ID: 1092626208

View in Genome Browser
Species Human (GRCh38)
Location 12:10332080-10332102
Sequence TGCCAAAAAAATAATAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 776
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 712}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092626208 Original CRISPR TGCCAAAAAAATAATAAGGT TGG Intergenic
900904877 1:5549008-5549030 TGGCAAAAAAAAAAAAAAGTAGG + Intergenic
901426622 1:9185707-9185729 TCTCAAAAAAAAAAAAAGGTTGG - Intergenic
901857001 1:12051013-12051035 TGCAAAAAAAAAAATTAGCTGGG - Intergenic
902248611 1:15138565-15138587 TGTCAAATAAATAAATAGGTAGG - Intergenic
904346453 1:29874760-29874782 TGTTAAAAAAAGAATAAAGTGGG + Intergenic
904736297 1:32636691-32636713 TGGAAAAAAAAAAAAAAGGTGGG + Intronic
905081137 1:35321675-35321697 TCCCAAAAATCTCATAAGGTAGG - Intronic
907075350 1:51573210-51573232 TCCAAAAAAAAAAAAAAGGTCGG + Intergenic
907183248 1:52589155-52589177 TGCCACAAAGAAAAAAAGGTGGG - Intergenic
907193774 1:52669720-52669742 TGAGAAAAAAAAAACAAGGTAGG + Intergenic
907534330 1:55136079-55136101 TGCTAAAGAAAAAATAAAGTAGG + Intronic
908268394 1:62400106-62400128 CTCCAAAAAAATAATAAAATAGG + Intergenic
908419153 1:63942787-63942809 TGCAAAATAAATGATAAAGTTGG + Intronic
908696089 1:66843196-66843218 TCTCAAAAAAAAAAAAAGGTGGG + Intronic
909107949 1:71436226-71436248 TGGCAAAAAAAAAAAAAGGTGGG + Intronic
909585648 1:77284587-77284609 TGACAAAATAATAAGAAAGTGGG - Intronic
909660135 1:78072963-78072985 TGCAAAAAAAAAAATTAGCTGGG - Intronic
909755879 1:79224737-79224759 ATTCAGAAAAATAATAAGGTTGG + Intergenic
909923388 1:81409506-81409528 TGCCAAATGAATAACAAGCTTGG + Intronic
909937379 1:81568735-81568757 TACCAAAAAAATGATAAGTATGG + Intronic
910430248 1:87152934-87152956 TGCAAAAAAAATCATATAGTTGG - Intronic
911903005 1:103528753-103528775 TGCCCAAAGGATAATAAGCTAGG + Intronic
912943153 1:114062491-114062513 TTACAAAAAATTAATTAGGTGGG - Intergenic
913046404 1:115076922-115076944 TGTCAAAAAAAAAAAAAGGGAGG - Intronic
913200056 1:116488680-116488702 TGCCATAAAAATAAAAACCTTGG + Intergenic
914229795 1:145755232-145755254 TGCCTCAAAAAAAAAAAGGTGGG + Intronic
914994148 1:152526634-152526656 TGCCATGAAAAAAATAAGATGGG + Intronic
915716182 1:157947201-157947223 TGCAAAAAAAAAAGTGAGGTAGG - Intergenic
916200295 1:162264810-162264832 TGAAAAAAAAAAAAAAAGGTCGG - Intronic
916447057 1:164882110-164882132 TACCAAAAAAAAAAAAGGGTTGG - Intronic
916937505 1:169644844-169644866 TGCCAAAAAATAAAAAAGGAAGG - Intergenic
917954721 1:180082847-180082869 TACCAAAATAATAATAATTTTGG + Intronic
918033008 1:180835028-180835050 TGCCAAATAATTCAGAAGGTAGG + Exonic
918118810 1:181519573-181519595 TGTGAAAAAAATAATAAGTAAGG - Intronic
918263043 1:182813711-182813733 TGCCAAAGAGATAATAACATCGG + Intronic
918407745 1:184227146-184227168 TGCCAAAAAAAAAAGAAGAAAGG - Intergenic
918664469 1:187132781-187132803 TGCCTAAAAAAAAAAAATGTTGG - Intergenic
919715867 1:200776103-200776125 TTTTAAAAAAATAATAAGATTGG - Intronic
920650332 1:207832783-207832805 TTCCAAAAAAATAATGTGTTTGG + Intergenic
920941704 1:210489526-210489548 TGCAAAAATAATAACAACGTGGG - Intronic
920974206 1:210770380-210770402 TGCCAAAAACCTAATTAGGAAGG + Intronic
921169130 1:212530279-212530301 TCTCAAAAAAATAAAAAGGGGGG - Intergenic
922145487 1:222939827-222939849 TGTCAAAAAAAAAAAAAGGCCGG + Intronic
922223121 1:223623837-223623859 TACAAAAAAAATAATTAGCTGGG + Intronic
922305762 1:224343004-224343026 AGCAAAAAAAATAATTAGCTGGG - Intergenic
922590413 1:226771608-226771630 TGCCAAAAATCTAATACAGTGGG + Intergenic
923672920 1:236056326-236056348 TACAAATAAAATAATAAAGTGGG - Intronic
923881331 1:238107311-238107333 TCCCTGAAAAATAATAAGGGAGG + Intergenic
924072959 1:240301115-240301137 TACCATGTAAATAATAAGGTAGG - Intronic
924512948 1:244742700-244742722 TGCCAAAAAAAAAAAAAAGGAGG + Intergenic
924523455 1:244825824-244825846 TGTCATAAAAAAAATAAGATGGG + Intergenic
924620832 1:245659234-245659256 TCTCAAAAAAATAATAATGATGG + Intronic
1063003790 10:1949387-1949409 AGCAAAAAAAATAATAAATTGGG - Intergenic
1063236384 10:4120841-4120863 TGCCAAAAAAAAAATTATTTGGG - Intergenic
1063438163 10:6051052-6051074 TACCAAAAAAAAAAAAAAGTTGG - Intronic
1063745302 10:8872649-8872671 TGCCAAAACTATACTTAGGTAGG + Intergenic
1064270419 10:13860273-13860295 TGCCATAAAAATAATTAGGAAGG + Intronic
