ID: 1092605271

View in Genome Browser
Species Human (GRCh38)
Location 12:10111712-10111734
Sequence GACTCGCCCTCGGGGCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092605271_1092605278 7 Left 1092605271 12:10111712-10111734 CCAGGCCGCCCCGAGGGCGAGTC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1092605278 12:10111742-10111764 CGACCGCAGCGCCCTCGAGCGGG 0: 1
1: 0
2: 1
3: 3
4: 74
1092605271_1092605277 6 Left 1092605271 12:10111712-10111734 CCAGGCCGCCCCGAGGGCGAGTC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1092605277 12:10111741-10111763 GCGACCGCAGCGCCCTCGAGCGG 0: 1
1: 0
2: 1
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092605271 Original CRISPR GACTCGCCCTCGGGGCGGCC TGG (reversed) Intergenic
900658619 1:3772335-3772357 GGCTCGCCCTTGGGGCCTCCAGG - Intergenic
903184752 1:21622642-21622664 GCCACGCCCCCCGGGCGGCCCGG + Intronic
904093324 1:27959961-27959983 GCGCAGCCCTCGGGGCGGCCCGG - Exonic
906309997 1:44747010-44747032 GCCTCAGCCTCGGGGGGGCCAGG + Intronic
911601212 1:99850053-99850075 GACTAGCGGTCGGGGCGGGCGGG + Intergenic
915463178 1:156081713-156081735 GGGCCGCCGTCGGGGCGGCCGGG + Exonic
924056211 1:240126978-240127000 GACTTGCCCTGGGAGCTGCCTGG - Intronic
924199051 1:241640499-241640521 GACGCGCCCGCGGGGGGGCGGGG - Intronic
1074531592 10:114302176-114302198 GAGTAGCCCTCAGGGAGGCCCGG - Intronic
1075096272 10:119473701-119473723 GACTCACCCGAGGGGGGGCCTGG - Intergenic
1076808064 10:132869214-132869236 GTCTCGCCCTTGGTGCGGCCAGG - Intronic
1077216293 11:1396506-1396528 GACCTGCCCTCGGGCCAGCCTGG - Intronic
1084086147 11:66856347-66856369 GCCTGGCCCGCGGGGCGGGCGGG + Intronic
1084394064 11:68897295-68897317 GTCTCGCCCTCGGTCAGGCCGGG - Intronic
1084539066 11:69775338-69775360 GGCTCGGCCTCGGGCGGGCCTGG - Exonic
1084800882 11:71543157-71543179 GCCTCGCTCTCAGGGTGGCCTGG - Intronic
1089694920 11:120211072-120211094 GTCTCCGCCTCGGGGCCGCCGGG + Exonic
1092605271 12:10111712-10111734 GACTCGCCCTCGGGGCGGCCTGG - Intergenic
1092659547 12:10723194-10723216 GGCTCGCTCTCGGGGAGGCCGGG + Exonic
1098161149 12:67649026-67649048 GACCCGCGCGAGGGGCGGCCGGG + Exonic
1100166630 12:91924170-91924192 GTCCCGCACTCGGAGCGGCCGGG - Intergenic
1101592888 12:106139164-106139186 GACTCGCCCTTTGTGCGGCGCGG + Exonic
1102393013 12:112564537-112564559 GAGTCACCCTCGGGGCTGTCTGG - Intergenic
1103595429 12:122022215-122022237 CGCTCGGGCTCGGGGCGGCCGGG - Intronic
1105044018 12:132986708-132986730 GACTCGGCCCCGGGACGGTCAGG + Exonic
1113371970 13:109732935-109732957 GCCCCGCACTCGGAGCGGCCGGG - Intergenic
1113768434 13:112894582-112894604 GGCTCGCGGTCAGGGCGGCCTGG + Intronic
1114644748 14:24249188-24249210 GACTCCCCCTCCGGGAGCCCTGG + Exonic
1120704791 14:87735041-87735063 GCCCCGCACTCGGGGCGGCGGGG - Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1122903688 14:104792407-104792429 GGCACGGCCTCGGGGAGGCCAGG - Intronic
1127103188 15:55588057-55588079 GACGAGGCCTCGGGGCGGCGGGG + Intronic
1132464730 16:72332-72354 GAGGCCCCCCCGGGGCGGCCGGG - Intronic
