ID: 1092595840

View in Genome Browser
Species Human (GRCh38)
Location 12:10003965-10003987
Sequence TTTCCCTCAATCACACTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092595840_1092595848 23 Left 1092595840 12:10003965-10003987 CCACCCAGTGTGATTGAGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1092595848 12:10004011-10004033 AGAGGTCTGGCCCTCTTAGCAGG 0: 1
1: 0
2: 1
3: 4
4: 69
1092595840_1092595844 -1 Left 1092595840 12:10003965-10003987 CCACCCAGTGTGATTGAGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1092595844 12:10003987-10004009 ATAGTGTGATTAAGGTGAAATGG 0: 1
1: 0
2: 1
3: 13
4: 196
1092595840_1092595845 0 Left 1092595840 12:10003965-10003987 CCACCCAGTGTGATTGAGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1092595845 12:10003988-10004010 TAGTGTGATTAAGGTGAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 154
1092595840_1092595846 5 Left 1092595840 12:10003965-10003987 CCACCCAGTGTGATTGAGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1092595846 12:10003993-10004015 TGATTAAGGTGAAATGGGAGAGG 0: 1
1: 0
2: 0
3: 24
4: 265
1092595840_1092595847 10 Left 1092595840 12:10003965-10003987 CCACCCAGTGTGATTGAGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1092595847 12:10003998-10004020 AAGGTGAAATGGGAGAGGTCTGG 0: 1
1: 0
2: 6
3: 18
4: 341
1092595840_1092595843 -9 Left 1092595840 12:10003965-10003987 CCACCCAGTGTGATTGAGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1092595843 12:10003979-10004001 TGAGGGAAATAGTGTGATTAAGG 0: 1
1: 0
2: 1
3: 15
4: 317
1092595840_1092595849 24 Left 1092595840 12:10003965-10003987 CCACCCAGTGTGATTGAGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1092595849 12:10004012-10004034 GAGGTCTGGCCCTCTTAGCAGGG 0: 1
1: 0
2: 2
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092595840 Original CRISPR TTTCCCTCAATCACACTGGG TGG (reversed) Intronic
901313570 1:8289671-8289693 TTTCCCTCTATCACCCAGGCTGG + Intergenic
903133263 1:21292848-21292870 TCTGCCTCACTCCCACTGGGTGG + Intronic
904306797 1:29595012-29595034 ATCCCCACAATCACCCTGGGAGG - Intergenic
905522759 1:38613137-38613159 GTTCCTGCAACCACACTGGGTGG - Intergenic
906300045 1:44674922-44674944 TATGCCTCAACCCCACTGGGTGG - Intronic
910213162 1:84814483-84814505 GTTCTCTGAACCACACTGGGAGG + Intronic
917965384 1:180175524-180175546 TTTCCCTAAAGCTGACTGGGAGG - Intronic
919403158 1:197145987-197146009 TTTCACTCAATAACTGTGGGTGG - Intronic
920582197 1:207120836-207120858 TCTCCCTCTATCACACAGGCTGG + Intronic
921681963 1:218044318-218044340 TTTCCCTCTATCACCCAGGCTGG - Intergenic
923351697 1:233113723-233113745 TTTCCCTGAACCATCCTGGGTGG + Intronic
1065980611 10:30892082-30892104 TTTTCCTCAATCAATCTGGCTGG + Intronic
1068784956 10:60961836-60961858 TTTCCCTCTATCACCCAGGCTGG + Intronic
1070177015 10:73979382-73979404 TTTCTCTCAAGAACAATGGGTGG - Intergenic
1070477691 10:76846250-76846272 TCTCCGTCACTCACGCTGGGAGG - Intergenic
1075171059 10:120114983-120115005 TTTCCCTGAGGCACACAGGGAGG - Intergenic
1075926676 10:126256717-126256739 TTTCCCTGAATCACTCTGGAGGG + Intronic
1076129528 10:128003294-128003316 GTTCTCCTAATCACACTGGGTGG + Intronic
