ID: 1092605134

View in Genome Browser
Species Human (GRCh38)
Location 12:10110465-10110487
Sequence CGTCCTCTTTACCAATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092605134 Original CRISPR CGTCCTCTTTACCAATTTGA AGG (reversed) Intronic
904889206 1:33765811-33765833 GGTATTCTTTCCCAATTTGAAGG - Intronic
905551885 1:38848236-38848258 CTTCCTCTTCTCCAATTAGAAGG - Intronic
913471011 1:119186234-119186256 CTTCTTCCTTTCCAATTTGAGGG + Intergenic
916331330 1:163620818-163620840 CTTCCTCTTTACTGATTTGGAGG + Intergenic
920355959 1:205372826-205372848 CCTTCTCTCTGCCAATTTGAAGG + Intergenic
922243395 1:223772044-223772066 TTCCCTCTTTACTAATTTGAGGG + Intronic
1069939011 10:71940709-71940731 TGTCCTCTTAACCACTGTGAGGG - Intergenic
1073659204 10:105454102-105454124 AGTCTTCTTTACCAATGTTAAGG - Intergenic
1075158216 10:119998895-119998917 CTTCCTCTTTTCCAATTTGGAGG + Intergenic
1076262973 10:129084865-129084887 TGTCTTCTTTCCCAATTTCAGGG - Intergenic
1079728915 11:23915884-23915906 CTTCTTCCTTTCCAATTTGAAGG + Intergenic
1087552612 11:99670727-99670749 CGTGCTTTTTACCAGTTTGCAGG - Intronic
1087614649 11:100473911-100473933 AGTCCTCATTACCAATGGGAAGG + Intergenic
1088147171 11:106695220-106695242 CGTCCTCTCTTCCATTTTGTTGG - Intronic
1088389034 11:109292855-109292877 CTTCCTCTTTTCCTATTTGGTGG - Intergenic
1092605134 12:10110465-10110487 CGTCCTCTTTACCAATTTGAAGG - Intronic
1094104513 12:26796419-26796441 CTTACTTTTTACCAATTTGTTGG - Intronic
1097581285 12:61459891-61459913 TTTCCTCTTTACCATCTTGATGG - Intergenic
1098960409 12:76734229-76734251 CTTCCTCTTTACTAATTTGGAGG + Intergenic
1100907085 12:99313948-99313970 CTTCCTCTCTTCCTATTTGAAGG - Intronic
1101394262 12:104330504-104330526 GGTCTTCTTTACCATTTTAATGG + Intronic
1106743317 13:32671559-32671581 CTTCCTATTTATCAATTTTATGG - Intronic
1107139876 13:36987087-36987109 CCTCCTCTTTGCCAGTTTAATGG + Intronic
1109976492 13:69841246-69841268 CTTCTTCTTTACCAATTTGGAGG - Intronic
1110902781 13:80844855-80844877 CATCCTCATTAAGAATTTGATGG + Intergenic
1113330411 13:109321191-109321213 CTTCCTCTTTACCGACTTGGAGG - Intergenic
1115390610 14:32851013-32851035 CTTCTTCTTTTCCAACTTGAAGG + Intergenic
1116332473 14:43613410-43613432 CTTCCTTTTTCCCAATATGAGGG - Intergenic
1117078611 14:52128689-52128711 CTTCCTCTTTTCCAAGTGGAGGG + Intergenic
1118361007 14:65056509-65056531 TTTCCTTTTTGCCAATTTGATGG + Intronic
1120743783 14:88135572-88135594 TGTCCTCTTTACCACTCCGAGGG + Intergenic
1128394788 15:67213401-67213423 CCACCTCTTTACAAATCTGAGGG + Intronic
1130098858 15:80876692-80876714 TGTCCTCTTTGCCCATTGGAAGG - Intronic
1133576164 16:7092826-7092848 TGTCCCCTTTACCAAATCGAAGG + Intronic
1135203188 16:20457846-20457868 CTTCCTCTTTACCAATTTGGAGG - Intronic
1135215915 16:20570020-20570042 CTTCCTCTTTACCAATTTGGAGG + Intronic
1138200980 16:55088199-55088221 TGTCTTCTTTGCCAATTTGAAGG + Intergenic
1138876900 16:60962830-60962852 CTTTCTTTTTTCCAATTTGATGG + Intergenic
1152384121 17:79959293-79959315 TGTCATCTTAACCAAGTTGACGG - Intronic
1164315392 19:24082998-24083020 CTACCTCTTTACCAACTTGGAGG - Intronic
925413078 2:3651189-3651211 CGTCCTCTTTTCCCACTAGATGG - Intergenic
927281011 2:21306428-21306450 TCTCATCATTACCAATTTGAGGG - Intergenic
928951533 2:36817574-36817596 TTTCCTCTTTTGCAATTTGAGGG - Intergenic
929659659 2:43770971-43770993 GATCCTCTTAACCAATTTTAAGG - Intergenic
932266552 2:70372229-70372251 CTTCCTCCTTACAAATTTGGAGG + Intergenic
932748315 2:74353755-74353777 AGTCCTATTTAGCAATTTCAGGG + Intronic