1132676855 16:1124534-1124556 GGCTTCCCCTCGGGGCGGGCAGG + Intergenic
1132765927 16:1534149-1534171 CACTCATCCTCGGGGCGGCGCGG - Exonic
1132875513 16:2135360-2135382 GCCTCGCCCTGGGAGCGTCCTGG + Intronic
1132880775 16:2160839-2160861 CACTCTCCCTCTGGGGGGCCAGG + Intronic
1134519474 16:14912000-14912022 GCCTCGCCCTGGGAGCGTCCTGG - Intronic
1134554462 16:15154235-15154257 GCCTCGCCCTGGGAGCGTCCTGG + Intergenic
1134707144 16:16310655-16310677 GCCTCGCCCTGGGAGCGTCCTGG - Intergenic
1134960396 16:18401469-18401491 GCCTCGCCCTGGGAGCGTCCTGG + Intergenic
1136364977 16:29805830-29805852 GTCTCGCGCTCGGGGCGACTCGG + Intergenic
1136641591 16:31569580-31569602 GGCTCGCTCTCGGGGAGGCCGGG + Intergenic
1139921151 16:70461385-70461407 GACTCGGTCTCGGGGAGGCCAGG + Intronic
1139965089 16:70740890-70740912 GACTCTGCCTCGGGGGGCCCTGG + Intronic
1148119268 17:45198018-45198040 GACTCACCCGCGGGGCTCCCAGG - Intergenic
1148888269 17:50789194-50789216 GACTGGTCCTTGGGGCTGCCTGG - Intergenic
1152239080 17:79152253-79152275 GTCTCGCCCCGGGGGTGGCCAGG - Intronic
1152531878 17:80923563-80923585 GACTTGCCTTCTGGCCGGCCGGG + Exonic
1157383805 18:47246642-47246664 CACTCGCCTTCTGGGGGGCCAGG + Intronic
1162621705 19:11848990-11849012 GAGTCGCCCACAGGGAGGCCCGG - Intronic
1162630769 19:11925350-11925372 GAGTCGCCCACAGGGAGGCCCGG - Intronic
1162635640 19:11965288-11965310 GAGTCGCCCGCAGGGAGGCCCGG - Intronic
1162660270 19:12163283-12163305 GAGTCGCCCACGGGAAGGCCCGG - Intronic
1162672106 19:12266184-12266206 GAGTCGCCCGCAGGGAGGCCCGG + Intronic
1162687673 19:12400970-12400992 GAGTAGCCCTTGGGGAGGCCCGG + Intronic
1162691995 19:12440814-12440836 AAGTCGCCCTTGGGGAGGCCCGG + Intronic
1164763263 19:30743945-30743967 CACTGGCCCTGGGGGCAGCCGGG - Intergenic
1165861634 19:38912138-38912160 GGCTGGCCCTCGGGGCGGCATGG + Exonic
1166678699 19:44754649-44754671 GGGTCCCTCTCGGGGCGGCCAGG - Intronic
1167343944 19:48933637-48933659 GACCCGCCCCCGGGGTGGGCGGG + Intergenic
1168152764 19:54457853-54457875 GACTCGCGCTGGGAGGGGCCTGG + Intronic
925743764 2:7028106-7028128 GACTCCTCCTTGGGGCCGCCAGG - Intronic
925877877 2:8327999-8328021 GCCTGGCTCTGGGGGCGGCCTGG - Intergenic
933886168 2:86720590-86720612 GACGCGGCCTCGGTGGGGCCCGG + Exonic
933924013 2:87076116-87076138 GACGCGGCCTCGGCGGGGCCCGG - Intergenic
935754745 2:106268212-106268234 CACTTGCCCCCGGGGCGGCCTGG - Intergenic
937312557 2:120911037-120911059 CACTCCCCCTCAGGGCAGCCTGG - Intronic
942540109 2:177007704-177007726 CACTCGCTCTCGGGGCCTCCTGG + Intergenic
948425856 2:237886204-237886226 GACACCCCCGTGGGGCGGCCTGG - Intronic
948824290 2:240566854-240566876 GACTTGCCCCCCGGACGGCCAGG + Intronic
1173660346 20:44729067-44729089 GACCAGCCCTCGGGGCGGAGGGG + Intergenic
1180050129 21:45327291-45327313 AACAGGCCCTGGGGGCGGCCAGG + Intergenic
1183476527 22:38038885-38038907 GAGCGGCCCTCAGGGCGGCCTGG + Intronic
1184478763 22:44735528-44735550 GACTCGGCCTGGGGGTGGGCAGG + Intronic
1185218143 22:49615318-49615340 GACACGCGCTCTGGGCAGCCTGG + Intronic
