ID: 1092615353

View in Genome Browser
Species Human (GRCh38)
Location 12:10211723-10211745
Sequence AGGTGGGGAAATCCAGAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092615348_1092615353 16 Left 1092615348 12:10211684-10211706 CCTACAGTACTGGTTGGAAGGTC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1092615353 12:10211723-10211745 AGGTGGGGAAATCCAGAACGAGG 0: 1
1: 0
2: 0
3: 12
4: 158
1092615347_1092615353 17 Left 1092615347 12:10211683-10211705 CCCTACAGTACTGGTTGGAAGGT 0: 1
1: 0
2: 1
3: 19
4: 167
Right 1092615353 12:10211723-10211745 AGGTGGGGAAATCCAGAACGAGG 0: 1
1: 0
2: 0
3: 12
4: 158
1092615342_1092615353 28 Left 1092615342 12:10211672-10211694 CCCTGTCGCTGCCCTACAGTACT 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1092615353 12:10211723-10211745 AGGTGGGGAAATCCAGAACGAGG 0: 1
1: 0
2: 0
3: 12
4: 158
1092615343_1092615353 27 Left 1092615343 12:10211673-10211695 CCTGTCGCTGCCCTACAGTACTG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1092615353 12:10211723-10211745 AGGTGGGGAAATCCAGAACGAGG 0: 1
1: 0
2: 0
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092615353 Original CRISPR AGGTGGGGAAATCCAGAACG AGG Intergenic
901318370 1:8324067-8324089 AGGTGGGGACCTGCAGGACGGGG + Intronic
902873995 1:19330246-19330268 AGCTGTGGAAAACCAGAACCAGG + Intergenic
904220355 1:28962571-28962593 GGCTGGGGAAAACCAGAATGGGG - Intronic
905651618 1:39660742-39660764 AGGTGGGGACATAGAGAATGGGG + Intronic
905732283 1:40305267-40305289 AGGTCAGGAGATCCAGACCGCGG - Intronic
906179724 1:43807877-43807899 AAGGTGGGAAATCCAGAAAGAGG + Intronic
908321825 1:62986059-62986081 AGGTGGGGACATCCAGGAGATGG + Intergenic
913557143 1:119978712-119978734 AGGTGGGGAGAGCCAGAGAGTGG - Intronic
916315495 1:163443943-163443965 AGGTGGGGCAGTTGAGAACGAGG + Intergenic
917628391 1:176868929-176868951 AGGTGGGGGAACCCAGATCCAGG + Exonic
920646154 1:207805935-207805957 GTGTGTGCAAATCCAGAACGTGG + Intergenic
923539171 1:234876015-234876037 AGATGGGGAAATCCAGAGTAGGG - Intergenic
1063052104 10:2462727-2462749 AGTTGGGACAATCCAGAACTTGG - Intergenic
1063901517 10:10737687-10737709 AAGTGAGGAAACCCAGAAGGTGG - Intergenic
1066147934 10:32581646-32581668 AAGTGGGGAAAGCCTGAACGTGG + Intronic
1066757290 10:38723571-38723593 ACATGGGGAAAACCAGAAAGTGG - Intergenic
1067784664 10:49236770-49236792 AGGTGGTGAAGTCCAGTAGGTGG + Intergenic
1068773442 10:60847255-60847277 AGGTGGGGAACTGCAGAGGGTGG + Intergenic
1071296976 10:84228277-84228299 AGTTTGGGAAATACAGAAGGAGG - Intergenic
1074745063 10:116524121-116524143 AGGTCAGGAAATCGAGACCGTGG + Intergenic
1074763214 10:116682915-116682937 AGGTCAGGAAATCCAGACCACGG - Intronic