1064942261 10:20748077-20748099 TGCCTAAAAAAAACTAAGATTGG + Intergenic
1065091361 10:22237345-22237367 TTCCAAAAAATTGAGAAGGTTGG - Intergenic
1065379879 10:25079170-25079192 TGACAAAAAGATAAGAAAGTTGG + Intergenic
1065395511 10:25232560-25232582 TACCAACAAAATAAGAAGGTGGG - Intronic
1065733519 10:28730735-28730757 TGTCAAAAAAAAAAAAAGGAAGG - Intergenic
1066500414 10:35988137-35988159 TGCCAAAAAAAAAAAAATGTGGG - Intergenic
1066682786 10:37950561-37950583 TGCAAAAAAAAAAAAAATGTTGG - Exonic
1068319962 10:55399905-55399927 TGCCAAAATAATAATATGTGGGG - Intronic
1069094344 10:64240512-64240534 TGAGAAAAAAATAATAATTTAGG + Intergenic
1069195285 10:65543974-65543996 TGCCTAAAGAATTCTAAGGTTGG - Intergenic
1069419363 10:68232346-68232368 CCCCAAAAGAATAACAAGGTGGG + Intergenic
1070004698 10:72412121-72412143 TACCAAAAAAATAAGAATTTTGG - Intronic
1070078454 10:73161647-73161669 TTCCAAAAAAATAAAAGGGAGGG + Intronic
1070253579 10:74794903-74794925 TGTCAGAAAAATAATTGGGTAGG + Intergenic
1070260177 10:74847037-74847059 TGAAAAAAATATGATAAGGTTGG - Intronic
1071388759 10:85148990-85149012 TGCCAGAAAAACAAATAGGTCGG - Intergenic
1072073046 10:91938973-91938995 TGCAAAAAAAAAAAAAAGGGGGG + Intronic
1072604106 10:96964236-96964258 TGCAAAAAAAAAAAAAAGGGGGG - Intronic
1073258878 10:102173751-102173773 TCTCAAAAAAATAAAAAGGCCGG - Intergenic
1074706299 10:116135192-116135214 TGCCAAAACAAAAATTAGGTGGG - Intronic
1075896530 10:126000965-126000987 TGACTAAAAAATAATCATGTTGG + Intronic
1077857116 11:6138988-6139010 TTCCAAAAAATTAAAAAGGAGGG + Intergenic
1078164332 11:8869696-8869718 TGCCAGATAAATAAAAAGGAGGG + Intronic
1078883776 11:15479322-15479344 TGCTAAAAAAAAAAAAAAGTGGG - Intergenic
1078929715 11:15903774-15903796 TTAAAAAAAAATAATAATGTAGG + Intergenic
1079057090 11:17215692-17215714 TCCCAAAAGAGTAAGAAGGTAGG - Intronic
1079226139 11:18606860-18606882 TGTCAAAAAAAAAAGAATGTGGG - Exonic
1079368864 11:19832968-19832990 TTCCAAAAAAAAAGTAACGTGGG + Intronic
1079403138 11:20122466-20122488 TGTCAAAAAAATAATAAAGAAGG + Intergenic
1080227285 11:29975112-29975134 TGATAAAAAGATTATAAGGTTGG - Intergenic
1080287205 11:30629065-30629087 AGCCAAAAAACCAGTAAGGTTGG + Intergenic
1080934129 11:36843974-36843996 TGCCCATAAAGTAATTAGGTTGG + Intergenic
1081161232 11:39751799-39751821 TGAAAAAAAGAAAATAAGGTAGG + Intergenic
1081565851 11:44260708-44260730 TGTAAAAAAAAAAATGAGGTCGG - Exonic
1081976325 11:47237589-47237611 TACCAAAAAAAAAATTAGCTGGG - Intronic
1083051686 11:59782836-59782858 TACAAAAAAAAAAAAAAGGTTGG + Intronic
1083929053 11:65829212-65829234 TGACAAAAAAAAAAAAAGTTTGG + Intronic
1084108018 11:66993304-66993326 TGCTAAAAAAATAATTAGCTGGG + Intergenic
1084598181 11:70129623-70129645 TGTCAAAAAAAAAAAAAGGCGGG - Intronic
1085215297 11:74825605-74825627 TTCCAAAAAATTAAAAAGGAGGG + Intronic
1085215648 11:74828235-74828257 TGACAAAAAAAGAATAAAATAGG + Intronic
1086446623 11:86877855-86877877 TGCAAAAAAAAAAAAGAGGTGGG + Intronic
1087155659 11:94899528-94899550 TTCCAAAAAATGAATAAGGTGGG + Intergenic
1087841278 11:102923375-102923397 GGCCAAAAAAAAAAAAGGGTTGG + Intergenic
1088388658 11:109289542-109289564 TTCCAAAAAAATAAAGAGGAAGG + Intergenic
1089750248 11:120646504-120646526 AGCAAAAAAAATAATTAGGATGG - Intronic
1089872833 11:121692131-121692153 TGGCAAAAGAATACTAGGGTAGG - Intergenic
1089993920 11:122886746-122886768 AGCCAAAAAAAGAATTAAGTGGG - Intronic
1091043243 11:132301857-132301879 TGCCATAAAAATATTAAGCAAGG + Intronic
1091683176 12:2541390-2541412 TGCAAAAAATGTAATAAGATGGG + Intronic
1092626208 12:10332080-10332102 TGCCAAAAAAATAATAAGGTTGG + Intergenic
1092668831 12:10839246-10839268 TGCCTAGAGAATAATGAGGTGGG + Intronic
1092685104 12:11034258-11034280 GGCCAAATACATATTAAGGTTGG - Intronic
1092689795 12:11095174-11095196 GGCCAAATACATATTAAGGTTGG - Intronic
1092704003 12:11264516-11264538 TGGCAGACAAATAATATGGTAGG + Intergenic
1092708006 12:11305675-11305697 TGGCAGACAAATAATAGGGTAGG + Intergenic
1093452247 12:19329371-19329393 TTCCAAAAAAATAAGGAGGAGGG - Intronic
1093525536 12:20100873-20100895 TTCCAAAAATGTAATAATGTAGG - Intergenic
1093676892 12:21952376-21952398 AGCCAAAAAAAGAAAAAAGTAGG + Intergenic
1094087120 12:26606539-26606561 TGCAAAAAAAAAAAAAAGGGAGG - Intronic
1094772485 12:33680823-33680845 TGCAAAAATAATCATAAAGTAGG + Intergenic
