ID: 1092611744

View in Genome Browser
Species Human (GRCh38)
Location 12:10180239-10180261
Sequence CACTCTGTACGGGGGCCATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 35}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092611744_1092611752 29 Left 1092611744 12:10180239-10180261 CCGTATGGCCCCCGTACAGAGTG 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1092611752 12:10180291-10180313 TGCTAATAGAACAGTTAAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092611744 Original CRISPR CACTCTGTACGGGGGCCATA CGG (reversed) Intronic
902332477 1:15737213-15737235 CACTCTGCAGGGGGGCCTCAGGG + Intronic
916892272 1:169123458-169123480 CTCTCTGTGTGGGGCCCATAAGG - Intronic
919322123 1:196056941-196056963 CTCACTATACTGGGGCCATAGGG - Intergenic
1080184610 11:29466361-29466383 CACTCAGTATGGGGGCAAAAAGG - Intergenic
1080639117 11:34148558-34148580 CACTCTGTCTGGGGGCCAGATGG - Intergenic
1085010475 11:73137461-73137483 CACTCTGTAGGGGAGCTATAGGG - Intronic
1092611744 12:10180239-10180261 CACTCTGTACGGGGGCCATACGG - Intronic
1092759137 12:11793510-11793532 CACTCTGTTTGGGGGCCACTAGG + Intronic
1103103281 12:118199463-118199485 CATTCTGGACGTGGGTCATAAGG + Intronic
1112094718 13:96119767-96119789 CACTCTGTACAGTGGAGATAGGG + Intronic
1112501656 13:99947572-99947594 CACTGAGTAAGGGGGCCAGAGGG - Intergenic
1121649558 14:95547746-95547768 CACTCTGTATGCTGGCCAGAGGG - Intergenic
1135330782 16:21558073-21558095 CGCTCAGTACGGGGGACAGAGGG + Intergenic
1141716003 16:85727207-85727229 CACACTGTCACGGGGCCATATGG + Intronic
1143756134 17:9068933-9068955 CAGTCTGTACTGCCGCCATATGG - Intronic
1149001151 17:51759005-51759027 CACACTGAACTGGGGTCATACGG - Intronic
1161216505 19:3097363-3097385 AACGCTGTACGGGAGCCATGGGG - Intronic
1162804406 19:13129527-13129549 CACTCTGTGCGGGGGCCACTGGG + Intronic
1167835119 19:52061899-52061921 CACTTGGTAAGGGGGCTATAGGG - Intronic
931951591 2:67369505-67369527 CATTCAGTACTGGGGTCATAGGG - Intergenic
932460320 2:71878060-71878082 CACTCTGTGCGGGGTTCACAGGG + Intergenic
932794556 2:74683028-74683050 CACACTATACAGGGGCCACATGG - Intronic
932838978 2:75064047-75064069 GAATCTGTAAGGGGGCCATGAGG - Intronic
932916583 2:75865714-75865736 CACTCTTAACGGGGGTCATCGGG - Intergenic
940594603 2:155773962-155773984 CTCTGTGTACAGGGGTCATATGG - Intergenic
949918292 3:8981914-8981936 CACTCTGTCCGGGGTTCAAAAGG + Exonic
963361896 3:144284622-144284644 CACTCTGTAGGAGTGCAATATGG + Intergenic
981565912 4:146101364-146101386 CACTCTGGACATGGGCCTTAGGG - Intergenic
992304247 5:75419891-75419913 CACTCTGTAAGAGGACCAGAAGG + Intronic
992460244 5:76953745-76953767 GACTCTGTGCGGGGGGCAGAGGG + Intronic
993187574 5:84638898-84638920 AACTCTCTACAGGGGACATACGG + Intergenic
995417218 5:111924872-111924894 GAGTCTGTCCTGGGGCCATAAGG + Intronic
998059448 5:139108255-139108277 CACTCTGGACTGGTGCCAGATGG + Intronic
1002465646 5:179407141-179407163 CAGTCTGCACGGGGGCTTTAGGG - Intergenic
1002483313 5:179517377-179517399 CACTCTGTCCGGGGGCCTTCAGG - Intergenic
1037316927 8:17608077-17608099 CACTCTGTCCTGGGGCCTCAGGG + Intronic
1037628317 8:20628272-20628294 AACTCTGAACATGGGCCATATGG + Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1057221781 9:93261439-93261461 CACTCTGACCGGGGGCCAGATGG + Intronic
1059678785 9:116566442-116566464 TCCTCTGTATGGGGCCCATAAGG + Intronic
1193796501 X:85881588-85881610 CACTCTGCAGGCAGGCCATATGG - Intronic