ID: 1092593270

View in Genome Browser
Species Human (GRCh38)
Location 12:9971388-9971410
Sequence CTGAAGCCACAGATGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092593270 Original CRISPR CTGAAGCCACAGATGAGATT TGG Intronic
900083801 1:877122-877144 CTGAAGCTCTAGATGAGCTTGGG + Intergenic
902606429 1:17571954-17571976 CTGATGCCAGAAATGAGATGGGG - Intronic
903312499 1:22470712-22470734 CTGGAGCCACAGAAGAGTCTAGG + Intronic
905476767 1:38234294-38234316 CTGATGGCACACATAAGATTTGG + Intergenic
905548003 1:38815563-38815585 CTGAAGTCACAGCTGAGACTTGG + Intergenic
906418410 1:45641311-45641333 CCAATGCCACAGATGAGGTTTGG + Intronic
909935334 1:81544523-81544545 GAGAAGTCACAGATGACATTAGG - Intronic
912229113 1:107771817-107771839 CAGGAGGCACAGATGATATTCGG + Intronic
912559050 1:110537272-110537294 CTGAACCCACTGATGGGGTTGGG + Intergenic
917745102 1:177999127-177999149 CTGAATCCCCAGATGAGAAGCGG + Intergenic
918843215 1:189572144-189572166 CTTAAGCCACTGATATGATTTGG - Intergenic
918999958 1:191818034-191818056 CTGAAGTCACAGTTGAGAATGGG + Intergenic
919124496 1:193378805-193378827 CTAAAGTCTAAGATGAGATTTGG - Intergenic
919841539 1:201612958-201612980 GTGAAGCCCAAGTTGAGATTTGG + Intergenic
922671337 1:227510472-227510494 CTGAAGTCCTAGATGAGCTTGGG + Intergenic
923247017 1:232142546-232142568 GTGAAGCCAAAAGTGAGATTCGG - Intergenic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1064281370 10:13954562-13954584 CTGGAGCCACTGATTGGATTTGG - Intronic
1064923445 10:20543529-20543551 CTGAAGTCACAGCTGAAACTGGG + Intergenic
1065433483 10:25683321-25683343 CAGAAGCAAAAGATTAGATTGGG + Intergenic
1067257666 10:44660162-44660184 GTAAAGCTACAGATGAGATAGGG - Intergenic
1067719840 10:48719988-48720010 CTGAAGCAACAGATGGGACTTGG - Intronic
1067971919 10:50981909-50981931 CTGGTGCCACAGATAACATTTGG + Intergenic
1068626305 10:59252242-59252264 CTGAAACCATACATGAGTTTGGG - Intronic
1069310424 10:67028336-67028358 CAGAAGCTACAGAATAGATTTGG + Intronic
1069857738 10:71451027-71451049 ATGGAGCCACAGCTGAGATGGGG - Intronic
1071019103 10:81030809-81030831 GTGGGGCTACAGATGAGATTTGG + Intergenic
1071938335 10:90556523-90556545 CTGAAACCAAAGCTAAGATTAGG + Intergenic
1073954228 10:108849403-108849425 ATGAAGCCATACATGAGTTTTGG + Intergenic
1076294909 10:129376667-129376689 CTGGGGCCACGGATGAGTTTGGG + Intergenic
1076295462 10:129380475-129380497 CTGAATCCACAGCAGAGATGCGG + Intergenic
1079523991 11:21362852-21362874 CTGCAGCCACAGTGGAGAATGGG + Intronic
1079739441 11:24038249-24038271 CTAAAGTTAAAGATGAGATTAGG + Intergenic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1084169545 11:67394118-67394140 CTCAAGCCAGACAAGAGATTTGG - Intronic
1084790016 11:71469043-71469065 CTGAATCCACAGATCAACTTAGG - Intronic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1088630635 11:111770883-111770905 CAGAGGCAACAGCTGAGATTAGG + Intergenic