1075001039 10:118798106-118798128 AGCTGGGCAAGTCCAGAAGGTGG - Intergenic
1076342393 10:129758704-129758726 AGCTGGGGGAATCCTGCACGCGG + Intronic
1076519900 10:131075002-131075024 TTGTGGGGAAATCCTTAACGAGG + Intergenic
1076555178 10:131316784-131316806 ACGTGAGGAAATCCAGAGCGGGG - Intergenic
1080855271 11:36106543-36106565 AGGTGGGGAACCCCAGGAGGAGG + Intronic
1084527495 11:69705867-69705889 AGGTGGGGAAATGAGGAAGGCGG + Intergenic
1091754699 12:3043779-3043801 AGGTGGGGAAAGGCAGCAGGTGG + Intergenic
1092615353 12:10211723-10211745 AGGTGGGGAAATCCAGAACGAGG + Intergenic
1095882686 12:47154990-47155012 GGGTGAGGAGATGCAGAACGAGG + Intronic
1095992530 12:48046145-48046167 AGGTGTGGTAACCCAGGACGTGG + Intronic
1097107576 12:56634636-56634658 AGGAGGCGAAACCCAGACCGCGG + Intronic
1097131127 12:56811343-56811365 AGATGGGGGAAGCCAGAAAGGGG + Intergenic
1100774681 12:97961179-97961201 AGGGGGGAAAATACAGAATGAGG + Intergenic
1101776698 12:107801410-107801432 TGGTGGGGATTTCCAGAAAGGGG + Intergenic
1101843247 12:108342464-108342486 AGCTGGGTAAATCCAGCCCGGGG + Intergenic
1104009251 12:124917514-124917536 AGGTGGTGAATTTCAGAAGGGGG - Intergenic
1112901695 13:104364805-104364827 AGATGGGGAAATCAAGAAACAGG - Intergenic
1116802545 14:49458347-49458369 AGGCTGGGAAATCCAGATCATGG - Intergenic
1117563520 14:56969694-56969716 ATGTTGGGAAATTCAGAGCGAGG - Intergenic
1121731818 14:96192720-96192742 AGATGGGGAAATACACAGCGTGG + Intergenic
1122057738 14:99116336-99116358 GGGTGGGGAGATCTAGAATGTGG - Intergenic
1126912302 15:53429687-53429709 AGGTGGGGGAATACAGGAGGAGG + Intergenic
1132486109 16:192245-192267 AGGTGGGAAAATCCAGATGGAGG - Intronic
1136720231 16:32314154-32314176 ACATGGGGAAAACCAGAAAGTGG + Intergenic
1136725284 16:32352547-32352569 ACATGGGGAAAACCAGAAAGTGG + Intergenic
1136838607 16:33520430-33520452 ACATGGGGAAAACCAGAAAGTGG + Intergenic
1136843614 16:33558604-33558626 ACATGGGGAAAACCAGAAAGTGG + Intergenic
1138090382 16:54168923-54168945 AGGTTGAGAAATCCAGATGGAGG + Intergenic
1141198969 16:81882760-81882782 AGGTGGGGTGAGCCAGAATGAGG - Intronic
1141198974 16:81882780-81882802 AGGTGGGATGAGCCAGAACGAGG - Intronic
1203001146 16_KI270728v1_random:165207-165229 ACATGGGGAAAACCAGAAAGTGG - Intergenic
1203006200 16_KI270728v1_random:203615-203637 ACATGGGGAAAACCAGAAAGTGG - Intergenic
1203132749 16_KI270728v1_random:1701611-1701633 ACATGGGGAAAACCAGAAAGTGG - Intergenic
1203148772 16_KI270728v1_random:1820716-1820738 ACATGGGGAAAACCAGAAAGTGG + Intergenic
1203153779 16_KI270728v1_random:1858902-1858924 ACATGGGGAAAACCAGAAAGTGG + Intergenic
1143394776 17:6584579-6584601 ACAAGGGGAAATGCAGAACGGGG - Intronic