1095076194 12:37929228-37929250 TACCAAAAAAAAAATAACATAGG + Intergenic
1095612843 12:44150726-44150748 AGCTAAAAAATTAATAAGGCAGG + Intronic
1095613274 12:44157574-44157596 TTTTAAAAAAATAATGAGGTCGG + Intronic
1096276150 12:50209961-50209983 TGAAAACAAAATAAAAAGGTGGG - Intronic
1096339804 12:50788182-50788204 TGTCAAAAAAAAAAAAAGATTGG - Intronic
1096921725 12:55094483-55094505 TGTTAAAAAAATGAGAAGGTTGG + Intergenic
1097207472 12:57335207-57335229 TGTCAAAAAAATAAAAAGTATGG - Intronic
1097838396 12:64296865-64296887 TGCAAAAAAAAAAAAAAGGGTGG - Intronic
1098353679 12:69589274-69589296 TGCCAAAAAAAAAAGAGGGGTGG - Intronic
1098596804 12:72282351-72282373 TGAGAAAAAAATAACAAGTTTGG - Intronic
1099734017 12:86543234-86543256 TGCCATATGATTAATAAGGTAGG - Intronic
1099912055 12:88846214-88846236 TTAAAAAAAAATAATTAGGTGGG - Intergenic
1100221264 12:92506787-92506809 GGACAAAAAAAAAAAAAGGTGGG + Intergenic
1100446365 12:94664044-94664066 TGCTAAAGAAATAATAGGCTGGG + Intergenic
1100825442 12:98470582-98470604 CCCCTAAAAAATAATAAGCTGGG + Intergenic
1100942174 12:99735717-99735739 TTCCAAAAAAATAAAGAGGAGGG + Intronic
1101075544 12:101125922-101125944 TTCCAAAAAATTAAAAAGGAGGG - Intronic
1102235307 12:111290862-111290884 TCTCAAAAAAAAAAAAAGGTTGG - Intronic
1103127064 12:118432752-118432774 TCTCAAAAAAAAAAAAAGGTGGG + Intergenic
1103629453 12:122247896-122247918 TCTCAAAAAAATAATAAAATAGG - Intronic
1103687156 12:122741206-122741228 TCTCAAAAAAAAAAAAAGGTCGG - Intergenic
1103688944 12:122754721-122754743 TGCTCAAAAAATGATTAGGTTGG - Intronic
1105646146 13:22319816-22319838 TTCCAAATACACAATAAGGTAGG - Intergenic
1105832247 13:24173507-24173529 GGCCAAAAAAAAAAAAAAGTTGG - Intronic
1106327947 13:28712135-28712157 TGCAAAAACAGTTATAAGGTAGG + Intronic
1107808673 13:44178623-44178645 TACCAAAAAAAAAATTAGTTGGG - Intergenic
1108196383 13:48000136-48000158 TGAAAAAAAAAAAAAAAGGTAGG + Intronic
1108457023 13:50626503-50626525 GGCCAAAAAAAAAAAAAGGCTGG + Intronic
1108464955 13:50706248-50706270 TGTCAAAAAAAAAAAAAGGAAGG - Intronic
1108870041 13:54973958-54973980 TCTCAAAAAAAAAAAAAGGTTGG - Intergenic
1109074272 13:57814170-57814192 TTCCAAAAAAATTATAAAATGGG - Intergenic
1109445043 13:62426084-62426106 TGACAATAAAACTATAAGGTAGG + Intergenic
1109650522 13:65319250-65319272 TGGAAAAAAAAAAAAAAGGTGGG + Intergenic
1109996076 13:70128853-70128875 TCTCAAAAAAAAAAAAAGGTGGG - Intergenic
1110228269 13:73142455-73142477 TGCCATTAAAACAACAAGGTCGG - Intergenic
1110530096 13:76587154-76587176 TGGCAAAGATATAATAAGCTAGG + Intergenic
1111360577 13:87169921-87169943 TGCCAGAAAAATAAAATTGTGGG - Intergenic
1111381691 13:87462227-87462249 GACCAAAAAAATAGCAAGGTTGG + Intergenic
1112612793 13:100972463-100972485 TTCCAAAAAAATGACAAGGAAGG - Intergenic
1113580705 13:111426613-111426635 TGCCAACAAAAGAATAGGGCTGG + Intergenic
1114489663 14:23091432-23091454 TACCAAAAATACAAAAAGGTGGG + Intronic
1114771819 14:25435838-25435860 TTCCAAAAAATTAAAAAGGAGGG - Intergenic
1114773652 14:25456882-25456904 TTCCAATAAAATAATGAGATAGG + Intergenic
1114778030 14:25508077-25508099 ATCCAAAAAAAGAATAAGGTTGG - Intergenic
1115647602 14:35380500-35380522 TGAAAAAAATATAATCAGGTTGG + Intergenic
1115758294 14:36551972-36551994 TACCAAAAAAAAAATTAGCTGGG - Intergenic
1115788374 14:36852053-36852075 TGCAAAAATAATCATAAGATTGG - Intronic
1116493384 14:45532843-45532865 TTCCAAAAAATTAAAAAGGAGGG - Intergenic
1116529598 14:45952953-45952975 TTCCAAATAAATAAAAAAGTGGG - Intergenic
1116633787 14:47366512-47366534 GGCGAAGAAAATAATCAGGTAGG - Intronic
1116728965 14:48598035-48598057 TGCCAAAGAAATAAAAGGATGGG + Intergenic
1116834827 14:49760151-49760173 TGACAAAAAATTAAAAAGCTGGG - Intergenic
1117280219 14:54233535-54233557 GCCCAAAAAAATAATAAAGATGG + Intergenic
1117523968 14:56579417-56579439 TGCTAAAAAAAAAAAAAGGGTGG - Intronic
1117906822 14:60598042-60598064 TTAGAAAAAAATAATAAAGTTGG + Intergenic
1118405706 14:65421742-65421764 TGGCAAAAAAAAAAAAAGGGGGG - Intronic
1119070092 14:71574141-71574163 TGCTGTAAAAAGAATAAGGTGGG + Intronic
1119070153 14:71574683-71574705 TGTCACAAAAATGAAAAGGTTGG + Intronic
1119119441 14:72060366-72060388 AGCAAAAAAAAAAAAAAGGTGGG - Intronic
1119228314 14:72960877-72960899 TCTCAAAAAAAAAAAAAGGTGGG - Intergenic
1119361407 14:74053409-74053431 TCTCAAAAAAATAAAAAAGTCGG - Intronic