1185334271 22:50264594-50264616 GACACTCCCTTGGGTCGGCCTGG + Exonic
951080427 3:18445157-18445179 GGCTGGCCAGCGGGGCGGCCAGG + Intronic
953246481 3:41199031-41199053 GAGTACCGCTCGGGGCGGCCGGG - Intronic
968603391 4:1520744-1520766 GAGGCGTCCCCGGGGCGGCCTGG - Intergenic
968603430 4:1520826-1520848 GAGGCGTCCCCGGGGCGGCCTGG - Intergenic
968603450 4:1520867-1520889 GAGGCGTCCCCGGGGCGGCCTGG - Intergenic
971207396 4:24584037-24584059 GACTCCCGCTCGGTTCGGCCTGG + Intronic
972321536 4:37977303-37977325 GTCGCGCCCGCGGGGCGGCCAGG - Intronic
975778905 4:77819474-77819496 GGCTTCCCCTCGGGGCGGGCGGG - Intronic
977908290 4:102501661-102501683 GACCCGCACTCGGGCCCGCCCGG + Exonic
978189550 4:105895941-105895963 GAGTCGCCCTCGGGGGGCCGCGG - Intronic
987340462 5:16935516-16935538 GGCTGGCTCTCGGGGCGCCCTGG - Intronic
997980615 5:138465596-138465618 GACTCGCCCTGGGCGCGGGCGGG - Exonic
999279734 5:150357480-150357502 GACCCGCCCCCGGGGCCGGCCGG - Intergenic
999767973 5:154755410-154755432 CCCCCGCCCCCGGGGCGGCCCGG - Intronic
1001536977 5:172504901-172504923 GGCTTGCCCTGGGAGCGGCCAGG + Intergenic
1003901575 6:10659967-10659989 GCCCCGCACTCGGAGCGGCCGGG + Intergenic
1004228890 6:13813902-13813924 GACCCGCCCTCCGGCCTGCCGGG + Intronic
1018809237 6:167285518-167285540 GACTCGCCCGTGGGGCTGGCGGG + Intronic
1020107521 7:5428930-5428952 GTCTCGCCCTTGTGGCTGCCTGG + Intergenic
1022771055 7:33473330-33473352 GACTCTGCCTCGGGGCGGGGGGG - Intronic
1027202338 7:76071964-76071986 GAGACGCCGTCGGGGCGGGCGGG + Intergenic
1034439907 7:151081243-151081265 GACGGGCCCCCGGGGCGGCCCGG + Exonic
1034498401 7:151435333-151435355 GCCACTCCCACGGGGCGGCCGGG + Intronic
1034951403 7:155298863-155298885 AACCCGCCCTCGGGGGTGCCAGG - Intronic
1035232241 7:157472345-157472367 GCTTTGCCCTCGGGGCAGCCTGG - Intergenic
1036910819 8:12755546-12755568 GCCCCGCCCTCGGGGCTTCCCGG - Intronic
1039608358 8:38901012-38901034 GACTGCCCCGCGGGGAGGCCCGG - Intergenic
1049647065 8:143740237-143740259 CACTCGCCCTCGCGGGGGTCGGG + Intergenic
1051170446 9:14314993-14315015 GCCCCGGCCTGGGGGCGGCCTGG - Intronic
1060103260 9:120857923-120857945 GACTAGCCCCCGGGGGTGCCAGG - Exonic
1060147895 9:121268081-121268103 GAGCCGCCCTCGGGGCGGGGCGG - Intronic
1060811549 9:126613704-126613726 GAGGGGCCCGCGGGGCGGCCGGG + Intergenic
1060979786 9:127785607-127785629 GACCCGGGCCCGGGGCGGCCGGG - Intergenic
1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG + Intronic
1061779959 9:132989642-132989664 GACACTCCATTGGGGCGGCCTGG - Intronic
1061840585 9:133356566-133356588 GACGCGCCCGCGGAGCAGCCCGG - Exonic
1062414251 9:136439792-136439814 GACTCCGCTTCTGGGCGGCCGGG - Exonic
1187367185 X:18675240-18675262 GAGGCGCCGGCGGGGCGGCCCGG + Intergenic
1189757024 X:44282605-44282627 GACTCCCTCTCGGGGCGGGGGGG + Intronic
1192510768 X:71719271-71719293 CTCTCGCCCTCGCGGCTGCCTGG - Intergenic
1192515929 X:71762282-71762304 CTCTCGCCCTCGCGGCTGCCTGG + Intergenic
1198040176 X:132843011-132843033 GACTGCCACTCGGGGCTGCCTGG - Intronic