ID: 1092615454

View in Genome Browser
Species Human (GRCh38)
Location 12:10212419-10212441
Sequence CAAACACTGTGACGCCAGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092615448_1092615454 30 Left 1092615448 12:10212366-10212388 CCTGAGTCACGCTCTGTTTATGT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1092615454 12:10212419-10212441 CAAACACTGTGACGCCAGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092615454 Original CRISPR CAAACACTGTGACGCCAGCG CGG Intergenic
902650362 1:17833338-17833360 CAAAGACTATCACGCCAGCTAGG - Intergenic
905370535 1:37480359-37480381 CAAACACTGTGATGTCTGTGTGG - Exonic
907802603 1:57785466-57785488 AAAACACTGTGACTCAAGGGAGG + Intronic
912339426 1:108896927-108896949 CAAAGAATGACACGCCAGCGCGG - Exonic
912872531 1:113322664-113322686 AAAACACTGAGAAGCCAGTGTGG - Intergenic
1062906917 10:1185574-1185596 CAAACACTCTGTAGCCAGTGCGG - Intronic
1064435710 10:15309453-15309475 CCAACACTGGGACGCCAAGGCGG - Intronic
1064589100 10:16870059-16870081 CAAAAACTGTGACAGCAGCTGGG + Intronic
1071258367 10:83895727-83895749 CAGACACTGTGATGCCTGGGAGG + Intergenic
1072881695 10:99234765-99234787 ATAACGCTGTGACCCCAGCGAGG + Intronic
1075470147 10:122682658-122682680 CACACACTGTCATGCCAGCTAGG + Intergenic
1076525406 10:131109556-131109578 CAAACACTCTCACTCCAGCCGGG - Intronic
1078015032 11:7605929-7605951 CAAAGAATGTGAAGCCAGAGTGG + Intronic
1080029945 11:27649849-27649871 CAAACACTGGCATGCCAGTGAGG + Intergenic
1085412008 11:76296962-76296984 CAAATACTGTGAGTCCAGTGTGG - Intergenic
1091457317 12:617670-617692 AAAACACGGCGACGCCAGCGGGG - Intronic
1092272178 12:7031743-7031765 CGCACACTGTGAAGCCAGTGGGG - Intronic
1092615454 12:10212419-10212441 CAAACACTGTGACGCCAGCGCGG + Intergenic
1098887259 12:75972944-75972966 CAAACACTGGGAGGCCAAGGTGG - Intergenic
1098891974 12:76018356-76018378 CAAGCACTGTGACTCCAGGAGGG + Intergenic
1112579012 13:100662464-100662486 AAAACGCTGTGACATCAGCGGGG - Intronic
1112673038 13:101663470-101663492 CAAGCACTGTGATGGCAGCTGGG - Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1120966141 14:90169427-90169449 CAAACACTGTGTTGACAGCAAGG - Intronic
1127349999 15:58141711-58141733 CAAACTCTGTGACCCCAGCAAGG - Intronic
1129830271 15:78664676-78664698 CAAAGACTGTGTGGCCAGAGAGG - Intronic
1132111779 15:99106722-99106744 CAAACCCTCTGACACCGGCGGGG + Intronic
1132400664 15:101503005-101503027 CGAGCACTGTGACTTCAGCGAGG + Intronic
1136283462 16:29228070-29228092 CAAACACTCAGGCCCCAGCGTGG + Intergenic
1140206536 16:72938109-72938131 CAAACAGTGTGACACCCGTGTGG + Intronic
1140659202 16:77171059-77171081 GAAACACTGTGACGATAGCTAGG - Intergenic
1141091315 16:81132166-81132188 TAAACACTGTGTCTGCAGCGTGG - Intergenic
1145400516 17:22528252-22528274 TAAATACTTTGACGCCAGTGGGG - Intergenic
1149692683 17:58591160-58591182 CAAACACTCTGATGCCAGCTAGG + Intronic
1151610854 17:75173722-75173744 CCAGCACTGTGACGCCAAGGTGG - Intergenic