1088706762 11:112470937-112470959 CTGGAGCCACAGATGAGAAGAGG - Intergenic
1089217828 11:116846308-116846330 CTGAAGCTCCTGATGGGATTGGG + Intronic
1090495912 11:127211866-127211888 CTGAAAGGACAGAAGAGATTTGG - Intergenic
1091197552 11:133744865-133744887 CTGAACCCCCAGATGGGAGTGGG + Intergenic
1092593270 12:9971388-9971410 CTGAAGCCACAGATGAGATTTGG + Intronic
1093739001 12:22659073-22659095 CTTTAGCCAAAGATTAGATTTGG - Exonic
1095301869 12:40593781-40593803 CTGAAGCCAAATATGGGCTTTGG + Intergenic
1095361816 12:41351416-41351438 ATGAAGACACACTTGAGATTGGG + Intronic
1095746849 12:45669109-45669131 CAGAAGCCACAGAAGTAATTAGG - Intergenic
1096141385 12:49245672-49245694 CTGAAGGGACAGCTGAGAATGGG - Intronic
1097161232 12:57047980-57048002 CTGAAGCCCCATATGTGAGTAGG - Exonic
1097711934 12:62926452-62926474 TAGAAGCCATAGAGGAGATTAGG + Intronic
1098051273 12:66456104-66456126 ATGAAGCCAAAGATGAGAAAAGG + Intronic
1100074118 12:90757408-90757430 TTGTAGCCACAGAGGAGATTAGG - Intergenic
1100634437 12:96421716-96421738 CTCAAGTCACACATGATATTTGG - Intergenic
1100796927 12:98192017-98192039 CTGAAGTTACAGATGTGAATGGG + Intergenic
1104044225 12:125150421-125150443 CTGAAGCCAGTGATGAGAGATGG - Intergenic
1104509396 12:129362741-129362763 ATGAAGCCCTAGATGAGACTTGG + Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1107861500 13:44665303-44665325 GTGAAGCCAGAGATGAGAGCTGG - Intergenic
1109655583 13:65386898-65386920 CTGTAACCCAAGATGAGATTTGG - Intergenic
1110612298 13:77502478-77502500 CTGCAGCTACAGATTAAATTTGG + Intergenic
1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG + Intronic
1112883050 13:104133278-104133300 CTGAAGTCACAGAAGAAATCAGG - Intergenic
1116024476 14:39498178-39498200 CTCAAGTCCAAGATGAGATTTGG + Intergenic
1117361800 14:54982591-54982613 GTGAAGCCACAGATAAGAAAAGG - Intronic
1118593170 14:67416462-67416484 CTGAAGGCACTGAAAAGATTGGG + Intergenic
1119543855 14:75457764-75457786 CTGAAGGCAGAGTTTAGATTTGG - Intronic
1119954417 14:78780896-78780918 TTGAAGCTACACATGACATTTGG + Intronic
1121648995 14:95543036-95543058 CTGAGGACACACATGAGATGAGG - Intronic
1121791290 14:96701594-96701616 GTGAGGCCTCAGATGAAATTAGG - Intergenic
1123219418 14:106842420-106842442 CTGCAGGCACAGATTACATTTGG - Intergenic
1125552400 15:40555596-40555618 CTGAACCCTCAGAGGAGAGTTGG + Intronic
1126869542 15:52972959-52972981 CAGAAACCACAGATGATACTTGG + Intergenic
1129157645 15:73728739-73728761 CTGAAGCCAGAGTTAGGATTAGG + Intergenic
1129356573 15:74995900-74995922 CGGGAGCCACAGATGGGAATGGG - Intronic
1129706706 15:77798510-77798532 GTGATGCCACAGAGGAGAGTGGG - Intronic
1130133342 15:81161485-81161507 AGGAAGCCACAGAGGAAATTTGG + Intronic
1131065808 15:89434365-89434387 CTGAATGCACTGATGAGCTTAGG + Intergenic
1131999868 15:98167660-98167682 CAGAAGTCACAAATGAAATTAGG + Intergenic
1134833539 16:17343195-17343217 CTGAAGCCACAGACTATTTTCGG + Intronic