1119365536 14:74088386-74088408 TCTACAAAAAATAATAAGGTGGG - Intronic
1119766450 14:77192523-77192545 TTTGAAAAAAATAATAAAGTTGG + Intronic
1120259997 14:82171753-82171775 TGCAAAAAAAAAAAAATGGTTGG - Intergenic
1120321859 14:82972973-82972995 TCACAAAAACATAATAAGGAGGG + Intergenic
1120391853 14:83918709-83918731 TGTCAAAAAAATTAAAAAGTTGG - Intergenic
1120444246 14:84573885-84573907 TTGCATAATAATAATAAGGTGGG - Intergenic
1120638198 14:86977551-86977573 TTCCAAAAAATTAAAAAGGAAGG + Intergenic
1121037355 14:90717470-90717492 TGCCATACAAATATAAAGGTGGG + Intronic
1121171764 14:91860329-91860351 TGCAAAAAAAAAAAAAAAGTTGG + Intronic
1121750531 14:96351044-96351066 TGCCAAAAAAAGTATAAGATGGG - Intronic
1121754228 14:96390029-96390051 TCTCAAAAAAATAATAAATTTGG + Intergenic
1122658134 14:103275743-103275765 TTTAAAAAGAATAATAAGGTGGG - Intergenic
1122678485 14:103437223-103437245 TGCCAAAACAAAAATAAGTCTGG - Intronic
1123184240 14:106499707-106499729 TGCAAACAAAAACATAAGGTGGG - Intergenic
1202846947 14_GL000009v2_random:186507-186529 TACAAAAAAAATAATAATGAAGG + Intergenic
1202916407 14_GL000194v1_random:177107-177129 TTACAAAAAAATAATAATGAAGG + Intergenic
1124856793 15:33396928-33396950 TACCAGAAAAATAAAGAGGTTGG - Intronic
1124881127 15:33643862-33643884 TGCCACAAAAACAAAAAGATGGG - Intronic
1125326980 15:38546009-38546031 TGCCAAAAAAATTACCAGGATGG - Intronic
1125651720 15:41322555-41322577 TGCCAAAAAAAAAATTAGTAGGG - Intronic
1126126988 15:45303675-45303697 TATCAAAAAAATAACAAAGTTGG - Intergenic
1126627350 15:50697889-50697911 TCTCAAAAAAAAAATAAAGTGGG - Intergenic
1126929281 15:53629931-53629953 TTCCCAAATAATGATAAGGTTGG - Intronic
1127949531 15:63791063-63791085 TGGAAAATAAATAATAAAGTAGG + Intronic
1129318088 15:74758231-74758253 TCTCAAAAAAAAAAAAAGGTCGG + Intergenic
1130830809 15:87596752-87596774 TGCAAAAAAAAAAAAAAGGTGGG + Intergenic
1131803786 15:96100320-96100342 TGCAAAAAAAATAATTAGCCAGG - Intergenic
1132706665 16:1246891-1246913 TGTCAAAAAAAAAAAAAGGAAGG + Intergenic
1133335108 16:5001931-5001953 TGCAAAAAAAAAAATTAGCTGGG - Intronic
1133436852 16:5787132-5787154 TCCCAAAAAAATAATAACACAGG + Intergenic
1133443799 16:5842726-5842748 TCCCATAATAATAACAAGGTGGG + Intergenic
1134167060 16:11939259-11939281 TGCTTAAAAATTAACAAGGTGGG + Intronic
1134268267 16:12710451-12710473 GGCCAAAAAAAAAAAAAGGAGGG + Intronic
1134493646 16:14714451-14714473 TGCTTAAAAATTAACAAGGTGGG - Intronic
1134499026 16:14753575-14753597 TGCTTAAAAATTAACAAGGTGGG - Intronic
1134546825 16:15116179-15116201 TGCTTAAAAATTAACAAGGTGGG + Intronic
1134547310 16:15120662-15120684 TGCTTAAAAATTAACAAGGTGGG + Intronic
1135060150 16:19264591-19264613 TCTCAAAAAAAAAAAAAGGTGGG - Intronic
1135312454 16:21416689-21416711 TGCTTAAAAATTAACAAGGTGGG + Intronic
1135365402 16:21849146-21849168 TGCTTAAAAATTAACAAGGTGGG + Intronic
1135369589 16:21884742-21884764 TGGCAAAAAAATATTAAAATTGG - Intergenic
1135446437 16:22522193-22522215 TGCTTAAAAATTAACAAGGTGGG - Intronic
1135481286 16:22822462-22822484 AGCAAAAAAATTAAGAAGGTTGG - Intronic
1135896770 16:26412746-26412768 TGCTAAAAAAAAAAAAAGGGGGG + Intergenic
1136151628 16:28354666-28354688 TGCTTAAAAATTAACAAGGTGGG + Intronic
1136163136 16:28434433-28434455 TGCAAAAAAAAAAATTAGCTGGG - Intergenic
1136167861 16:28468506-28468528 TGCTTAAAAATTAACAAGGTGGG + Intronic
1136195114 16:28646507-28646529 TGCTTAAAAATTAACAAGGTGGG - Intronic
1136211452 16:28760622-28760644 TGCTTAAAAATTAACAAGGTGGG - Intronic
1136256174 16:29040574-29040596 TGCTTAAAAATTAACAAGGTGGG - Intronic
1136309152 16:29395677-29395699 TGCTTAAAAATTAACAAGGTGGG + Intronic
1136313333 16:29431197-29431219 TGGCAAAAAAATATTAAAATTGG - Intergenic
1136322573 16:29497213-29497235 TGCTTAAAAATTAACAAGGTGGG + Intronic
1136326776 16:29532963-29532985 TGGCAAAAAAATATTAAAATTGG - Intergenic
1136420412 16:30128862-30128884 TGCCTCAAAAAAAAAAAGGTGGG - Intergenic
1136437253 16:30237184-30237206 TGCTTAAAAATTAACAAGGTGGG + Intronic
1136441467 16:30272947-30272969 TGGCAAAAAAATATTAAAATTGG - Intergenic
1136530675 16:30866573-30866595 TGGAAAAAAAAAAAAAAGGTGGG + Intronic
1137223727 16:46481947-46481969 TGCCAGAAAAACACTCAGGTGGG - Intergenic
1137331165 16:47498233-47498255 TGCCAAAAAGATAATAAAATGGG - Intronic
1137349817 16:47703639-47703661 TCTCAAAAAAAAAAAAAGGTGGG + Intergenic