1153025678 18:670274-670296 CCAACACTGGGACGCCAGGGTGG - Intronic
1154402169 18:14050522-14050544 AAAACACTGTCATGCCAGTGGGG - Intergenic
1163633139 19:18427085-18427107 CCAACACTGAGACTCCAGAGAGG - Intronic
1163868971 19:19801906-19801928 CAAACATTGTTAGGCCAGCCAGG + Intronic
1166774534 19:45304335-45304357 CAATCACTGTGACTCTAGAGTGG + Intronic
1168344165 19:55642344-55642366 TAAAAACTGTGACTCCAGCCCGG - Exonic
925643128 2:6006431-6006453 CAAACACTGAGACCACAGCAAGG - Intergenic
934033443 2:88067840-88067862 CAGAGACTGTCAGGCCAGCGCGG - Exonic
935785522 2:106545070-106545092 CAAACCCTGTGACAACAGCATGG - Intergenic
946399050 2:219459257-219459279 CAAACACAGTTACACCAGCCAGG - Intronic
1176269385 20:64227785-64227807 CAAGCTCTGTGACCCCAGGGTGG - Intronic
950303469 3:11901125-11901147 CCTGCACTGTGACGCCACCGTGG + Intergenic
959752602 3:109855890-109855912 CAAAAACTGTGATACCAGGGTGG - Intergenic
973803156 4:54498297-54498319 CAAACCCTGTGATGCAAGGGAGG - Intergenic
982004424 4:151050275-151050297 CCAACACTGGGACGCCAAGGCGG - Intergenic
999673658 5:153978302-153978324 CCAACACTGGGAGGCCAACGTGG + Intergenic
1001149661 5:169216191-169216213 CACACACTGTGCCACCAGCCAGG + Intronic
1002083004 5:176748561-176748583 CAGACACTGTGACGCCCTCACGG + Intergenic
1002879496 6:1238508-1238530 CAAACAGTTTGAGGCCAGAGGGG - Intergenic
1005131409 6:22512755-22512777 CAAACCTTGTGACGCCATCTCGG - Intergenic
1005785170 6:29237517-29237539 CAAGCACTTTGAGACCAGCGTGG - Intergenic
1007380678 6:41488410-41488432 CAAATGCTGTAACGCCAGAGGGG + Intergenic
1016992199 6:149938157-149938179 CAAACACTGTGAGGCTGGAGGGG + Intergenic
1016994755 6:149954097-149954119 CAAACACTGTGAGGCTGGAGGGG + Intergenic
1017003851 6:150015339-150015361 CAAACACTGTGAGGCTGGAGGGG - Intergenic
1017326057 6:153142568-153142590 CAAGCATTGTGATGTCAGCGGGG - Intergenic
1018738087 6:166704723-166704745 AAAATGCAGTGACGCCAGCGAGG - Intronic
1019777161 7:2918632-2918654 CAAGCACCGGGAAGCCAGCGGGG + Intronic
1023009461 7:35912872-35912894 CAAACACTGAGAACCCAGCTGGG + Intergenic
1024065097 7:45725993-45726015 CAAACACTGAGAACCCAGCTGGG - Intergenic
1025123130 7:56323025-56323047 CAAACACTGAGAACCCAGCTGGG + Intergenic
1031497329 7:122466404-122466426 AAAACACTGTGGCCCCAGAGGGG - Intronic
1038166152 8:25086912-25086934 CAGGCACTTTGACACCAGCGAGG + Intergenic
1046201459 8:110933572-110933594 TAAAGACTTTGATGCCAGCGGGG + Intergenic
1049306341 8:141906285-141906307 CCAACACTGGGAGGCCAGCGAGG + Intergenic
1051331772 9:16031470-16031492 TAAACACTGTGACTCTAGTGTGG - Intronic
1054706942 9:68472279-68472301 CAGACACTGTGAAGCCAGCAAGG - Intronic
1186709181 X:12174685-12174707 CAAACACAGAGACCCCAGAGAGG + Intronic
1193093536 X:77521436-77521458 CAAACAGTGTGACAGCAGTGAGG - Exonic
1198652550 X:138878723-138878745 CAACCATTGTGAAGTCAGCGTGG - Intronic
1200935747 Y:8736785-8736807 CAATCACTGTGATGCTAGCAAGG + Intergenic