ID: 1092596050

View in Genome Browser
Species Human (GRCh38)
Location 12:10005689-10005711
Sequence GGTCAGGTATATTCACCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092596050 Original CRISPR GGTCAGGTATATTCACCTGA TGG Intronic
910096594 1:83529607-83529629 CGTCAGGGATATTGGCCTGAAGG + Intergenic
913537294 1:119785426-119785448 GGTCAGGTACATTCACTTGATGG + Intergenic
913685340 1:121226507-121226529 AGTTAGCTATCTTCACCTGATGG + Intronic
914037186 1:144014111-144014133 AGTTAGCTATCTTCACCTGATGG + Intergenic
914152269 1:145053821-145053843 AGTTAGCTATCTTCACCTGATGG - Intronic
918860338 1:189817019-189817041 CGTGAGGTATATTTACTTGAAGG - Intergenic
920472658 1:206245065-206245087 AGTTAGCTATCTTCACCTGATGG + Intronic
1071145585 10:82566669-82566691 TGTCAGGAATAGTCACATGAGGG + Intronic
1071727448 10:88213700-88213722 GGTCAGTTATTTTTATCTGAAGG + Intergenic
1072056881 10:91766986-91767008 GGTCAGCTGTATTAACCTGCAGG + Intergenic
1072673836 10:97451172-97451194 GGTGAGGAATAATCATCTGAAGG + Intronic
1074380964 10:112980117-112980139 TGTCAGGTTTATACTCCTGAGGG + Intronic
1080219949 11:29890555-29890577 TGTCAGGTATAGACACCTGTGGG - Intergenic
1090390351 11:126383763-126383785 GTTCAGGCAGATTCACCAGAGGG + Intronic
1092596050 12:10005689-10005711 GGTCAGGTATATTCACCTGATGG + Intronic
1096727157 12:53573738-53573760 GGTAAAGTATTTTCTCCTGAGGG - Intronic
1102589716 12:113948064-113948086 GGTCAGGTCAATTTTCCTGATGG + Intronic
1107849205 13:44553091-44553113 GGTCATGTATAGTCAAGTGACGG - Intronic
1108086232 13:46796607-46796629 GGTCAGGAGCACTCACCTGATGG - Intronic
1119305075 14:73601195-73601217 CTTCAGGTACATTTACCTGATGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1131296080 15:91150332-91150354 GGTCAGGTGTATACAGCTGTTGG + Intronic
1140786160 16:78344091-78344113 GGTCAGGTATATCATCCTAAGGG + Intronic
1147980468 17:44270956-44270978 GGTCAGTTTGATTCATCTGAAGG + Intergenic
1150761872 17:67969600-67969622 GCTAAGGTATATTCAACTAATGG - Intronic
1153838628 18:8986744-8986766 AGTCAGGAATATTCTCCTGATGG - Intergenic
1168020680 19:53606680-53606702 GGACAGGTATATGCACCGGGCGG + Intergenic
1168020693 19:53606730-53606752 GGACAGGTATATGCACCGGGCGG + Intergenic
925945505 2:8859043-8859065 TGTCAGGTTTCTTCTCCTGAGGG - Intronic
927498842 2:23568524-23568546 GCTCAGGCTTATTCACCTGGTGG + Intronic
931018229 2:58011013-58011035 GGCCAGCTAGTTTCACCTGATGG - Intronic
931537757 2:63298125-63298147 GGACTGGTATATGCACCTGGTGG - Intronic
936467872 2:112769541-112769563 GGTCAAGTAACTTTACCTGATGG + Intergenic
939951878 2:148484784-148484806 TGCCAGGTATATTTAACTGATGG + Intronic
945375692 2:209077466-209077488 GGCAAGGTGTATTCACTTGAAGG + Intergenic
946541814 2:220693049-220693071 GGTCAGATATATTCAAGGGAAGG - Intergenic
1168801698 20:647547-647569 GCTCAGGCTTATTCACATGATGG - Exonic
1171455420 20:25269279-25269301 GGTCAGGTAAATTGGCCTCAGGG + Intronic
1182873858 22:33673307-33673329 GGTCAGGCTTATTCAACTGGTGG - Intronic
950439448 3:13000641-13000663 GGTGAGGTATATGCAGCAGAGGG + Intronic
951116408 3:18867789-18867811 GTTCAGGAATAGTCACCTGCAGG - Intergenic
956127206 3:66021962-66021984 AGGCACTTATATTCACCTGATGG - Intronic
957032205 3:75254976-75254998 AGTCAGGTATATTCAACATAGGG - Intergenic
964417044 3:156458434-156458456 TGTGAGGTATAATCACCTGCAGG + Intronic
964543764 3:157809781-157809803 GCTCAGATATATACTCCTGAAGG + Intergenic
970902941 4:21181139-21181161 GGTCAGGAATATCCTCCTGAGGG + Intronic
984341179 4:178458511-178458533 TGTCAGGGAGATTTACCTGATGG - Intergenic
984746016 4:183218817-183218839 GATGAGGTATATTCACATTATGG + Intronic
992953785 5:81887477-81887499 GGTCAGGTACCTTCTCCTGAAGG - Intergenic
993231056 5:85236878-85236900 GGTCAGTTATATTCCACAGAAGG + Intergenic
994790577 5:104221448-104221470 GGTTCCGTGTATTCACCTGATGG + Intergenic
1002037819 5:176486426-176486448 GGTCAGCTGTATTAACCTGCAGG - Exonic
1015705261 6:136080926-136080948 GTTCAAGTATCTTCTCCTGAAGG - Intronic
1015861902 6:137690191-137690213 GGTCAGTCATATACACCTCAGGG + Intergenic
1017071852 6:150582174-150582196 AGTCAGTTATATTCAGCTTAAGG - Intergenic
1020805788 7:12789076-12789098 GGTAAGGTTTATGCACCCGAAGG + Intergenic
1021472484 7:21020861-21020883 GGTCAGATATATTAGCCTGTGGG - Intergenic
1026193790 7:68154311-68154333 GGTCAGTTATATTCACATTTGGG - Intergenic
1028987440 7:97019158-97019180 GGTAAGGTAAATTCCCCTCAAGG + Intergenic
1031917825 7:127579597-127579619 GGACAGGTTTATTCCCCAGATGG + Intergenic
1039254925 8:35708662-35708684 GGTTTGGTAAGTTCACCTGAAGG + Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1059034987 9:110744766-110744788 ACTCAGGTATATGGACCTGAGGG - Intronic
1203788203 EBV:139672-139694 GGGCAGCTATATTCACCTTGAGG - Intergenic
1186118988 X:6338036-6338058 GGTGAGGTAGATGCACTTGAAGG - Intergenic
1189638029 X:43033340-43033362 AGTCATGTTTATTGACCTGAAGG + Intergenic
1191953811 X:66622941-66622963 GGGAAGGGATATTCTCCTGATGG - Intronic
1193202370 X:78706805-78706827 GGTCACAAATATTTACCTGAAGG + Intergenic