1138769049 16:59640404-59640426 AGCCAAAAAAAGAATATGGAAGG - Intergenic
1138846793 16:60576734-60576756 TACCAAAAAAAAAATTAGCTGGG - Intergenic
1139057652 16:63205106-63205128 TCTCAAAAAAATAAAAAAGTTGG + Intergenic
1139622109 16:68153912-68153934 TCTTAAAAAAATAATAATGTGGG - Intronic
1139888261 16:70226688-70226710 TGGCAAAAAAATATTAAAATTGG - Intergenic
1140365865 16:74379886-74379908 TGCTTAAAAATTAACAAGGTGGG - Intronic
1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG + Intergenic
1142288386 16:89180969-89180991 TCTCAAAAAAAAAAAAAGGTCGG - Intronic
1142718275 17:1759496-1759518 TCTCAAAAAAAAAAGAAGGTGGG + Intergenic
1142962793 17:3561522-3561544 TCGCAAAAAAAAAAAAAGGTCGG + Intergenic
1143979421 17:10855258-10855280 TGCCAAAAGACCAATGAGGTAGG - Intergenic
1144209990 17:13006068-13006090 TTAAAAAAAAATAATAATGTTGG + Intronic
1144223855 17:13125498-13125520 TGCCTAAAAAAAAAAAAAGTTGG - Intergenic
1144259571 17:13505013-13505035 AGCCAAAAAAGAGATAAGGTAGG + Intronic
1144504649 17:15819751-15819773 TCCCAAAAAAAAAAAAAAGTTGG - Intergenic
1144766265 17:17734440-17734462 TCTCAAAAAAATAAAAAGTTGGG + Intronic
1145346213 17:22042877-22042899 TTCCAAAAAAATAAAAGGATAGG - Intergenic
1145728028 17:27151779-27151801 TTCAAAAAAAAAAATCAGGTTGG + Intergenic
1145845937 17:28039538-28039560 TGTCAAAAAAAAAAAAAGGCTGG - Intergenic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1147183197 17:38699758-38699780 TCTCAAAAAAAAAAAAAGGTGGG - Intergenic
1147285446 17:39399616-39399638 GGTAAAAAAAAGAATAAGGTGGG - Intronic
1147598316 17:41730910-41730932 TCTCAAAAAAAAAAAAAGGTGGG - Intronic
1147699185 17:42381399-42381421 TAGCAAAAGAATAATAAGGAAGG - Intronic
1147756955 17:42774998-42775020 AGGCAAAAAAATACCAAGGTGGG - Intronic
1148539014 17:48465100-48465122 TGCCAAATAAATGGAAAGGTGGG + Intergenic
1148617412 17:49011685-49011707 TTCCAAAAAAAAAAAAACGTTGG + Intronic
1148642156 17:49195760-49195782 TGTCAAAAATAAAATAAAGTAGG + Intergenic
1148933782 17:51148560-51148582 TCCCAAAAAAATATTAAAATGGG - Intergenic
1148997567 17:51724422-51724444 TGCCAACAAAAGTATAAGATGGG + Intronic
1149070728 17:52539252-52539274 TGACAAAGAAATAATAAACTTGG + Intergenic
1149221800 17:54423297-54423319 TGCAACAAAAATAAATAGGTGGG + Intergenic
1149748363 17:59121650-59121672 TCTCAAAAAAAAAAAAAGGTCGG + Intronic
1149804226 17:59599823-59599845 TCTCAAAAAAAAAAAAAGGTGGG - Intronic
1149866328 17:60153035-60153057 TGCTTTAAAAATAATAATGTTGG + Intronic
1149975149 17:61258010-61258032 GTGCACAAAAATAATAAGGTGGG - Intronic
1150253509 17:63724441-63724463 TCTCAAAAAAAAAAAAAGGTAGG - Intronic
1150360444 17:64528608-64528630 TGTGAAAAAAATAATAAGCTCGG + Intronic
1150577267 17:66441341-66441363 TTCCAAAAAAAAAAAAAGATTGG + Intronic
1150585747 17:66516334-66516356 TGTGAAAAAAAGAATAAGGCTGG + Intronic
1150681056 17:67284928-67284950 TCTCAAAAAAAAAAAAAGGTGGG - Intergenic
1150968743 17:70002644-70002666 TGTCAAAAAAATGATGAGGAAGG + Intergenic
1151497646 17:74468332-74468354 TCTCAAAAAAATAAAAATGTTGG - Intronic
1152075123 17:78154544-78154566 TCTCAAAAAAATAAATAGGTGGG + Intronic
1152351592 17:79786629-79786651 TGCCAAAAATAAAAGAGGGTGGG + Exonic
1152812673 17:82389470-82389492 TTTTAAAAAAATAAAAAGGTGGG - Intronic
1153349649 18:4064797-4064819 TTCCAAAAAATTAATAAGGAGGG + Intronic
1153414337 18:4829125-4829147 TACCAAAAAAAAAATATGCTGGG - Intergenic
1153528951 18:6024171-6024193 TGTCAAAGAAGTAATAAGGCCGG - Intronic
1153982663 18:10323752-10323774 TGTCAAAAAAAAAAAAAAGTAGG + Intergenic
1154118331 18:11631378-11631400 TGCTTAAAAATTAACAAGGTGGG + Intergenic
1155082428 18:22424007-22424029 TGCTAATAAAAGAATAAGGGCGG - Intergenic
1155281495 18:24245254-24245276 TGCCGAAAAAAAAATTAGCTAGG - Intronic
1155516614 18:26629719-26629741 TGTCAAAAAAAAAAAAAGGCGGG - Intronic
1155690522 18:28616367-28616389 AGTCATAAAAATAATAAGATTGG - Intergenic
1155756965 18:29510324-29510346 TTCCAAAAAATTAATGTGGTGGG + Intergenic
1155985281 18:32224250-32224272 TGAAGAAAAAATAATAAAGTGGG - Intronic
1156163000 18:34382847-34382869 TGACAGAAAAAATATAAGGTGGG - Intergenic
1156407590 18:36797511-36797533 TGCCAAAAAAAAAAAACAGTAGG - Intronic
1156895150 18:42237516-42237538 AGCCAAAAAAATAATGAGGGAGG - Intergenic
1157091045 18:44637500-44637522 TGACACAAAAATAATAATTTAGG - Intergenic
1157445263 18:47740626-47740648 TGCAAATAACATAATAAGGTTGG - Intergenic