1076222926 10:128749144-128749166 TCTCCCTCAATCACACTACCTGG + Intergenic
1076289487 10:129334129-129334151 TTTCCATCAATCGCAGGGGGTGG + Intergenic
1077901516 11:6493794-6493816 TTTCCCTCCATCTCACTAGTTGG + Intronic
1078306401 11:10192079-10192101 TTCCCCTCAATCACACTAAAAGG + Intronic
1078574102 11:12483970-12483992 CTTCCATCAATCACCCTGGAAGG - Intronic
1079026581 11:16953052-16953074 TTGCCCTAAATGACACAGGGAGG + Intronic
1079723923 11:23855487-23855509 TTTCCCTCAGTCACTTTGTGAGG + Intergenic
1081297878 11:41414035-41414057 CTTGCCTAAATCACACAGGGTGG - Intronic
1081712078 11:45223871-45223893 TCCCACTTAATCACACTGGGTGG - Intronic
1083115540 11:60455853-60455875 TGTTTCTCAAGCACACTGGGAGG - Exonic
1084017562 11:66394590-66394612 TTTCACTCTATCACCCAGGGTGG - Intergenic
1086945310 11:92838812-92838834 TGTCCAGCAATCAGACTGGGAGG + Intronic
1087976359 11:104552653-104552675 TTTCCCTCAAACTCAATGGTTGG - Intergenic
1088746790 11:112810473-112810495 TTTCCCTCAACATCTCTGGGAGG + Intergenic
1089694789 11:120210513-120210535 TTTCCCTGCCCCACACTGGGAGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090441186 11:126726932-126726954 TCTCACTCACTCACACAGGGAGG + Intronic
1092204107 12:6605424-6605446 GTTCCCCCAATCAGACAGGGTGG + Intronic
1092595840 12:10003965-10003987 TTTCCCTCAATCACACTGGGTGG - Intronic
1093234801 12:16594643-16594665 TTTCCCTTCATTACACTGTGGGG - Intronic
1094784349 12:33828897-33828919 TTTCCCACAACCACACTAAGAGG + Intergenic
1102434582 12:112910983-112911005 TTTCCTTCAGTCACTCTGAGGGG - Intronic
1103275987 12:119712384-119712406 TTTCCCCCGTTCCCACTGGGAGG + Intronic
1104362775 12:128149532-128149554 TTGCCCTCAATTACACAGAGAGG + Intergenic
1108616005 13:52132839-52132861 TTTCCCACAATCACACAAGTAGG + Exonic
1108977522 13:56467145-56467167 TTTCCCTCCATCTCATTGTGTGG - Intergenic
1110171578 13:72506933-72506955 TTTCCCTAAATTCCACTGGTAGG - Intergenic
1110854338 13:80279444-80279466 TTTCACTCTATCACTCTGGCTGG - Intergenic
1111567490 13:90034686-90034708 TTTCCCCCCATCAGACTGGCTGG + Intergenic
1111578766 13:90195457-90195479 TTTCACTCTATCACACAGGCTGG + Intergenic
1113061747 13:106329967-106329989 TCTTCCTCCATCACACTGAGTGG - Intergenic
1113156056 13:107323595-107323617 TTACCCCCAATCAGACTGTGAGG + Intronic
1113900793 13:113796799-113796821 TTTCCATAAATCACACTGAAAGG + Intronic
1113929098 13:113957071-113957093 ATTTCATCAAGCACACTGGGGGG + Intergenic
1113929145 13:113957268-113957290 CTTTCATCAAGCACACTGGGGGG + Intergenic
1113929169 13:113957363-113957385 CTTTCATCAAGCACACTGGGGGG + Intergenic
1117179701 14:53179778-53179800 TTTCCCTCAATCACCCGGGAGGG + Intergenic
1117884735 14:60348644-60348666 TTTCCCTCAAGCAAACTCAGTGG + Intergenic
1118438141 14:65789885-65789907 TTTACCATAATGACACTGGGAGG - Intergenic
1120487687 14:85134835-85134857 TCTCCCTCTATCACCCTGGCTGG - Intergenic
1122704088 14:103609243-103609265 TCTCCTTCAATCCCTCTGGGGGG - Intronic
1123892689 15:24797250-24797272 TCTCACTCTATCACACAGGGTGG + Intergenic
1124115378 15:26837959-26837981 TTTCACTGAATCACAATAGGGGG + Intronic
1125196991 15:37058308-37058330 TTTCACTCTATTACACAGGGTGG + Intronic
1125203414 15:37123025-37123047 CTTCCCACAACCACACTGAGAGG + Intergenic
