ID: 1092621671

View in Genome Browser
Species Human (GRCh38)
Location 12:10278294-10278316
Sequence CTGTGAAAATAATCCATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092621666_1092621671 14 Left 1092621666 12:10278257-10278279 CCAGTCTTATCAGCCAACTCAAG No data
Right 1092621671 12:10278294-10278316 CTGTGAAAATAATCCATGTCAGG No data
1092621667_1092621671 1 Left 1092621667 12:10278270-10278292 CCAACTCAAGCCATTCCATTTGA No data
Right 1092621671 12:10278294-10278316 CTGTGAAAATAATCCATGTCAGG No data
1092621668_1092621671 -9 Left 1092621668 12:10278280-10278302 CCATTCCATTTGACCTGTGAAAA No data
Right 1092621671 12:10278294-10278316 CTGTGAAAATAATCCATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092621671 Original CRISPR CTGTGAAAATAATCCATGTC AGG Intergenic
No off target data available for this crispr