1157546758 18:48551956-48551978 TACAAAAAAAATAATTAGCTGGG - Intronic
1157732782 18:50019248-50019270 TGCAAGGAAAATAATAAGGATGG - Intronic
1158081582 18:53598806-53598828 TGCCAAAAAAAAAAAAGGGGGGG - Intergenic
1158194047 18:54864841-54864863 TGACTGAAAAATAATAAAGTTGG - Intronic
1158372248 18:56821644-56821666 TGTCAAAAAAAAAAAAAGGAGGG - Intronic
1158942387 18:62417237-62417259 GGCCAAAAAAATCATAAAGAAGG - Intergenic
1158991429 18:62872688-62872710 TCTCAAAAAAAAAATTAGGTGGG + Intronic
1159524224 18:69567473-69567495 TACCAAAAAAAAAATGAGGCAGG + Intronic
1159896815 18:74005037-74005059 TGCACAGAAAATAATAAAGTTGG + Intergenic
1161387882 19:4006565-4006587 GGCCAAAAAAAAAATTAGCTGGG + Intergenic
1162201626 19:9024684-9024706 TCTCAAAAAAAAAAAAAGGTTGG + Intergenic
1162482037 19:10933138-10933160 TCTCAAAAAATTAATAAGGCTGG + Intronic
1162561420 19:11419970-11419992 TCTCTAAAAAATAATAAGGCTGG - Intergenic
1162748336 19:12812230-12812252 TCTCAAAAAAATAAAAAGGCTGG + Intronic
1163480681 19:17554486-17554508 TGTGAAAATAATAATAAGCTGGG + Intergenic
1163512250 19:17742316-17742338 TCTCAAAAAAAAAATTAGGTGGG - Intergenic
1163877810 19:19889644-19889666 TCTCAAAAAAAAAATAAAGTAGG - Intronic
1164264968 19:23606827-23606849 TTCCAAAAAATTAAAAAGGAGGG - Intronic
1164389195 19:27803409-27803431 TGAAATAAAAATGATAAGGTTGG + Intergenic
1164640400 19:29820988-29821010 TGCCAAAAAGAAAAAAAGGCTGG + Intronic
1165527166 19:36365956-36365978 TGTCAAAAAAAAAAAAAGGCTGG + Intronic
1166307585 19:41943586-41943608 TCACAAAAAAAAAAAAAGGTGGG + Intergenic
1166649896 19:44564731-44564753 TGAAAAAAAAAGAATAAAGTAGG - Intergenic
1166710914 19:44936646-44936668 TCTCAAAAAAAAAAAAAGGTGGG - Intergenic
1167152094 19:47716237-47716259 TACAAAAAAAATAATTAGCTGGG - Intronic
1167562434 19:50233828-50233850 TCTCAAAAAAACAAAAAGGTTGG - Intronic
1167864900 19:52316971-52316993 TTCAAAAATAATAAAAAGGTGGG - Intronic
1167882065 19:52467865-52467887 GGGAAAAAAAATAAAAAGGTTGG + Intronic
1168500780 19:56891207-56891229 GGCCAAAAAAAAAAAAAGGCTGG - Intergenic
1168654065 19:58113971-58113993 AGCTCAAAAAATAATAAGGCTGG + Intronic
925121752 2:1423675-1423697 TTCCTACAAAATAATAAGCTTGG - Intronic
925530311 2:4852444-4852466 TGCCAAAAAAATGAAAAAGATGG + Intergenic
925597441 2:5569811-5569833 TGCCAAAAGGAAAATAAGCTAGG - Intergenic
926668146 2:15547758-15547780 TGCCAGAAGAATAATTTGGTGGG - Intronic
926976854 2:18524260-18524282 TTCCAAAAAGAAAATAATGTAGG - Intergenic
927034636 2:19161725-19161747 TTGCAAAAAAATAACAACGTTGG - Intergenic
927704745 2:25290120-25290142 TTCCATAAAAATAAAAAGTTAGG - Intronic
927796548 2:26054206-26054228 TACAAAAAAAAAAATTAGGTGGG - Intronic
927933580 2:27061662-27061684 TGACCAAAAAAGAATGAGGTTGG - Intronic
928274299 2:29885559-29885581 TGGCAAAAAAAAAAAAAGGGTGG + Intronic
928525380 2:32134694-32134716 TCCCAAAAAAATAAAAAGCTAGG - Intronic
928576875 2:32663984-32664006 TGCCAAAAAAAAAAAATAGTGGG - Intronic
928763914 2:34618598-34618620 TGAAAAAAAAAAAAAAAGGTGGG + Intergenic
929699263 2:44147782-44147804 TGCCAATAAAATGCTAAGGCTGG + Intergenic
930784042 2:55253169-55253191 TGACAACAACATCATAAGGTAGG - Intronic
930916272 2:56692629-56692651 TTCCAAAAAATTAAGAAGGAGGG - Intergenic
930967438 2:57347331-57347353 TACCAAAAAAAAAAAAAAGTTGG + Intergenic
931545906 2:63387093-63387115 TTCCAAAAAAATGAGAAGGAAGG + Intronic
931779256 2:65565480-65565502 AGAAAAAAAAATAATAAGCTGGG - Intergenic
932041508 2:68304398-68304420 TCTCAAAAAAAAAATAAAGTTGG + Intronic
932087733 2:68776603-68776625 GGCCAAAAAAGCAATGAGGTTGG - Intronic
933029480 2:77309822-77309844 AGCCATTAAAATAATAATGTAGG + Intronic
933653769 2:84870722-84870744 TGCCAAAGAAGTAAGATGGTGGG + Exonic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
934741505 2:96726781-96726803 CTCAAAAAAAATAAAAAGGTTGG + Intronic
935537201 2:104308403-104308425 CTCCTAAAAAATAATAAAGTAGG - Intergenic
936841862 2:116779106-116779128 TCCCAAAAAAAAAAAAAAGTTGG + Intergenic
937270303 2:120645874-120645896 CTCCAAAAAAATAATTAGCTGGG - Intergenic
937499142 2:122459434-122459456 TGCAAAAAAAATTATATAGTGGG + Intergenic
938130291 2:128709390-128709412 TGCAAAAAAAAAAAAAAGATAGG - Intergenic
938385828 2:130866383-130866405 TGGAAAAAAAAGAAGAAGGTGGG + Intronic
938654444 2:133416654-133416676 TGCAAAAAAAAAAAAAAGTTAGG + Intronic
938840466 2:135157331-135157353 TTCCAAAAAAATAACAAGAATGG + Intronic
