ID: 1092599777

View in Genome Browser
Species Human (GRCh38)
Location 12:10047828-10047850
Sequence GGAAACCTTTTAGCTGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092599775_1092599777 -5 Left 1092599775 12:10047810-10047832 CCTGAGTCTTTAATGAGTGGAAA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1092599777 12:10047828-10047850 GGAAACCTTTTAGCTGGTAGAGG 0: 1
1: 0
2: 0
3: 18
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092599777 Original CRISPR GGAAACCTTTTAGCTGGTAG AGG Intronic
901181110 1:7342417-7342439 GGAAACCATTTAGCAGGGAAAGG - Intronic
902111326 1:14081010-14081032 GAAAACCTTTTAGCTAGCAAGGG + Intergenic
903202011 1:21749053-21749075 TCAAACATTTTAGCTGATAGTGG + Intronic
904162144 1:28530055-28530077 GGAAACCTTCCAGCTGGGTGGGG - Intronic
906494921 1:46298410-46298432 GGAAACCTCTTGGGTGGGAGGGG - Intronic
906953830 1:50356312-50356334 GGTAATCTTTTTGCTGGTGGAGG - Intergenic
908654303 1:66371694-66371716 GGAATGCTTTTGGCTGGTAGAGG - Intronic
908728559 1:67202523-67202545 GAAAAGCTGTTAGCTGGCAGTGG - Intronic
909139863 1:71849764-71849786 TGTAACCTTTTTGCTGGTGGAGG - Intronic
913351096 1:117860334-117860356 CGTAATCTTTTTGCTGGTAGAGG - Intergenic
913699290 1:121358838-121358860 GGAAACCTCTTGGCTGGGACAGG + Intronic
914138254 1:144921198-144921220 GGAAACCTCTTGGCTGGGACAGG - Intronic
915032046 1:152888430-152888452 GGTAATCTTTTTGATGGTAGAGG + Intergenic
916468900 1:165103146-165103168 TGTAATCTTTTTGCTGGTAGGGG - Intergenic
916958501 1:169865361-169865383 GTAAACCTGTTTGCTGATAGCGG - Intronic
918582521 1:186147823-186147845 GTCAATCTTTTAGCTGGCAGAGG + Intronic
920486698 1:206377550-206377572 GGAAACCTCTTGGCTGGGACAGG + Intronic
920495080 1:206448754-206448776 GGAAACCTTTGAGATGGTGGGGG - Intronic
922188601 1:223297553-223297575 GGAAAACTTTCCGTTGGTAGAGG - Intronic
923763309 1:236868223-236868245 TGTAACCTTTTTGCTGGTAGAGG - Intronic
1064085162 10:12340298-12340320 GGAAACCTATTGGCTTGTAGTGG - Intergenic
1065880726 10:30035580-30035602 GTACACATTTTAGCTGGTAATGG - Intronic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1067784721 10:49237054-49237076 GAAAACCTTGTTGTTGGTAGAGG - Intergenic
1068524248 10:58109256-58109278 GGGAACTTTTTAACTGGCAGAGG - Intergenic
1069536598 10:69258122-69258144 GGAAACCTCTTACCTGGCATGGG - Intronic
1070944589 10:80378902-80378924 GTAAATCTTTTTGCTGGTGGTGG + Intergenic
1074541600 10:114369823-114369845 GCAAAGGTTTTATCTGGTAGAGG - Intronic
1074959202 10:118424075-118424097 GGAAACCTTTCGGCTGTTTGTGG - Intergenic
1075001336 10:118800747-118800769 AGACACCATTTAGCTCGTAGTGG + Intergenic
1085222167 11:74883767-74883789 GGAAACACTACAGCTGGTAGGGG - Intronic