1135970436 16:27068188-27068210 CTGTCGCCACTGATGAGTTTTGG - Intergenic
1137421361 16:48337525-48337547 CTTATGCCAGAAATGAGATTTGG + Intronic
1138872700 16:60911397-60911419 CTAAAGCTAAAGATGAGATTTGG - Intergenic
1140252840 16:73309558-73309580 GGGAAGCGACAGATGAGAGTGGG + Intergenic
1141409514 16:83822930-83822952 CAGAAGCCTCAGATGAATTTTGG - Intergenic
1141732680 16:85833521-85833543 CCAAGGCCCCAGATGAGATTAGG + Intergenic
1142160777 16:88556284-88556306 CTAAAGCCACTGATGTGGTTTGG + Intergenic
1142748650 17:1974235-1974257 CTGCAGTCCCAGATGAGATCTGG + Intronic
1145116498 17:20215067-20215089 ATGCAGCCACAGAGGAGATCCGG + Intronic
1147062254 17:37889934-37889956 CTGAATCTCCAGATGAGGTTAGG + Intergenic
1147970459 17:44216825-44216847 CTGAAGGCACAGACAAGATATGG + Intronic
1149341489 17:55691009-55691031 TTTAAGCCACAGATTAGTTTAGG + Intergenic
1149937696 17:60825392-60825414 ATAAAGCCACACATGAGATTCGG - Intronic
1152022753 17:77789420-77789442 CTGAAGGCCCAGATAAGATGAGG - Intergenic
1152891562 17:82884508-82884530 CTGAAGACGCAGAAGAGAGTGGG + Intronic
1157793566 18:50555289-50555311 CTGATTCCCCAGATGAGAGTAGG + Intergenic
1157958308 18:52124016-52124038 TTGAAGACACAGATGAAAGTAGG + Intergenic
1158242068 18:55388749-55388771 CTGAAGGCAGAGATGGGACTGGG - Intronic
1158926405 18:62267634-62267656 CTGAAGACATTGAAGAGATTTGG + Intronic
1159032291 18:63243827-63243849 ATGAAGCCTCAGAAGACATTAGG - Intronic
1159754773 18:72350937-72350959 CTGTAGCCCCCTATGAGATTAGG + Intergenic
1160816672 19:1039200-1039222 CTGAAGCCACAGGTGAGTCTGGG + Intergenic
1162213761 19:9114938-9114960 CTGAAGCCACAGCAGTAATTCGG + Exonic
1162826033 19:13252871-13252893 CTGAAGCCACCCTTGAGGTTGGG + Intronic
1165119291 19:33548779-33548801 CTGAAGCCACAGCAGGGATGGGG + Intergenic
1165895818 19:39140251-39140273 CTGAAGCCACAGAGGGGAGATGG + Intronic
1165981828 19:39730841-39730863 GTGAAGGGACATATGAGATTTGG + Intergenic
1166089379 19:40498172-40498194 CTGAAGTCAGGGATGGGATTAGG - Intronic
925270781 2:2605967-2605989 CTGAACTCAAAGATGAGCTTTGG - Intergenic
925348664 2:3187179-3187201 CTGCAGCCACAGCTGTGATTAGG - Intergenic
925722920 2:6845719-6845741 GGGAAGCCACAGATGGTATTAGG - Intronic
927150143 2:20190929-20190951 CTTCAGGCACAGATGAGACTTGG - Intergenic
928680528 2:33697627-33697649 CAGGAGCTAAAGATGAGATTTGG - Intergenic
930050398 2:47211324-47211346 TTAAAGCCAGAAATGAGATTTGG - Intergenic
932154816 2:69406804-69406826 CTGAAGTTCAAGATGAGATTTGG - Intronic
934567956 2:95350974-95350996 CTGAAGCCAGAGTTGGGAGTTGG + Intronic
935460333 2:103323886-103323908 CTGAAGGCTCAGATGATCTTTGG + Intergenic
937377965 2:121350732-121350754 ATGAAGCCCCATATGAGCTTTGG + Intronic
937894575 2:126968995-126969017 CCAAAGCCACAGATGAGCTTAGG + Intergenic
943028370 2:182655909-182655931 CTGCAGCCAGAGAATAGATTGGG - Intergenic