1125891412 15:43269648-43269670 TTTCCCCCAATCACCCTGGAGGG + Intergenic
1126382672 15:48065194-48065216 TTTCCCTCATCCACACTTCGGGG + Intergenic
1126990712 15:54373339-54373361 TTTCACCCACTCACACTGGCAGG + Intronic
1128829900 15:70758916-70758938 TTTCCCTCTATCACCCAGGCTGG + Intronic
1130968377 15:88714061-88714083 TTTCCCTCACTTACACAGTGAGG - Intergenic
1135061960 16:19278734-19278756 TGTCACACACTCACACTGGGAGG - Intergenic
1135171142 16:20184858-20184880 TTTCCCCCACTCCCACTGCGGGG + Intergenic
1135293539 16:21260618-21260640 TTTCCTTCAATCTCATAGGGTGG + Intronic
1138075174 16:54035337-54035359 TTGCCCTCAACCAAACTGAGGGG - Intronic
1138919825 16:61513377-61513399 TTTCCCTCAAGCATACATGGGGG + Intergenic
1140801509 16:78492425-78492447 TTTGACTCCAGCACACTGGGAGG - Intronic
1141220226 16:82062656-82062678 ATCCTCTCAATCACCCTGGGGGG - Intronic
1141277542 16:82602224-82602246 TTTTGCTCACCCACACTGGGAGG + Intergenic
1141428197 16:83957100-83957122 TGTCCCTCAACCACCCTAGGAGG + Intronic
1145975975 17:28984679-28984701 TTACCCTCTATGACAGTGGGTGG - Intronic
1146685300 17:34837401-34837423 TTTCCCTCAATCTCTCTGCTGGG - Intergenic
1146701815 17:34967627-34967649 TATGCTTCCATCACACTGGGGGG + Intronic
1147681565 17:42250892-42250914 TTTCCCTCTATCACCCAGGCTGG - Intronic
1148256951 17:46143157-46143179 TTTCCCTTTATTTCACTGGGAGG - Intronic
1148350019 17:46934490-46934512 TTTCCCTCTGTCACCCAGGGTGG - Intronic
1149247335 17:54726118-54726140 TATCCCACAATCCCACTGGTGGG + Intergenic
1149979237 17:61296360-61296382 GTTCCCTCAAACCCACTGGATGG - Intronic
1150153440 17:62830088-62830110 TTTCCCTCTATCACCCTGGCTGG + Intergenic
1150525602 17:65919260-65919282 TTTCCCACAATCGAACTGAGTGG + Intronic
1151513637 17:74578398-74578420 TCTCCCTCAATCACCCAGGCTGG + Intergenic
1157342827 18:46794589-46794611 TTTTCCCCCCTCACACTGGGGGG - Intergenic
1157746400 18:50139627-50139649 TTTCCCTAAAGCACACTGCCTGG + Intronic
1158234813 18:55301081-55301103 TTTCCCACTATCTCACTGGTGGG - Intronic
1159063282 18:63539704-63539726 TATTCCCCAAGCACACTGGGAGG + Intergenic
1161454220 19:4362132-4362154 AATCCCTCATTCACACTGTGAGG + Intronic
1161900238 19:7113092-7113114 TTTCTCTCCTTCACAGTGGGTGG - Intronic
1162271851 19:9622185-9622207 TTTATTTCAATCAGACTGGGAGG + Intronic
927267095 2:21163089-21163111 ATTCCCACAATTTCACTGGGGGG - Intergenic
927591806 2:24363089-24363111 TATCCCTGAATCACACAGGGTGG - Intergenic
928943811 2:36754110-36754132 TTTCCTTCTATGCCACTGGGAGG + Intronic
929250976 2:39754755-39754777 TTTCCCTCTACCTCACAGGGTGG + Intronic
931268782 2:60683700-60683722 TTTCGCTCTGTCACACTGGCTGG - Intergenic
931869281 2:66441501-66441523 TTACCCCCAAACACACAGGGGGG + Intronic
935563487 2:104582633-104582655 TTTCCCACAATGCCACAGGGTGG + Intergenic
936265780 2:111005238-111005260 TTGCCCTCCATCACACTGCCAGG + Intronic
937190076 2:120086709-120086731 TCTCCCTCCATTACACAGGGTGG - Intronic
937640583 2:124206473-124206495 TTTCCCTCAACCACAGTGTTGGG + Intronic
938990833 2:136628078-136628100 TTACCCACAATTACACGGGGGGG + Intergenic
939974815 2:148705407-148705429 TCTGCATCAATCACGCTGGGAGG - Intronic
942267630 2:174244323-174244345 TATACCTCAATGACACTGGGAGG + Intronic
