45349075 CTTGCCCATGAGCAGCCTTCTGG - Intergenic
1191194913 X:57710166-57710188 CTTCTCGAGGAGCATCCTTGTGG - Intergenic
1191814275 X:65226027-65226049 CTTCTTGAGGAGCATCTTTGTGG - Intergenic
1192589252 X:72346355-72346377 TTTCTTCTTGAGAAGCCATGAGG - Intronic
1194474144 X:94336759-94336781 CTTCTTCAGGAGAATCATTGAGG - Intergenic
1198892602 X:141415171-141415193 CTTCTTTATGAGCTGTGTTGAGG - Intergenic
1199579657 X:149348445-149348467 TTTCTTCCTGAGGAGCCTGGAGG + Intergenic
1199992936 X:152999365-152999387 CTTCTTCATGAGGGGCCTGGAGG + Intergenic
1201258756 Y:12136500-12136522 CTTCTTGATGAGTATCTTTGTGG - Intergenic
1201778647 Y:17694562-17694584 CTTCTTGATGAGTATCTTTGTGG + Intergenic
1201822909 Y:18211430-18211452 CTTCTTGATGAGTATCTTTGTGG - Intergenic