944229214 2:197376396-197376418 GTGAAGCCATAAATGAGAGTAGG + Intergenic
945646329 2:212499869-212499891 CTGAAGACACAGAAAAGAATAGG + Intronic
948336152 2:237208988-237209010 CAAAAGCCGCAGATGACATTAGG - Intergenic
948761669 2:240196014-240196036 TGAAAGCCACTGATGAGATTTGG + Intergenic
948807498 2:240459339-240459361 TTGAAGCCCCAGCTGGGATTTGG + Intronic
1169628761 20:7601240-7601262 TTAAAGTCAGAGATGAGATTTGG - Intergenic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1170880030 20:20288964-20288986 ATGAAGCCACAGATTAGGTATGG + Intronic
1173120594 20:40285895-40285917 CTGAAGCTAAAGATGAGGATAGG + Intergenic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1174415622 20:50364470-50364492 CTGCAGCCGAAGGTGAGATTTGG + Intergenic
1179356901 21:40668287-40668309 CTGAATCCACTGATGTGAGTTGG - Intronic
1179710842 21:43212118-43212140 CTGAAGCCTCAGGTGAGAGAGGG - Intergenic
1181701256 22:24622769-24622791 CTGTGGCCACAGATGAGAGAAGG + Intronic
1181858748 22:25801861-25801883 CTAAAGCTAGAGATGGGATTTGG + Intronic
1182850294 22:33468227-33468249 CTCAAGCCTCAGCTGAGTTTTGG + Intronic
1182938349 22:34248819-34248841 TGGGAGCCACAGATGAGATTTGG - Intergenic
1184257230 22:43294235-43294257 CTCAAGCCACCCAAGAGATTTGG - Intronic
950086965 3:10265892-10265914 GTGAAGCCGCAGATGAAAATAGG - Intronic
951961422 3:28326676-28326698 CTGAAGCCAAAGCAGAGAATGGG + Intronic
952653880 3:35760420-35760442 CAGAAGCCTCAGTTGAGTTTGGG + Intronic
953167634 3:40479429-40479451 CTACAACCACAGATGAGATTGGG - Intronic
954039176 3:47871163-47871185 CTTAAGCCACAGAGGAGGTGGGG + Intronic
954417799 3:50402531-50402553 CTGAAGCCACAGTTCAAATGTGG - Intronic
954690817 3:52394777-52394799 CTGGAGGCACAGAGGAGATGTGG - Intronic
955213087 3:56960326-56960348 CTGATCACACAGATGAAATTGGG + Intronic
956241394 3:67134661-67134683 TTGGAGCCACAGTTAAGATTGGG + Intergenic
959029678 3:101283589-101283611 CAGAAGCCACAGAGTAGACTTGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960485796 3:118251450-118251472 TTGGAGCCACAGATGGGACTGGG - Intergenic
961756791 3:129132563-129132585 CTAAACCCTCAGCTGAGATTAGG - Intronic
962912089 3:139862248-139862270 CTGAAACCTCAGATGTGAGTTGG + Intergenic
965679461 3:171235335-171235357 TGAAAGCCACAGATGAGATTGGG - Intronic
966904495 3:184512313-184512335 CTGAAGCCACAGGAGAGAGGAGG + Intronic
968746086 4:2361357-2361379 CTGCAGCCACAGCTCACATTAGG - Intronic
968886613 4:3337977-3337999 CTCAATCCACAGATGAGAACTGG - Intronic
973287815 4:48439654-48439676 CAGAAGCCAAGGATGAGAATCGG + Intergenic
973643306 4:52924867-52924889 CTGCATTCACAGATGAGATGTGG - Intronic
974977010 4:68904507-68904529 CTGCAGGCACAGATTACATTTGG - Intergenic
975048289 4:69829611-69829633 CTGCAGGCACAGATTACATTTGG - Intronic
975349931 4:73333818-73333840 GTGAGGCCACAGATGGCATTTGG - Intergenic
975994441 4:80298093-80298115 GTCAAGCCAAAGATGAGATATGG - Intronic