938848899 2:135239979-135240001 TGTCAAAAAAAAAAAAAGGGTGG + Intronic
939012454 2:136862508-136862530 TATGAAAAAAATAATAAGGCAGG + Intronic
939148864 2:138449444-138449466 TCTCAAAAAAAAAAAAAGGTTGG - Intergenic
939621759 2:144428845-144428867 TGTCAAAGAAAAAACAAGGTGGG + Intronic
939683587 2:145169732-145169754 TGGCAAAAAAAAAAAAAGGGGGG + Intergenic
939946145 2:148413505-148413527 TCCAAAAAAAAAAAAAAGGTGGG - Intronic
939998671 2:148945329-148945351 TGCAAAAAATATATTAATGTTGG - Intronic
940209433 2:151241332-151241354 TCCCAAAAAAATAAAAAAATAGG + Intergenic
940647916 2:156411013-156411035 TGGGAGAAAAATAATAGGGTTGG + Intergenic
940708193 2:157129840-157129862 TGAAAAAAAAATAATAAGCTAGG + Intergenic
941272124 2:163443128-163443150 TGCCAACCAAATAATAAACTTGG - Intergenic
941325899 2:164113599-164113621 TGCCAAAAATATTAAAGGGTTGG - Intergenic
941411507 2:165162246-165162268 TGCGAAAAAAAAAAGTAGGTAGG - Intronic
942160754 2:173184344-173184366 TGCCAATAAAGTAATAACATGGG - Intronic
942262960 2:174189143-174189165 TTCAAAAAACATAAAAAGGTAGG + Intronic
942359497 2:175157248-175157270 TGTCAGAAAAACAATAAGGCTGG + Intronic
942681708 2:178483660-178483682 TGCCAAACAAATTATAAGCAGGG - Intronic
942968548 2:181927837-181927859 TGTCAAAAAAATAATCTGGAAGG - Intronic
943073126 2:183165257-183165279 CGCCAAAAAAAAAAAAAGGGGGG - Intergenic
943711577 2:191102004-191102026 TTCAAAAAAAAAAAAAAGGTTGG - Intronic
944003185 2:194867383-194867405 AGCCAACAAAATAAGAAAGTTGG - Intergenic
944214812 2:197244349-197244371 TGCTAAATTAATAAGAAGGTGGG - Intronic
944234285 2:197427604-197427626 TTCAAAATAAATAAAAAGGTGGG + Intronic
944370888 2:198982382-198982404 TGAAAAAAAATTAATAAGATAGG + Intergenic
944380153 2:199099590-199099612 TGCTAAAATAATTATAAGCTTGG + Intergenic
945119845 2:206445507-206445529 CAGCAAAAACATAATAAGGTAGG + Exonic
945494138 2:210489645-210489667 AACCAAAAAAATCATAAAGTGGG + Intronic
946032165 2:216713953-216713975 TGCCAAGAAAAGAATAAGAGAGG + Intergenic
946091758 2:217231930-217231952 TGCCAAAAATCCAATAAGCTTGG + Intergenic
946323200 2:218965997-218966019 TAACAAAAAAATTATCAGGTGGG - Intergenic
946344419 2:219096993-219097015 AGCCAAAAAAATCATAAGCCAGG - Intronic
946608372 2:221431079-221431101 TTCCAAGAAAATAATATGGTAGG + Intronic
946663082 2:222021436-222021458 TCTCAAAAAAAAAAAAAGGTGGG + Intergenic
946673397 2:222130647-222130669 TTCGAATAGAATAATAAGGTGGG + Intergenic
946888065 2:224244591-224244613 TGCCAATAAAAGTATAATGTGGG - Intergenic
946967909 2:225057735-225057757 TACCAATAAAATAATGAGTTAGG + Intergenic
947308152 2:228770428-228770450 TGACCAAAAAAAAATAAAGTAGG - Intergenic
947799000 2:232915580-232915602 TCAGAAAAAAATAATTAGGTTGG - Intronic
1169944672 20:10975845-10975867 TGCCAAGAAAATACTTAGGAAGG + Intergenic
1170382426 20:15775827-15775849 TGCCAAAGTAAGAATAAAGTTGG + Intronic
1171015484 20:21537412-21537434 TGCTCAAAAAATAATGAGATGGG - Intergenic
1171027622 20:21645925-21645947 TGCCAAAAAATTGAAGAGGTGGG + Intergenic
1172757780 20:37299240-37299262 TACAAAAAAAATAATAAATTAGG - Intronic
1172985349 20:38983088-38983110 TACCAAAAATATAAAAACGTAGG - Intronic
1173740418 20:45396251-45396273 TCTCAAAAAAATAATAAAATAGG - Intronic
1173967489 20:47123978-47124000 TCTCAAAAAAAAAAAAAGGTGGG + Intronic
1173995144 20:47332307-47332329 TCTCAAAAAAAAAATAAGTTTGG + Intronic
1174076085 20:47937988-47938010 TGCTATGAAAAAAATAAGGTGGG - Intergenic
1174183246 20:48688086-48688108 AGCCAAAAAAAAAATGGGGTGGG + Intronic
1174470129 20:50752328-50752350 TGCCAAAAAAAAAAAAAATTGGG + Exonic
1174879372 20:54261603-54261625 AACCAAAAAAATAATAATGTAGG - Intergenic
1174945353 20:54979421-54979443 TGCTAAAAAAAAAAAAAAGTAGG - Intergenic
1175565409 20:59971817-59971839 TGCCAAAGAAATAAACAGATGGG - Intronic
1176635760 21:9191753-9191775 TTCCAAAAAAATAATAATGAAGG + Intergenic
1176848278 21:13893384-13893406 TGGTAAAAAAAAAAAAAGGTGGG + Intergenic
1177268476 21:18813795-18813817 TGCTAAAAGAAAAATAAAGTAGG - Intergenic
1177812349 21:25937928-25937950 AGTCAAAAAAATAATAAGCTGGG - Intronic
1177884128 21:26728080-26728102 TGCCAACAAAAAAATAAGCTTGG - Intergenic
1178516702 21:33254067-33254089 TACCAGAATAAAAATAAGGTAGG + Intronic
1180227654 21:46405227-46405249 TGCCTAAAAAAAAATAATTTTGG + Intronic
1182195340 22:28510136-28510158 TTCCAAAAAATTAAAAAGGAGGG + Intronic