1143731412 17:8884945-8884967 AGGTGGAGATCCCCAGAACGTGG - Intronic
1146530336 17:33603043-33603065 TGGTGGGGAAATGCAGAGCTAGG - Intronic
1147122588 17:38344212-38344234 AGATGGGCAAATCCAGGATGGGG + Intergenic
1147659781 17:42111388-42111410 AGGTGGCCAAAGCCAGCACGTGG + Exonic
1147921669 17:43920974-43920996 AGATGGGGAAAGCCAGAAGGGGG - Intergenic
1148078374 17:44953126-44953148 AGCAGGGGAAATCCTGAAAGGGG + Intergenic
1148812830 17:50305161-50305183 AGGAGGGGAACCCCAAAACGTGG + Intergenic
1148860829 17:50603587-50603609 AGATGGGGAAAGCCAGCAAGAGG - Intronic
1149294817 17:55252498-55252520 GGGTGGGGAAAACCAGGATGAGG + Intergenic
1150255719 17:63742487-63742509 AGGAGGGGGTATCCAAAACGCGG + Intronic
1151038925 17:70835434-70835456 AGGTAGGGAAATCCTGGCCGAGG - Intergenic
1151499177 17:74478012-74478034 AGGTGGGTAGAGCCAGATCGTGG - Intronic
1153340359 18:3967032-3967054 AGGTGAGGTAGTCCAGAACCTGG + Intronic
1155714026 18:28917830-28917852 ATGTGGTGAAATCCAAAAGGGGG + Intergenic
1156431671 18:37081352-37081374 AGCTGGTGAAACCCAGAACTAGG + Intronic
1157157792 18:45284744-45284766 AGATGGTGAAATACAAAACGAGG + Intronic
1157204544 18:45687402-45687424 AGGTGGAGAAAAGCAGAACATGG + Intergenic
1159603505 18:70451550-70451572 AGGTGGTGAAATGCAGATGGCGG - Intergenic
1160076333 18:75680974-75680996 TGGTGGGGAAACCGAGAACCAGG + Intergenic
1162048510 19:8017624-8017646 AGGTGGGGAGTTCCAGACAGAGG + Intronic
1163832788 19:19554983-19555005 AGGCTGGGGAATCCAGAACGCGG + Intergenic
1164668184 19:30056237-30056259 AGGTGGGGACATAGAGAAGGGGG - Intergenic
1166229840 19:41420164-41420186 TGGTTGGGAAATCCAGAGTGTGG - Intronic
1167239039 19:48332439-48332461 TGGTGGGGAGATCCAGACCGAGG + Exonic
1167742057 19:51329644-51329666 AGGTGGGGAAATCAAGGCCAAGG - Exonic
1168585198 19:57586167-57586189 AGATGGAGAAATCCAAAAGGTGG + Intronic
926888573 2:17619728-17619750 AGGTGAGGAAATGCATAAGGAGG - Intronic
928696729 2:33856786-33856808 AGGTCAGGAGATCCAGACCGCGG - Intergenic
930000724 2:46859891-46859913 AGGTGGGGAAAGAGAGAAAGTGG + Intergenic
931026286 2:58116268-58116290 AGGTGGGGGAATACAAAAGGAGG + Intronic
932170685 2:69552959-69552981 AGGTGAGGAAATCTGGAATGTGG + Intronic
932759169 2:74428372-74428394 AGCTGGGGAGATGCAGAACTGGG - Exonic
934320593 2:91968012-91968034 ACATGGGGAAAACCAGAAAGTGG - Intergenic
935594939 2:104871023-104871045 AGGTGAGGAAATGAAGAATGGGG - Intergenic
937070243 2:119057607-119057629 AGGTGGGCAAATGCAGAAATGGG + Intergenic
938575249 2:132597358-132597380 AGGTGGTGAAATCCAGAGCCAGG - Intronic
941176359 2:162201858-162201880 AGGTGGGGAAAAACTGAAGGCGG - Intronic
948390799 2:237609813-237609835 AGGTGGGGAAATACAAGAGGAGG - Intergenic