942271361 2:174278772-174278794 TTTCACTCTATCACCCTGGCCGG + Intergenic
942826672 2:180185960-180185982 TCTCCCTCAATCACCCAGGCTGG - Intergenic
942826897 2:180189456-180189478 TCTCACTCAATAACACTGTGTGG + Intergenic
946823540 2:223654198-223654220 TTTCCCTCTATCACCCAGGCTGG + Intergenic
947544570 2:231001678-231001700 TTTCCCTCAATAACACTTGCTGG - Intronic
1173496145 20:43519305-43519327 TTTCCTTCTGTCACACAGGGTGG - Intronic
1177893705 21:26837125-26837147 TTTACCTCACTAACAATGGGGGG - Exonic
949505901 3:4727237-4727259 TGTCTCTCAATCACAGTGTGTGG - Intronic
953877188 3:46673170-46673192 CTTACCTCCACCACACTGGGAGG + Intronic
953988748 3:47467061-47467083 TCTCCCTCAGTCACCCAGGGTGG - Intronic
956253433 3:67258830-67258852 TATACCTCAATAAAACTGGGGGG + Intergenic
956860307 3:73316718-73316740 TTTGCCTCACTCATACTTGGAGG + Intergenic
957990957 3:87627214-87627236 TTTTCCCCAATCCTACTGGGGGG - Intergenic
966871621 3:184293598-184293620 TTTCCCTCCCTCACTCTGGAGGG - Intronic
967268436 3:187713048-187713070 TTACACTCAATGACTCTGGGTGG - Intronic
967506063 3:190254260-190254282 ATGTCCTAAATCACACTGGGGGG - Intergenic
972319377 4:37958946-37958968 ATTCCCTCACTGACTCTGGGTGG + Intronic
979829276 4:125280762-125280784 TTTCCCTAAGTCATACTGAGAGG + Intergenic
980229076 4:130024714-130024736 TTTCCCAGAATAACATTGGGTGG + Intergenic
980393094 4:132171032-132171054 TTTCCTTCAATCTCAGTTGGTGG - Intergenic
981434298 4:144702121-144702143 TTTCACTCTATCACCCTGGCTGG - Intronic
983887356 4:172995257-172995279 TTTCACTGAACCACACTGTGCGG - Intronic
984968723 4:185167054-185167076 CTTCCCTCAGCCACACTGGAAGG - Intronic
985018884 4:185666166-185666188 TTTACCTCCAACACACTGGCAGG + Intronic
985997245 5:3603705-3603727 TTTCCCTGAATCAAATTGGATGG + Intergenic
986164398 5:5261166-5261188 TTTCCCTCTATCATACAGGCTGG + Intronic
987671046 5:21008855-21008877 TTTCCCCCAAATACTCTGGGGGG + Intergenic
988055364 5:26087439-26087461 TTTCCCTGAACCCCACTGGTGGG - Intergenic
994349278 5:98725825-98725847 TTTTCCTCAATCCAACTGAGGGG - Intergenic
996628734 5:125602249-125602271 TTTTCCCCAAACACACCGGGCGG + Intergenic
996669228 5:126097500-126097522 TTTCAGTCAATCACAGTGGAAGG - Intergenic
996777346 5:127146890-127146912 TTTACCTCAATAAAGCTGGGGGG - Intergenic
1000923797 5:167169548-167169570 TTTCTCAAAATGACACTGGGAGG - Intergenic
1001332223 5:170770498-170770520 TTTCCATCACTCACCCTGAGAGG - Intronic
1002808282 6:600099-600121 ATTGCCTCAGTCTCACTGGGTGG + Intronic
1004558318 6:16721595-16721617 TCTCCCTCTATCACCCTGGCTGG - Intronic
1005801713 6:29432114-29432136 TTTCCCTCTATCACATGGGAGGG + Intronic
1007718543 6:43871157-43871179 TTCTCCACAATAACACTGGGAGG - Intergenic
1009201828 6:60755559-60755581 TTTCCCGCAATCACTCTCTGAGG - Intergenic
1010177502 6:73046669-73046691 TTTCCCTCTATCACCCAGGCTGG + Intronic
1010670004 6:78676013-78676035 TCTGCCTCAATCACGGTGGGGGG - Intergenic
1011306843 6:85936522-85936544 TCTGCGTCACTCACACTGGGAGG + Intergenic
1011955562 6:93021166-93021188 TTTCCCTCTATCACCCAGGCTGG + Intergenic
1015982514 6:138853440-138853462 TTTCACTCCCTCCCACTGGGAGG - Intronic
1016761753 6:147745806-147745828 TTTCCCTCTATCACCCCGGCTGG + Intergenic