1085556720 11:77429513-77429535 TGCATCCTTTTAGATGGTAGTGG - Intronic
1089042120 11:115462009-115462031 GGGAAACATTTAGCCGGTAGAGG + Intronic
1089722156 11:120435964-120435986 GGTAACCTATTAGCTAGTAAGGG - Intronic
1090449282 11:126791789-126791811 AGACACCTTTTAGCAGGTGGAGG + Intronic
1090523318 11:127502369-127502391 AGAAATCTTTTTGCTGGTGGAGG - Intergenic
1090843026 11:130509018-130509040 CGATACCTTTTATCTGGGAGGGG + Intergenic
1092599777 12:10047828-10047850 GGAAACCTTTTAGCTGGTAGAGG + Intronic
1093100467 12:15022393-15022415 CAAAACATTTTAGCTGGGAGTGG + Intergenic
1095692129 12:45101698-45101720 GGAAACCTTTGTTATGGTAGTGG + Intergenic
1096906406 12:54940658-54940680 TGTAACCTTGTTGCTGGTAGAGG - Intergenic
1100938543 12:99698588-99698610 GGGAACCTTTTAGTAGGTAATGG - Intronic
1101944707 12:109127852-109127874 TGACAACTTTTAGCTGGCAGTGG - Intronic
1102671053 12:114619228-114619250 GGAAACATTTTAGCTGGGCATGG - Intergenic
1102798760 12:115713273-115713295 GTGATCCTTATAGCTGGTAGGGG - Intergenic
1105081921 13:16131765-16131787 GGAAATTTTTTAGCTGCTTGAGG + Intergenic
1109479284 13:62928134-62928156 AGAGACATTTGAGCTGGTAGGGG + Intergenic
1112338761 13:98536035-98536057 GAAAATCTTTTAGCTTTTAGAGG + Intronic
1113722535 13:112570581-112570603 CGAAATCTTTTTGCTGGTGGAGG + Intronic
1113730309 13:112636946-112636968 GGAAAACTGGTAGCTGGCAGTGG - Intergenic
1115593105 14:34883072-34883094 GGAAACTTTTTAGCTGGGCATGG + Intergenic
1115922809 14:38395520-38395542 GGAAACATTTCAGGTAGTAGAGG - Intergenic
1116400922 14:44505861-44505883 GGAGACTTTTCAGCTGGTGGAGG + Exonic
1121374140 14:93390316-93390338 AGAAACCTTTTATCAGGTTGAGG - Intronic
1121453792 14:94026185-94026207 GGAAAGCTTTTAACTAGCAGAGG - Intergenic
1122821387 14:104347170-104347192 GGAAACCTTATTGCAGGTGGGGG + Intergenic
1126463109 15:48934946-48934968 AGAAACCTTGTACCTGTTAGAGG - Intronic
1126879007 15:53074500-53074522 AGAAACCTTTGAGATGGTTGAGG + Intergenic
1127251894 15:57247352-57247374 GGAAACTTTGGAGGTGGTAGAGG - Intronic
1128189765 15:65680907-65680929 GGTAATCTTTTTGCTGGTTGAGG + Intronic
1131909752 15:97185191-97185213 TGTAATCTTTTAGCTGGTTGAGG + Intergenic
1133755817 16:8761651-8761673 GGAAACCTTTTAGCCCGTGGAGG - Intronic
1134445785 16:14330433-14330455 AGAAACCCTTTAGCTGGGCGCGG + Intergenic
1136692622 16:32046357-32046379 GGAAAGCTGTTAGCTTGTACGGG + Intergenic
1136876734 16:33864474-33864496 GGAAAGCTGTTAGCTTGTACGGG - Intergenic
1137845685 16:51685649-51685671 GGAAACATTTTAGCCTGTAGGGG + Intergenic
1203095375 16_KI270728v1_random:1251274-1251296 GGAAAGCTGTTAGCTTGTACGGG + Intergenic
1143360310 17:6364023-6364045 GGGAACCTCTGAGCTGGTAAAGG - Intergenic