948861004 2:240752555-240752577 GGGTGGGGAGAGCCAGAACTTGG + Intronic
1168746407 20:246286-246308 AGGAGGGGAAATCCAAGAAGGGG + Intergenic
1168971291 20:1932677-1932699 AGGTGGGGAGATCAAGGAGGAGG + Intronic
1171033399 20:21696568-21696590 AGGAGGTGGAATCCAGAACATGG + Intergenic
1171858930 20:30377029-30377051 AGGTGGGGAAAGCCCGCCCGAGG - Intergenic
1174723434 20:52837732-52837754 AGGTGGGCAAATTGAGAACGAGG - Intergenic
1178100189 21:29259778-29259800 AGGTGAGCAAATCCAGGACCAGG - Intronic
1180066883 21:45416869-45416891 AGACGAGGAAATGCAGAACGAGG - Intronic
1180308845 22:11152071-11152093 ACATGGGGAAAACCAGAAAGTGG - Intergenic
1180547322 22:16513882-16513904 ACATGGGGAAAACCAGAAAGTGG - Intergenic
1180842112 22:18964305-18964327 AAGTGAGGACATCCAGAAAGAGG - Intergenic
1180935363 22:19621943-19621965 ATGGGGGGAAAGCCAGAACCAGG - Intergenic
1181059383 22:20274576-20274598 AAGTGAGGACATCCAGAAAGAGG + Intronic
1182105802 22:27688234-27688256 AGGTGGGGAAAGAGAGACCGAGG - Intergenic
1182211844 22:28683452-28683474 ACATGGGGAAAACCAGAAAGTGG + Intergenic
1183503632 22:38196246-38196268 AGATGAGGAAATCGAGACCGTGG - Intronic
949271278 3:2220193-2220215 ATCTGGGGAAATCCAGAAAATGG - Intronic
950065396 3:10107994-10108016 AGGTGGGGAAATCAAGAGATGGG - Exonic
950478711 3:13231391-13231413 AGGTTGGGAAGTCCAGATCAGGG + Intergenic
951526364 3:23656854-23656876 AGATGGGGAAATGCAGAAAGAGG + Intergenic
959369374 3:105504453-105504475 AGATGGGGGAAGCCAGAAGGAGG + Intronic
960638998 3:119809640-119809662 AGGAGGGGAAATCGAGGAAGAGG + Intronic
960997046 3:123347169-123347191 AACTGGACAAATCCAGAACGTGG - Intronic
963609162 3:147443274-147443296 AAGTGGGGAAAACCAGAGAGAGG + Intronic
969579144 4:8053885-8053907 AGGTGGGGAAATCCAGGAGCAGG - Intronic
973596655 4:52498237-52498259 AGGCAGGGAAGTCCAGATCGAGG - Intergenic
973788564 4:54357824-54357846 AGGAAGGGAATTCCAGAAAGAGG + Intergenic
977655741 4:99518794-99518816 ATGTGTGGAAATCCAGACGGAGG - Intronic
982117748 4:152112244-152112266 AGGAGGGTAAATCCAGAGCTGGG - Intergenic
982117939 4:152113437-152113459 AGGAGGGTAAATCCAGAGCTGGG + Intergenic
982519864 4:156401843-156401865 AGGTGGGGCAATCAAGAGCCTGG + Intergenic
986504829 5:8438958-8438980 AGGTTGGGAACTCCAGGACTGGG + Intergenic
988420094 5:30994984-30995006 GGGTGGGGAAAACCAGAGTGAGG + Intergenic
991621770 5:68551978-68552000 AGGAGGGGAAGCCCAGACCGAGG - Intergenic
993674074 5:90795993-90796015 AGGTAGGTAAATCCACAAAGAGG + Intronic
997579126 5:135006143-135006165 AGGTGCGGAAATCCAGTCCTAGG - Intronic
1000301396 5:159959844-159959866 GGGTGGGGAAGGCCAGAACTAGG - Intronic
1002099121 5:176848683-176848705 AGGTGGGGGACTCCAGAGAGGGG - Intronic