978559025 4:110011772-110011794 CTGCAGCCCCAGAAGAAATTAGG + Exonic
979316247 4:119267644-119267666 CTGAGGCCACCGATGAGAAAAGG - Intronic
980708938 4:136539050-136539072 CTGAAGGTGCAGATGACATTTGG - Intergenic
982300573 4:153874876-153874898 CTGAAGACTCAGATGATAATTGG + Intergenic
986013883 5:3740757-3740779 CTGAGGACACAGAAGAGGTTGGG - Intergenic
986236057 5:5911825-5911847 CCAAACCCACTGATGAGATTTGG + Intergenic
988498170 5:31762236-31762258 CAGAAACCACAGCTGAGATACGG + Intronic
989228493 5:39058973-39058995 CTGAAGACACAGAAGAGAAATGG + Intronic
989341431 5:40379726-40379748 CTCAAGCCACCCAAGAGATTAGG - Intergenic
992473411 5:77079383-77079405 CTGAAGACAAAGATGAGAATAGG + Intronic
993127074 5:83848822-83848844 CTGAAATTAGAGATGAGATTTGG - Intergenic
994382972 5:99093679-99093701 CTGAAGCCTAATATGAGAGTAGG - Intergenic
994610514 5:102032203-102032225 TGGGAGCTACAGATGAGATTTGG - Intergenic
997616611 5:135250692-135250714 GAGAAGCCACAGGTGAAATTTGG + Intronic
998113409 5:139518960-139518982 CAGAAGCCACTGAAGAGTTTGGG - Intergenic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
1000164224 5:158631842-158631864 CTTAAGCCAATGATGAGACTAGG - Intergenic
1000700392 5:164442428-164442450 TTTAAGGCACAGCTGAGATTAGG + Intergenic
1001082408 5:168676980-168677002 CAGAAGCCACAGATCAGAGAGGG + Intronic
1006835715 6:36997739-36997761 CTGAGGCCTCGGATGGGATTTGG + Intergenic
1007249601 6:40486783-40486805 GAGAAGTGACAGATGAGATTTGG + Intronic
1007260351 6:40559103-40559125 ATGAAGCCTCTGATGATATTGGG + Intronic
1007935406 6:45728039-45728061 TTGAAGGCACAGATGTGAATAGG + Intergenic
1008802783 6:55390413-55390435 CTGAAGGCACAGTTGCCATTGGG + Intronic
1013464900 6:110409401-110409423 GGGAAGCCACAGAGGAGATGAGG + Intronic
1014471376 6:121819136-121819158 CTGAAGACACACCTGAGACTGGG - Intergenic
1016794316 6:148101571-148101593 CTGAAGGCACAGATGATCATTGG + Intergenic
1017469172 6:154722705-154722727 CTGACCCCAGAGATAAGATTAGG + Intergenic
1017648386 6:156559528-156559550 CTTCAGCCACAGTTGAGTTTGGG - Intergenic
1019120072 6:169795058-169795080 CTGAAGCCACAGCTACGACTTGG - Intergenic
1019496509 7:1342883-1342905 GTGGACACACAGATGAGATTTGG - Intergenic
1019496512 7:1342906-1342928 ATGGGGACACAGATGAGATTTGG - Intergenic
1020398003 7:7739344-7739366 CTGTAGCCTTAGGTGAGATTTGG + Intronic
1021021931 7:15610928-15610950 ATGAAGCCACAGATAAAAGTAGG - Intergenic
1021732906 7:23613942-23613964 CTGAAGGCTCAGATGATTTTTGG - Intronic
1022130838 7:27402979-27403001 CTGAAGTCACAGATTATATGTGG + Intergenic
1023597032 7:41840899-41840921 CTGAATCCACAGATCAAGTTGGG + Intergenic
1023756305 7:43420866-43420888 CTGAAACCACAGATCAATTTGGG - Intronic
1024028140 7:45431737-45431759 TTGAAGCCAAAGAGGAGAATCGG - Intergenic
1025193114 7:56911364-56911386 CAGCAGCCACAGAGGAGACTGGG + Intergenic
1025678830 7:63665556-63665578 CAGCAGCCACAGAGGAGACTGGG - Intergenic