1144702285 17:17347535-17347557 AGAAACCTCTAAGCTGGTCGAGG - Exonic
1148678329 17:49458007-49458029 GGAATCCTGTTAGGAGGTAGTGG + Intronic
1150032094 17:61749272-61749294 AGAAACCTTTTAGTTTGTTGTGG - Intronic
1156894460 18:42229581-42229603 GAAAACCTTCTTGCTGGTAGGGG + Intergenic
1159575080 18:70165734-70165756 GGAAACCTTTTAGGTTGTTGTGG - Intronic
1159688810 18:71459580-71459602 GGAAACATTCTATATGGTAGAGG - Intergenic
1161019871 19:2004101-2004123 GGGAAACTCTTAGCTGGGAGGGG - Intronic
1162022719 19:7874898-7874920 GGAAACCCCTTATCTGGTTGGGG + Intergenic
1164242438 19:23401496-23401518 GGAAACATTTGTGCTGGTATGGG + Intergenic
1165125281 19:33591240-33591262 TGTAATCTTTTTGCTGGTAGAGG - Intergenic
927086330 2:19677032-19677054 CTAAACCTTTTAGCTGGCTGGGG - Intergenic
928574041 2:32636801-32636823 GAAGACCTTTTAGTTGGAAGTGG + Intronic
928631365 2:33195932-33195954 CATAACCTTTTTGCTGGTAGAGG - Intronic
928833844 2:35520310-35520332 GGAAGCCTATTAGATGTTAGAGG + Intergenic
931349993 2:61479139-61479161 GCAAACCTGTTAACTGGTGGGGG + Intronic
931573480 2:63695779-63695801 GGAAACCATGTTGCTGGAAGAGG - Intronic
932526792 2:72478367-72478389 GGAAACCTTTATGCTGGAAAAGG - Intronic
934553997 2:95277950-95277972 GGACACCTTTTAGCTGGTGCAGG - Exonic
938808909 2:134833726-134833748 GGACATCTTTGAGCAGGTAGAGG - Intergenic
938998774 2:136709149-136709171 GGAAACCTTTTGGCTGTAAGAGG + Intergenic
940498928 2:154470141-154470163 GAAAACATGTTAGATGGTAGAGG - Intergenic
942784274 2:179682895-179682917 GTCATCCCTTTAGCTGGTAGAGG + Intronic
943713396 2:191123416-191123438 GGAAACCTTTTAGCAGAAGGAGG - Intronic
943734982 2:191344280-191344302 GAAAGCCTTTTAACTGGTGGTGG + Intronic
947668100 2:231919669-231919691 GAAAACCCTTTAGCTTCTAGTGG + Intergenic
948254957 2:236560583-236560605 GCAAACCATTTATCTGGTAAAGG - Intergenic
1171162441 20:22940400-22940422 AGAACCCTTTTATCTGGAAGAGG - Intergenic
1179218632 21:39387848-39387870 GGAGACCTGTAAGCTGGAAGGGG + Intronic
950413926 3:12857373-12857395 AGAAACCATTTAGGTGGTAATGG + Intronic
950481125 3:13244701-13244723 GGAATCCTTTCAGCAGGGAGAGG + Intergenic
954151697 3:48661095-48661117 GGAAAGCTATGAGCTGGTGGTGG - Exonic
955969942 3:64428852-64428874 TGCAACCTTTTTGCTGGTAGAGG - Intronic
959559478 3:107763179-107763201 AGAAACCATTTAACTGGTGGAGG - Intronic
960179670 3:114560697-114560719 GGTAATCTTTTTGCTGGTGGAGG + Intronic
962173989 3:133133312-133133334 TGTAATCTTTTTGCTGGTAGAGG - Intronic
963542851 3:146616496-146616518 CAAAACCTTTTTGCTGGTGGAGG - Intergenic
964535144 3:157713072-157713094 TGTAATCTTTTTGCTGGTAGAGG - Intergenic
965099911 3:164282910-164282932 TGGAATCTTTTAGCTGGTGGAGG - Intergenic
965851964 3:173038578-173038600 GGAAATCTTTTTGCACGTAGAGG + Intronic