1002202421 5:177537488-177537510 AGGTGGGGAAATCAAGGCCTAGG + Intronic
1002434991 5:179225744-179225766 AGATGGGGGAAGCCAGAAGGAGG - Intronic
1003260414 6:4511237-4511259 AGGTGGGGAAGCCAAGAACCTGG + Intergenic
1004396423 6:15249198-15249220 AGGTGGCCAAATCCACAACGCGG - Intronic
1005988571 6:30889582-30889604 AAGTGGAGAAATCCAAAAGGTGG - Intronic
1007831480 6:44642114-44642136 GAGTGAGGAAATCCAGAATGTGG + Intergenic
1011452216 6:87505602-87505624 AGGCTGGGAAGTCCAGAACACGG + Intronic
1017247110 6:152238647-152238669 GGGTGGGGAAGTCCACAAAGGGG + Intronic
1017848760 6:158284104-158284126 AGGTGGGGAAAAAGAGAAAGAGG + Intronic
1019055767 6:169222251-169222273 AGGTGGTGAACTCCACCACGGGG - Exonic
1020364039 7:7360713-7360735 TGGTGGGAAAATCCACAACTTGG - Intronic
1021309794 7:19079973-19079995 AAGTGGTGAAGTCCACAACGGGG - Intronic
1025776904 7:64568522-64568544 AGGTGGGGAAATCAAGGCCAAGG + Intergenic
1026952240 7:74355272-74355294 AGGTGGGAAAAGGCAGAATGGGG + Intronic
1027357485 7:77372178-77372200 AATTGGATAAATCCAGAACGTGG + Intronic
1028602763 7:92620376-92620398 AGATGGGGAAATTGAGAATGAGG + Intronic
1028846261 7:95483539-95483561 AGGTGGGGAGACCCATAATGGGG + Intronic
1029296071 7:99541551-99541573 AGGTGGGCAAAGCCAGGAAGAGG - Intergenic
1030042888 7:105467814-105467836 AGGTGGGGAGTTCGAGATCGAGG + Intronic
1033482838 7:141759283-141759305 AGGTGAGGAAACCCAAAACTGGG + Intronic
1034234796 7:149558248-149558270 AGGTGGGGGATTCCAAGACGAGG - Intergenic
1047789736 8:128190814-128190836 AGGAGGGGAAAACCGGAACACGG - Intergenic
1048680514 8:136836240-136836262 AACTGGGGAATTCCAGAACCAGG - Intergenic
1049007277 8:139863483-139863505 CTGTGGTGAAATCCAGAGCGTGG + Intronic
1052671929 9:31568948-31568970 AGGCTGGGAAATCCAGAAGAAGG - Intergenic
1053725185 9:40992112-40992134 AGGTGGGGAAAGCCCGCCCGAGG - Intergenic
1054340767 9:63859782-63859804 AGGTGGGGAAAGCCCGCCCGAGG + Intergenic
1056319415 9:85422232-85422254 AGGTGGGGAAATCTGGAAATGGG + Intergenic
1057448678 9:95137469-95137491 AGGTGGGGAGATGAGGAACGGGG - Intronic
1061283240 9:129609266-129609288 AGGTGGGGACACCTAGAAAGGGG + Intronic
1203449617 Un_GL000219v1:99778-99800 AGGTGGGGAAAGCCCGCCCGAGG + Intergenic
1186076252 X:5882568-5882590 AGGAAGGGAAATGCAGAAAGAGG - Intronic
1186417726 X:9398306-9398328 GGGTGGGGAAATGGAGAATGTGG - Intergenic
1189905334 X:45753590-45753612 AGGTAGGGAAAACCAGAAGGTGG + Intergenic
1190047389 X:47123645-47123667 AGGTGGGGAGATCATGAATGGGG - Intergenic
1190880863 X:54491785-54491807 AGTTAGGGAAACTCAGAACGAGG + Intronic
1196073191 X:111546783-111546805 AGGTGGGGGAATACAGGAGGAGG - Intergenic
1200773100 Y:7145372-7145394 AGGTGGGGAAGTAGAGAACAGGG + Intergenic