1017493604 6:154965530-154965552 TTTCCCCTAATCATACTGGAGGG - Intronic
1020088586 7:5324697-5324719 TTTTCCTCAAGCCCATTGGGTGG - Intronic
1020171174 7:5846223-5846245 TTTCCCTCCATCACCCAGGCTGG + Intergenic
1025205724 7:56992417-56992439 TTTTCCTCAAGCCCATTGGGTGG + Intergenic
1025666216 7:63584521-63584543 TTTTCCTCAAGCCCATTGGGTGG - Intergenic
1029294110 7:99525862-99525884 TGACTCTGAATCACACTGGGTGG + Exonic
1030703190 7:112662960-112662982 TCTGCATCAATCTCACTGGGAGG + Intergenic
1031433105 7:121697278-121697300 TTTCTCTTAATCACAGTGGGTGG + Intergenic
1034509679 7:151523528-151523550 ATTCCCTGAATTTCACTGGGAGG + Intergenic
1035026079 7:155827183-155827205 TGACCCTCAATCACAGTGTGAGG + Intergenic
1036076789 8:5511547-5511569 ATTACCTCAAACACATTGGGAGG - Intergenic
1039737048 8:40343969-40343991 TATCCTTCAGTCACTCTGGGAGG - Intergenic
1041400102 8:57433755-57433777 TTTCCCTCGGTCACCCTGGCTGG + Intergenic
1042191123 8:66188238-66188260 TTTCCCACAATCACACTTCAAGG - Intergenic
1042207895 8:66347224-66347246 TTGCCCACAATCACACAGGTGGG + Intergenic
1044178706 8:89162917-89162939 TCTCCGTCGCTCACACTGGGAGG - Intergenic
1044752864 8:95432794-95432816 TTTCCCTTGATTACACTGGAGGG + Intergenic
1045318042 8:101060004-101060026 TTTCCCTGAATCACAGTGCATGG - Intergenic
1045910916 8:107408868-107408890 TTTCCCACAATCACAGTGTCAGG + Intronic
1047035443 8:120933443-120933465 TTTCCCTTAAAAACATTGGGTGG + Intergenic
1048484250 8:134832285-134832307 TCTCCCTCAGACACACTGGAGGG - Intergenic
1048863342 8:138740191-138740213 TTTCCCTCAAGGTCAGTGGGAGG + Intronic
1049210890 8:141385964-141385986 TTTTCCTAAGTCACACTGAGGGG + Intergenic
1049331747 8:142058239-142058261 TTTCCCTCAATCACATTCTGGGG - Intergenic
1050025973 9:1334952-1334974 ATTCCCTACATCACACTGGGGGG + Intergenic
1050034519 9:1421435-1421457 TTTCCCCTAATTCCACTGGGTGG + Intergenic
1050941341 9:11462227-11462249 TTTCACTCAGTCACACATGGTGG - Intergenic
1052789872 9:32865351-32865373 TTACCCTGCATCACAGTGGGTGG - Intergenic
1057082040 9:92180457-92180479 TTGCCCTCAAACAAGCTGGGTGG - Intergenic
1057610528 9:96539016-96539038 TTCCCCTCAATAAAGCTGGGCGG + Intronic
1058169701 9:101665633-101665655 ATTCCCCCAATCTCAATGGGAGG - Intronic
1058366343 9:104213524-104213546 TATACCTCAATAAAACTGGGGGG - Intergenic
1061584633 9:131557975-131557997 TAGCCCTCAATCGCACTGGGAGG + Intergenic
1186091802 X:6056444-6056466 TCTCCCTCTATCACCCTGGCTGG - Intronic
1190551337 X:51585236-51585258 TCTCCCTCTGTCACACAGGGTGG + Intergenic
1191987376 X:66996900-66996922 TTTCCCTCAACCTCAGTGGTTGG + Intergenic
1192822182 X:74656993-74657015 TTTTCCTCAATCTCCTTGGGTGG + Intergenic
1193278787 X:79624063-79624085 TTTCCCACAAGAAAACTGGGTGG - Intergenic
1196179255 X:112672118-112672140 TTTCCCACAATCAAAATGGGAGG + Intronic
1197448064 X:126577081-126577103 TCTCACTCAATCACACTCAGGGG - Intergenic
1199742021 X:150744890-150744912 TTTCCCTCAGTGACCTTGGGTGG - Intronic
1201100999 Y:10672655-10672677 TTTCACTCATTCACACAGGCTGG + Intergenic
1201101348 Y:10677657-10677679 TCTCACTCAGTCACACTGGCTGG + Intergenic
1201103051 Y:10692998-10693020 TTTCACTCATTCACACAGGCTGG + Intergenic
1201173764 Y:11294974-11294996 TTTCACTCTGTCACACTGGCTGG + Intergenic