968539546 4:1157327-1157349 GGTAACCTTTTTGCTGGTGGAGG + Intergenic
969218029 4:5738582-5738604 TGTAATCTTTTAGCTGGTGGAGG - Intronic
970628932 4:17920422-17920444 GGTAATCTTTTTGCTGGTGGAGG + Intronic
970981504 4:22103952-22103974 GGAGACCTTTTATCTGGGTGGGG + Intergenic
973929539 4:55777399-55777421 GTAAACCGTATATCTGGTAGGGG + Intergenic
975124779 4:70769484-70769506 TGTAATCTTTTTGCTGGTAGAGG + Intronic
975324635 4:73045405-73045427 TGTAATCTTTTTGCTGGTAGAGG + Intergenic
975849249 4:78554811-78554833 GGAAAACTTCTAGCTGTTTGGGG + Intronic
976154888 4:82132688-82132710 GGTAATCTTTTTGCTGGTGGAGG - Intergenic
981208629 4:142073996-142074018 TGAAGCTTTTTAGCTGGGAGGGG - Intronic
981564618 4:146086295-146086317 TGCAATCTTTTAGCTGGTGGAGG + Intergenic
982557095 4:156881210-156881232 AGTAACCTTTTTGCTGTTAGAGG - Intronic
982891803 4:160863489-160863511 GAAAACCTTTTAACTGGCTGTGG - Intergenic
984025542 4:174539072-174539094 GGGAACCTGTCAGGTGGTAGAGG + Intergenic
985516661 5:349285-349307 GAAAACCTTTTGGCTGGGCGCGG + Intronic
988200092 5:28056029-28056051 GGAAACTTTGTAGTTGGTACAGG + Intergenic
988209183 5:28180744-28180766 GAAAACCATTTATCTGGTAAGGG - Intergenic
992749680 5:79850459-79850481 GGAAACTTTTTATATGCTAGGGG - Intergenic
992821020 5:80496297-80496319 TGTAATCTTTTAACTGGTAGAGG - Intronic
993771660 5:91935741-91935763 TGTAACCTTTTTGCTGGCAGAGG + Intergenic
993798177 5:92296801-92296823 GGAAACTATGTAGCTGGTAGAGG - Intergenic
994032032 5:95154097-95154119 GGAAGCCTTTGAGTTGGTGGTGG + Intronic
995114835 5:108468143-108468165 TGTAATCTTTTTGCTGGTAGAGG + Intergenic
996550271 5:124723184-124723206 AGAAACCTTGTAGCTGGGAGTGG - Intronic
996586761 5:125097231-125097253 CATAACCTTTTTGCTGGTAGAGG - Intergenic
996643224 5:125783431-125783453 CGTAACCTTTTTGCTGGTGGGGG - Intergenic
996841836 5:127855042-127855064 GGTAATCTTTTTGCTGGTGGAGG + Intergenic
997566353 5:134889947-134889969 TGTAATCTTTTTGCTGGTAGAGG + Intronic
998957320 5:147452005-147452027 GGGATCCTTTTGCCTGGTAGAGG - Intronic
999245189 5:150150450-150150472 TGAAACCTTTTATCTGCCAGAGG - Intronic
1005391105 6:25334161-25334183 GGAAACCTTGCAGCTCATAGCGG - Intronic
1007490128 6:42214409-42214431 GGTAACCTTTTAGTTTTTAGTGG - Intronic
1008334169 6:50280250-50280272 AGATACATTTTAGCTAGTAGAGG + Intergenic
1008519371 6:52348530-52348552 GGAAACTTTTTAGCAATTAGAGG + Intergenic
1010920601 6:81675329-81675351 TGTAATCTTTTTGCTGGTAGAGG + Intronic
1012942480 6:105429895-105429917 GGAAAGCTTCTATCTGGAAGTGG + Intergenic
1013031050 6:106333455-106333477 GGTAATCTTTTTGCTGTTAGAGG - Intergenic
1013414893 6:109916320-109916342 TGTAACCTTTTTGCTGGTGGAGG - Intergenic