1182374505 22:29836892-29836914 TGCCCAGAGAATATTAAGGTGGG + Intronic
1182593670 22:31401284-31401306 TACCAAAAAAAAAAAAAGGCTGG + Intronic
1182851194 22:33475762-33475784 TGTGAAAAAAATAATGAGTTAGG - Intronic
1183809948 22:40247105-40247127 TGCAAAAAGAATGGTAAGGTGGG - Intronic
1183876453 22:40786308-40786330 TGCAAAAAAAAAAAAAAAGTAGG + Intronic
1183917461 22:41133316-41133338 TTCCAAAAAAAAAATTAGCTGGG - Intronic
1184531917 22:45061696-45061718 TGACAAAGAAATGATAATGTAGG + Intergenic
1184622702 22:45694483-45694505 TTCCAAAAAAATACAAAGGCTGG + Intronic
949978347 3:9481428-9481450 TTACAAAAAAATAATTAGCTGGG - Intergenic
950815157 3:15693302-15693324 TGACAAAAAAATAGTAATGGGGG + Intronic
951345792 3:21546056-21546078 TACCAAAAAAAAAATATGATAGG - Intronic
951581586 3:24170385-24170407 TGTCAAGAAAATATTAAAGTGGG - Intronic
952100393 3:30005194-30005216 TGCAAAAAAAAAAAGAGGGTGGG + Intronic
952173805 3:30839511-30839533 TCTCAAAAAAAAAAAAAGGTTGG + Intronic
953459444 3:43070966-43070988 TTTAAAAAAAATAATGAGGTGGG - Intergenic
953774717 3:45806538-45806560 TGTCATGAAAATAAAAAGGTGGG - Intergenic
953792277 3:45957115-45957137 AGCATAAAAAAAAATAAGGTCGG + Intronic
953944106 3:47130807-47130829 TGTCAAAAAAATAGTGAAGTGGG + Intronic
955144068 3:56298876-56298898 TGTCACAAAAATCATGAGGTGGG + Intronic
955459130 3:59161342-59161364 TGACAAAGAAATAATAAGTGAGG + Intergenic
955568903 3:60281615-60281637 TGCCAAAAAAAAAAAAAGGGGGG + Intronic
955618504 3:60835166-60835188 TGAAAAAGAAATAATAAAGTGGG - Intronic
956150708 3:66239259-66239281 TGGCAAAAAAAAAAAAAGGTTGG - Intronic
956738735 3:72258774-72258796 TGACAAAGAAATAGGAAGGTGGG + Intergenic
957492066 3:80940704-80940726 TGCCAAAAAAATCATATGTGAGG - Intergenic
957720003 3:83982709-83982731 GCCCTACAAAATAATAAGGTTGG + Intergenic
957929314 3:86857835-86857857 TTCCAAAAAATTGATAAGGTGGG - Intergenic
958431137 3:94043138-94043160 GGCCAAAAAAATAATGAATTTGG + Exonic
958478073 3:94610629-94610651 TGCCAAAATAATAAAAATGATGG - Intergenic
958649850 3:96925181-96925203 TTCCAAAAAATTAAAAAGGAGGG - Intronic
958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG + Intronic
959936661 3:112036563-112036585 TGTCAAAAAAAAAAAAAGGAGGG + Intronic
960091549 3:113644878-113644900 TTTCAAAAGAATAATAAAGTAGG - Intergenic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960497212 3:118388956-118388978 TTCCAATAAAAGGATAAGGTTGG + Intergenic
961231026 3:125309460-125309482 TGCCAAATAAATAATATTATAGG + Intronic
961998612 3:131271792-131271814 TCTCAAAAAAATAAAAAGGTCGG + Intronic
962225745 3:133606029-133606051 TGCCAAAAAAAAAATTAGCTGGG + Intronic
962541464 3:136386688-136386710 TACCAAAAAAAAAATTAGCTAGG - Intronic
962712528 3:138100025-138100047 AGCCAAAAAAAAAAAAAGGATGG - Intronic
963395482 3:144727284-144727306 TGCCATAAAAATAGTAAAATCGG + Intergenic
963493522 3:146031132-146031154 TTCCAAACAAATAAAAAGGAGGG - Intergenic
963909379 3:150802439-150802461 TGACAAAAGGATAATAAGGGAGG - Intergenic
964196475 3:154070703-154070725 TGCAAAGAAAAAAATTAGGTGGG + Intergenic
965887515 3:173465482-173465504 TGTCAGAAAAATAATAAATTTGG + Intronic
966113085 3:176427306-176427328 TGCTACAAAAATAATAAAGCAGG - Intergenic
966488579 3:180500285-180500307 TTCCAAAAAATTAAAAAGGAGGG - Intergenic
966519082 3:180854017-180854039 TGCAGAAAAAAAAATAAGGCTGG + Intronic
966523030 3:180893936-180893958 TGACAAAAATAAAATAAGGCTGG - Intronic
966573497 3:181473916-181473938 TTCCAAAAAAATAAAAAGGAGGG - Intergenic
966800425 3:183758358-183758380 GGAAAAAAAAATAATAATGTTGG + Intronic
967058773 3:185853050-185853072 TTGCAAAAAAACAAAAAGGTGGG - Intergenic
967571649 3:191036215-191036237 TGGCAAAAAACTAAGAAAGTGGG - Intergenic
967763885 3:193256270-193256292 TACAGAAAAAATAAGAAGGTAGG + Intronic
967824301 3:193866567-193866589 TCTCAAAAAAAAAAAAAGGTGGG + Intergenic
968751560 4:2392150-2392172 TCCCAAAAAAAAAAAAAGGGTGG + Intronic
968862957 4:3187153-3187175 TCCAAAAAAAATAAAAAGGCCGG - Intronic
969083592 4:4639009-4639031 TACCAAAAAAAAAAAAAGGTGGG + Intergenic
970201072 4:13606826-13606848 TGACAAAAAAAGAAAAAGGGAGG - Intronic
970960195 4:21862468-21862490 TGCCACAAAGATAAAAAGGCAGG + Intronic
971887210 4:32466130-32466152 AGCCATTAAAATAATAAGGTAGG - Intergenic
972044647 4:34650003-34650025 TGCCAAAGAAATAAAAAAGCTGG - Intergenic
972097887 4:35371304-35371326 TACAAAAAAATTCATAAGGTAGG + