ID: 1092609485

View in Genome Browser
Species Human (GRCh38)
Location 12:10156175-10156197
Sequence CAGTGTTGCACCACTAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092609485_1092609486 12 Left 1092609485 12:10156175-10156197 CCATACTTAGTGGTGCAACACTG 0: 1
1: 0
2: 1
3: 22
4: 114
Right 1092609486 12:10156210-10156232 TCAAGATCAATTTCAAAATAAGG 0: 1
1: 0
2: 5
3: 44
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092609485 Original CRISPR CAGTGTTGCACCACTAAGTA TGG (reversed) Intergenic
902982467 1:20135430-20135452 CAGTCTTGCACCATTAAGCCTGG + Intergenic
904099029 1:28006757-28006779 CAGTCTTTCACCACTAGGTGTGG - Intronic
905248843 1:36634439-36634461 CAGTCTTGCACCACTATGCCTGG - Intergenic
906272498 1:44491595-44491617 CAGTCTTTCACCATTAAGCATGG - Intronic
906804783 1:48770171-48770193 CAGTTTTGCACCACAGAGGAAGG - Intronic
907006587 1:50920804-50920826 CAGTCTTTCACTATTAAGTATGG - Intronic
907010557 1:50959432-50959454 TGGTGTTGGACCATTAAGTATGG - Intronic
911012639 1:93297482-93297504 CAGTTTTTCACCATTAAGTATGG - Intergenic
915618437 1:157061045-157061067 CAGTCTTTCACCAGTGAGTATGG + Intergenic
917195333 1:172458118-172458140 CAGTCTTTTACCATTAAGTAGGG - Intronic
918044362 1:180932767-180932789 GAGTGTAGCAGCACTCAGTATGG + Intronic
918678185 1:187316774-187316796 CAGTTTTTCACCATTGAGTATGG - Intergenic
919167502 1:193914424-193914446 CAGTATTTCCCCATTAAGTAAGG + Intergenic
919734807 1:200940517-200940539 CAGTCTTTCACCATTAAGTATGG + Intergenic
923381385 1:233422331-233422353 CGGTCTTTCACCATTAAGTATGG + Intergenic
1067246056 10:44545856-44545878 TAGTCTTTCACCATTAAGTATGG + Intergenic
1071432284 10:85615707-85615729 CAGTGTTGCACCACCTCATATGG + Intronic
1072360558 10:94654824-94654846 CAGTTTTTCACCACTAAGAGAGG - Intergenic
1073743024 10:106432871-106432893 CAGTATTTCACCATTTAGTATGG - Intergenic
1074463021 10:113655758-113655780 CATAGGTGCACCATTAAGTATGG - Intronic
1076270421 10:129147781-129147803 CAGTGGTGCTGCACTAAGTCCGG - Intergenic
1083914515 11:65731982-65732004 CAATGTTTCACCATTGAGTATGG + Intergenic
1086211453 11:84325110-84325132 CAGTTTTTCACCATTGAGTATGG + Intronic
1086572138 11:88297417-88297439 CAGTGTTGCACAGCTAATGAGGG - Intronic
1087823500 11:102737964-102737986 CAGTTTTGCCCCATTCAGTATGG - Intergenic
1088135121 11:106546837-106546859 CAGTGTGTCACTACTAAGTTGGG - Intergenic
1091126030 11:133098714-133098736 TAGTTTCTCACCACTAAGTATGG - Intronic
1092609485 12:10156175-10156197 CAGTGTTGCACCACTAAGTATGG - Intergenic
1102763355 12:115408812-115408834 CAGTGGTGCCCCAGCAAGTAAGG + Intergenic
1103102531 12:118191543-118191565 CAATATGGCACCACTAACTATGG - Intronic
1103194637 12:119032352-119032374 CAGTGTTTCACCACTAAGCATGG + Intronic
1106198774 13:27518240-27518262 CAGTCTTTCACCATTAAATATGG - Intergenic
1106352876 13:28951387-28951409 TAGTCTTTCACCACTGAGTATGG + Intronic
1117860626 14:60089198-60089220 CAGAGCTGCAGCACTAGGTATGG - Intergenic
1119434010 14:74586200-74586222 CAGGGTTGCAGCACTCAGGAGGG - Intronic
1120596177 14:86440251-86440273 TAGTGTTTCACCACTAATCATGG - Intergenic
1121358877 14:93236829-93236851 CAGTGTTACACCACTATGCCTGG - Intergenic
1121513892 14:94536130-94536152 CAGTGGTGTAACACTAAGTAAGG - Intergenic
1122750741 14:103930741-103930763 AAGTGATGGACCATTAAGTAGGG - Intronic
1125387125 15:39149774-39149796 CAGTGTTGCAAACCAAAGTATGG + Intergenic
1125844044 15:42834506-42834528 CAGTGTGGCACCAAAAAATAAGG + Intronic
1129012612 15:72436178-72436200 CAGTTTTTCACCACTGAGTATGG + Intergenic
1137298041 16:47116099-47116121 CAGGTTTTCACCACTAAGTATGG + Intronic
1142316282 16:89347812-89347834 CAGTTTTTCACCAGTAAGAATGG + Intronic
1144047329 17:11465706-11465728 CACTGCTGCACCACAAAGCAGGG - Intronic
1144351971 17:14405331-14405353 CAGTGTTGCACAAGTAAGAAGGG - Intergenic
1148291558 17:46455706-46455728 CAGTGTCACACTCCTAAGTATGG - Intergenic
1153281750 18:3421095-3421117 ATGTGTTGCACCACAAAGTTAGG - Intronic
1153399127 18:4663311-4663333 CAGTCTTTCATCATTAAGTATGG - Intergenic
1155600389 18:27539125-27539147 CCATGTTGCACCATCAAGTAGGG - Intergenic
1155680195 18:28478068-28478090 CAGTGTTGCAATACAAAATATGG - Intergenic
1157193565 18:45601127-45601149 CAGTGCTGCACCACATGGTATGG + Intronic
1159342220 18:67149862-67149884 CAGTGCTGCAGCAATAAGGAAGG + Intergenic
1161276309 19:3419913-3419935 CAGCCTCTCACCACTAAGTACGG - Intronic
927106129 2:19828588-19828610 CAGTGTTTCACCGTTAAGTATGG - Intergenic
932788881 2:74634655-74634677 CAGTCTTTCACCATTAAATATGG + Intronic
933881864 2:86677720-86677742 AAGTGTTACTCCACTAAGTGAGG + Intronic
937117493 2:119418848-119418870 CAGGCTTGCACCACTATGTCTGG - Intergenic
939450620 2:142368800-142368822 CAGTATTGCAGCACTCAGAAAGG - Intergenic
940700899 2:157041545-157041567 CAGTGTCTCACCAATAATTATGG - Intergenic
941738443 2:169006432-169006454 TAGTCTTTCACCATTAAGTATGG - Intronic
948983310 2:241505998-241506020 CAGTGTTGCCCCACAAAACAAGG + Intronic
1171402608 20:24886972-24886994 CAGTCTTTCACCATTGAGTATGG - Intergenic
1173770235 20:45649964-45649986 CAAGGTTGCCCCACTAAGAAGGG + Intronic
1175315701 20:58045109-58045131 CTGTGTTGCTCAACTCAGTAAGG + Intergenic
1177012653 21:15746925-15746947 CAGTCTTTTACTACTAAGTATGG + Intronic
1178748612 21:35278593-35278615 CAGTCTTTCACTATTAAGTATGG - Intronic
1179337412 21:40470694-40470716 CAGGTTTGCACCACCATGTATGG + Intronic
1179936150 21:44604687-44604709 CAGCTTTTCACCACTGAGTATGG + Intronic
951020867 3:17779523-17779545 TACTGTTGCATCACTAACTATGG - Intronic
951744297 3:25960379-25960401 CAGTATTTCAACACTAAATAGGG + Intergenic
952322328 3:32289700-32289722 TAATGTTTCATCACTAAGTATGG - Intronic
956744861 3:72303284-72303306 CAGAGTTGCACCACCCAATATGG + Intergenic
957907191 3:86572580-86572602 CAGTTTTTCACCACTTAGTATGG + Intergenic
958807287 3:98827049-98827071 CTGTGTTGTACCAGTAAGAAAGG + Intronic
959114303 3:102157808-102157830 CAGTCGTGCACCACTATGTCTGG + Intronic
960098443 3:113711597-113711619 CAGTCTTTCACCATCAAGTATGG + Intergenic
962990480 3:140573106-140573128 CAGTGTTTCTCCACAAAATATGG - Exonic
967063629 3:185894641-185894663 CAGTCTTTCATCATTAAGTATGG + Intergenic
968806490 4:2776388-2776410 CAGTGGTGCACCACCAAGCCCGG + Intergenic
969625199 4:8299574-8299596 CAGTCTTTCACCATTAAGTACGG + Intronic
971556094 4:28014281-28014303 CAGTGTTCCACCAGAAAGTAGGG - Intergenic
972235460 4:37128163-37128185 CAGTTTTTCACCATTAAGTATGG - Intergenic
972967893 4:44534876-44534898 CAGTGTTTCAGCACTATGCATGG - Intergenic
973559771 4:52123303-52123325 CAGTTGTTCACCAGTAAGTATGG + Intergenic
974694518 4:65348457-65348479 CAGTATAGCAGCTCTAAGTAAGG + Intronic
975605591 4:76150823-76150845 CAGTCTTCCACCATTCAGTAGGG - Intergenic
977033022 4:91911296-91911318 CATTGTTGCAGCACTAAATCTGG + Intergenic
983298365 4:165894709-165894731 CAGTCTTTCATCACTAAGTGTGG + Intronic
985905900 5:2836289-2836311 CTGTCTTTCATCACTAAGTATGG - Intergenic
987982212 5:25100465-25100487 CAGTCTTGCACTATTAAGTATGG + Intergenic
988820915 5:34884305-34884327 CAGTTTTTCACCATTAAGTATGG - Intronic
990355663 5:54963857-54963879 CTGTGTTGCACGACTAACTAGGG - Intergenic
991212329 5:64120149-64120171 CAGATTTGCACTACTAAGTAAGG - Intergenic
991286744 5:64985846-64985868 CAGTCTTTCACCATTAAGTATGG + Intronic
992406719 5:76465447-76465469 CTGTATTTCACCACTGAGTATGG - Intronic
992925914 5:81586986-81587008 CTGTGTTACTCCACTAAGAAGGG + Intronic
993447880 5:88037078-88037100 CAGTGTTTTACCACTTAGAAAGG + Intergenic
996773855 5:127113403-127113425 CAGATGTGCACCACCAAGTATGG + Intergenic
997342393 5:133154782-133154804 CAGTCATGCACCACTTAGGATGG + Intergenic
998493725 5:142568754-142568776 CAGTGTTGCACCTCAGAGGAAGG + Intergenic
999343265 5:150792118-150792140 CACTGTTGCCACCCTAAGTAAGG - Intronic
1002651112 5:180695363-180695385 CAGTCTTTCACCACTGAGTATGG - Intergenic
1006857703 6:37147078-37147100 CAGGGTTGCACCACTATGTCTGG + Intergenic
1010029404 6:71257531-71257553 CAGTTTTGCAGCACTCAGCAGGG + Intergenic
1011230162 6:85151719-85151741 CAGTTTTTCACCATTGAGTATGG + Intergenic
1014759044 6:125335128-125335150 CAGTCTTTCATCATTAAGTATGG + Intergenic
1018168199 6:161120376-161120398 CATTCTTTCACCATTAAGTATGG + Intergenic
1020206480 7:6121245-6121267 CAGTCTTTTACCATTAAGTATGG + Intronic
1024189237 7:46988639-46988661 CAGGGTTGCACCACCAAGCCTGG - Intergenic
1024378717 7:48669504-48669526 AAGTGTTGCATCACAAAGGATGG + Intergenic
1024739390 7:52338010-52338032 CAGTGTTGCAGAAGAAAGTAAGG + Intergenic
1028514022 7:91656698-91656720 CAGTGTGGCAACACTAGGAAAGG + Intergenic
1030421115 7:109307665-109307687 CAGTTTCTCACCATTAAGTAGGG + Intergenic
1031915918 7:127563016-127563038 CAGTGCTTCAGCACTAAGTTGGG - Intergenic
1036383569 8:8257773-8257795 CAGTCTTTCACCATTAAGTAGGG + Intergenic
1037454464 8:19049546-19049568 CAGGTTTGCACCACTATGTCTGG - Intronic
1038829320 8:31039650-31039672 CAGTCTTTCACCATTAAGTATGG + Intronic
1041679026 8:60567955-60567977 TAGTGTTTTACCATTAAGTATGG + Intronic
1044633713 8:94302003-94302025 CAGTTTGGGCCCACTAAGTAGGG - Intergenic
1047099279 8:121658261-121658283 CAGTTTTTCACCTGTAAGTATGG + Intergenic
1048383140 8:133885973-133885995 CAGGGCTGCACCTTTAAGTAAGG + Intergenic
1049458452 8:142708084-142708106 TAATGCTTCACCACTAAGTATGG - Intergenic
1052251059 9:26397910-26397932 CTGTGTAGCACCAGTATGTAAGG - Intergenic
1055286121 9:74729880-74729902 CAGTGTTGCATCTCTAAGTTGGG - Intronic
1055779223 9:79801103-79801125 CAGTGCAGAACCACTAAGTTAGG + Intergenic
1062296568 9:135832458-135832480 CAGTTTTCCCCCACTAATTATGG - Intronic
1187498617 X:19818519-19818541 CAGTCTTTCACCATTAAATATGG + Intronic
1188136867 X:26502557-26502579 TACTGTTGCATCACTAACTATGG - Intergenic
1188177106 X:27004435-27004457 TATGGTTGCACCACTCAGTAAGG + Intergenic
1188994743 X:36869971-36869993 CTATTTTACACCACTAAGTATGG + Intergenic
1189493326 X:41486955-41486977 CAGTCTTTCACCAGTAAGTATGG - Intergenic
1191008545 X:55737532-55737554 CAGTTTTTCACCACTGAGCATGG + Intronic
1192540756 X:71969870-71969892 CTGTTTTTCACCATTAAGTATGG + Intergenic
1193447241 X:81619412-81619434 CAGTGTTTGACCACTAAGAGAGG - Intergenic
1195432647 X:104806626-104806648 AAGTGTTGTACCACAAAGGAGGG - Intronic
1195515187 X:105766155-105766177 CAGAATTGCTCCACAAAGTAGGG + Intronic
1201963722 Y:19709116-19709138 AAGTGTTGCATGACAAAGTAAGG + Intronic