1013740466 6:113278000-113278022 GAACACCCTTTAGCAGGTAGAGG + Intergenic
1016741929 6:147537772-147537794 GAAAACCTTTTCTCTGATAGAGG + Intronic
1016842098 6:148534792-148534814 GGACACCTTTAAGCTGCTGGAGG + Exonic
1017533237 6:155318511-155318533 GTTAACCTTTTTGCTGGTAGAGG + Intergenic
1019214119 6:170431739-170431761 GGAAACATTTTAGCAGGTTTTGG + Intergenic
1019518972 7:1452113-1452135 TGAAACCTGTTACCTGGGAGGGG - Intronic
1019691360 7:2415508-2415530 GGCAATCTTTTTGCTGGTGGAGG + Intronic
1020822726 7:12990141-12990163 TGAAAAATTTTAGCTGGCAGAGG + Intergenic
1021219111 7:17954151-17954173 GGTAATCTTTTTGCTGGTGGAGG - Intergenic
1022235141 7:28453889-28453911 GTAAACCTTTTTGCTGGAAGAGG + Intronic
1026330375 7:69347015-69347037 CGTAACCTTTTTGCTGGCAGAGG + Intergenic
1027304171 7:76875069-76875091 GGAAAACTTTTAGCTGGCCCAGG + Intergenic
1028065058 7:86373870-86373892 CATAATCTTTTAGCTGGTAGAGG - Intergenic
1029044285 7:97611664-97611686 AGATACCCTTTAGCTGGTTGAGG - Intergenic
1034729457 7:153372444-153372466 GGATGCCTTTTACCTGGTTGAGG - Intergenic
1035627722 8:1084979-1085001 GGAACCCTGTTCGCTGTTAGTGG - Intergenic
1036019317 8:4825712-4825734 GCAAACCATTTATCTGGTAAGGG + Intronic
1037006546 8:13788249-13788271 TGTAATCTTTTTGCTGGTAGAGG + Intergenic
1037365587 8:18118255-18118277 GGAAACCTTATGGCTGGGCGTGG - Intergenic
1039906763 8:41792016-41792038 TGAAACCTATTAGCGTGTAGGGG - Intronic
1041971735 8:63750898-63750920 GGAAACAATTTCCCTGGTAGGGG + Intergenic
1042695397 8:71548651-71548673 GGGACGCTTTGAGCTGGTAGGGG + Intronic
1043305823 8:78793577-78793599 GTAAACTTTTTTGCTGGTGGAGG + Intronic
1043885652 8:85596781-85596803 GGAAGCCATTGAGGTGGTAGTGG - Intergenic
1043916910 8:85933498-85933520 GGAACACTTTTAGCAGGTAAGGG - Intergenic
1043959658 8:86402439-86402461 AAAAACTTTTTAGCTGGTTGTGG - Intronic
1047034384 8:120918938-120918960 TGTAATCTTTTTGCTGGTAGAGG + Intergenic
1047327212 8:123851386-123851408 GCAAACCTTTCAGCTGGTTGAGG + Intergenic
1048564237 8:135578136-135578158 GGAAACATGTTAGCTGATAAAGG - Intronic
1049834706 8:144727560-144727582 GAAAACCTTGAAGCTGGCAGAGG - Intronic
1054349691 9:64009926-64009948 CGTAATCTTTTTGCTGGTAGAGG - Intergenic
1056830923 9:89916780-89916802 GAAAACCTTTTATTTAGTAGAGG - Intergenic
1060480581 9:124014849-124014871 GGAAAGCCTTTACCTGGGAGTGG - Intronic
1186849077 X:13561939-13561961 TGTAACCTTTTCGCTGGTGGAGG + Intergenic
1186953462 X:14654240-14654262 TGTAATCTTTTTGCTGGTAGAGG - Intronic
1194591819 X:95808522-95808544 TGTAACCTTTTTGCTGGTAGAGG - Intergenic
1195740141 X:108056761-108056783 GGAATCCTTTTATTTGGTGGTGG + Intronic
1198022373 X:132671587-132671609 GGAAAGCTATCAGCTGGCAGCGG + Intronic