1026311762 7:69191973-69191995 GTGAAGCCACAGAAGAGAACAGG + Intergenic
1027532480 7:79353623-79353645 CTGGAGATACAGCTGAGATTGGG + Intronic
1027917744 7:84347831-84347853 CAGTAGCCAGAGATGAGATGAGG + Intronic
1030545742 7:110892923-110892945 CTGAAGCCAAGGATGAGGGTGGG - Intronic
1031737786 7:125388530-125388552 CTAGAGCCACAGGGGAGATTTGG - Intergenic
1031880980 7:127198368-127198390 CTAAGGCCACAGAGCAGATTTGG - Intronic
1035838781 8:2788087-2788109 CTGAACCCAAAGATGAGAACAGG - Intergenic
1036060588 8:5314594-5314616 ATGAAGCAACAGATGAAACTGGG + Intergenic
1037142132 8:15532673-15532695 TGGGAGCTACAGATGAGATTTGG - Intronic
1039353170 8:36784635-36784657 GTGAAGTCAGAGATGAGTTTGGG + Intronic
1040045125 8:42955043-42955065 CTGAAGGCCCAGTTGAGATTGGG + Intronic
1042400657 8:68342500-68342522 CTGAAACCACAGATAAGAGGGGG - Intronic
1042579263 8:70258327-70258349 CTGAAGCTACAAATGAAAATTGG - Intronic
1042877245 8:73450431-73450453 CCAAAGCCACGGATGAGATGAGG + Intronic
1043072923 8:75661954-75661976 CTGAAGTCACATCTGAGATCAGG - Intergenic
1043519954 8:81034380-81034402 CTGAAGACAGAGAAGAGAGTAGG + Intronic
1045431284 8:102117231-102117253 CTGAGGCCACAGGTGAGAGATGG - Intronic
1047545436 8:125811843-125811865 GTTAACTCACAGATGAGATTGGG + Intergenic
1048651062 8:136478048-136478070 AAGAAGCCACAGATGATATACGG + Intergenic
1048767629 8:137862201-137862223 CTGCAGCCACAGCTCAGAATTGG - Intergenic
1050073097 9:1837156-1837178 CTGAAGGCAAAGGTGAGGTTGGG - Intergenic
1050410760 9:5362839-5362861 CGGAAGCCTCAGATGGGTTTGGG + Intronic
1052122585 9:24737251-24737273 CTGAAGCAAGATAAGAGATTGGG + Intergenic
1052314074 9:27097943-27097965 CTTGAGTCTCAGATGAGATTTGG + Intergenic
1052559123 9:30060931-30060953 CTGATGCCACAGATAACTTTGGG - Intergenic
1058812727 9:108656889-108656911 CTGATGCCTGAGATGAGATATGG - Intergenic
1059116178 9:111601762-111601784 TTGAAGATACAGATAAGATTGGG + Intergenic
1059682655 9:116601131-116601153 CTGAATCCTTAGATTAGATTTGG - Intronic
1060044169 9:120326999-120327021 TTGAAGCCACAGAACAGAATGGG + Intergenic
1062001996 9:134220843-134220865 TTGTAGCTACAGATGAGAATAGG + Intergenic
1062247414 9:135576264-135576286 CAAAAGCCACAGATGAGCATTGG - Intergenic
1062387618 9:136319253-136319275 CTGAAGCCACACATGAAGTGGGG + Intergenic
1187306833 X:18102771-18102793 GGGAAGACACAGATGAGAGTAGG - Intergenic
1188606827 X:32041416-32041438 CTCAAGCCACAGATGCCATATGG - Intronic
1190746720 X:53327996-53328018 TTGAAGGAACAGATGATATTTGG + Intergenic
1195712925 X:107789306-107789328 TTGAAGACACAGATGAGAGGAGG - Intronic
1197750570 X:129961117-129961139 CTGAAGCCCCAGAGGAGAGGGGG - Intergenic
1198821324 X:140651349-140651371 CTGAAGTCACAGATAACTTTTGG + Intergenic
1199666590 X:150101078-150101100 AGGCAGCCACAGATGAGAGTTGG + Intergenic
1200137205 X:153880905-153880927 CTGAAGCCTCAGGCGAGATGAGG - Intronic
1200139049 X:153888568-153888590 CAGAAGCCACAGACGACAGTGGG + Intronic