935688153 2:105704516-105704538 CTTTCTCTTTTCCAATTTGGAGG - Intergenic
939826595 2:147023144-147023166 CCTCAAATTTACCAATTTGAGGG + Intergenic
940437944 2:153677057-153677079 CTTCCTCTTTTCCAATTTAAAGG - Intergenic
940604580 2:155904329-155904351 AGGCCTCATTACCAATTTCATGG - Intergenic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
948324516 2:237102746-237102768 CCTCCTTTTTTCCACTTTGAAGG + Intergenic
1173016709 20:39232502-39232524 CTTGCTCTTTAGCAAGTTGAAGG + Intergenic
1173376489 20:42488416-42488438 CTACCTTTTTACCAATCTGATGG + Intronic
1178620718 21:34172060-34172082 TGTCTTCTTTACCAATTTGCTGG - Intergenic
1180665219 22:17505420-17505442 TGTCCTCTTCACCAAATTCAGGG + Intronic
1181890579 22:26059571-26059593 CGTCCTCTTTCCCAAACTCAGGG - Intergenic
951166513 3:19489379-19489401 TGTCCTCTTAACCACTGTGAGGG + Intronic
962774082 3:138642309-138642331 CTTCCTCTTTTCCAATTTGGAGG + Intergenic
970658294 4:18256519-18256541 TTTGCTCTTTACCAATTTGGAGG + Intergenic
972049139 4:34706257-34706279 CTTTCTCCTTACCAATTTGGAGG - Intergenic
975435083 4:74342815-74342837 AGTCCTCTTTACTCATTAGAAGG + Intergenic
985942437 5:3149002-3149024 CGTCCTAATTCTCAATTTGATGG - Intergenic
987070402 5:14331770-14331792 CTTCCTCGTAACTAATTTGAAGG + Intronic
988628992 5:32909206-32909228 TGTCCACTTTACCAATTTTGTGG - Intergenic
991346341 5:65672769-65672791 TGTCGACATTACCAATTTGAGGG - Intronic
1017489765 6:154934736-154934758 TGTCCCCTTTCCCAATGTGAGGG - Intronic
1018116006 6:160586050-160586072 CTTCAGCTTTACCATTTTGAAGG - Intronic
1022127127 7:27369333-27369355 CGTCCTTTCTCCCAATTAGATGG + Intergenic
1022870020 7:34467682-34467704 CTTTCTCTTTTCCAATTTGGAGG + Intergenic
1022950045 7:35329519-35329541 CTTCATCTTTGCCCATTTGATGG - Intergenic
1024327676 7:48123527-48123549 CTTCCTCTTTATCGATTTGGAGG + Intergenic
1028798964 7:94938966-94938988 CATCCTCTTCCACAATTTGAGGG - Intronic
1030214422 7:107029429-107029451 CGTCCTTTTTACCGATTTGCTGG - Intergenic
1032999965 7:137492976-137492998 CATCCTCTGTACCACTTTGCTGG + Intronic
1035304093 7:157918969-157918991 AGTCCTCTTTATCAATAAGATGG - Intronic
1035930365 8:3773708-3773730 CCTCCTCATCATCAATTTGAAGG - Intronic
1036944482 8:13081827-13081849 CATCCTATCTACCAATTTAATGG - Intergenic
1037239815 8:16764170-16764192 CGATCTCTTTACCATGTTGATGG - Intergenic
1041768293 8:61443811-61443833 AAACCTGTTTACCAATTTGAGGG + Intronic
1045409211 8:101899529-101899551 GATACTCTTTATCAATTTGAGGG + Intronic
1050912068 9:11083731-11083753 ATTGCTCTTTACCCATTTGAAGG + Intergenic
1051946452 9:22575058-22575080 CCTCCTCTTCAATAATTTGAAGG - Intergenic
1054780561 9:69162518-69162540 TGTCCTCTATACTAGTTTGAAGG + Intronic
1058252005 9:102710754-102710776 GGTCCTCCTCACTAATTTGATGG + Intergenic
1059544325 9:115161064-115161086 AGTCCTCCTTCCCAATGTGATGG + Intronic
1187137632 X:16563621-16563643 TGTCATTTTTACCAATTAGATGG + Intergenic
1191140360 X:57109862-57109884 CTACCTCTTTACCGATTTGGAGG - Intergenic
1193636130 X:83950982-83951004 CTTCCTCTTTACAAATTTGGAGG - Intergenic
1194176662 X:90658189-90658211 CTTCCTCCTTTCCAATTTAAGGG + Intergenic
1194347215 X:92780888-92780910 CTTCCTCTTCACTGATTTGAAGG - Intergenic
1200119027 X:153781760-153781782 CGCACTCTTCACCACTTTGAGGG - Exonic
1200371563 X:155730692-155730714 CTTCCTCCTTTCCAATTTGGAGG - Intergenic
1200523287 Y:4239058-4239080 CTTCCTCCTTTCCAATTTAAGGG + Intergenic
1200655544 Y:5897524-5897546 CTTCCTCTTCACCGATTTGAAGG - Intergenic
1200932964 Y:8713961-8713983 TGTCCTCTTAACCACTGTGAGGG - Intergenic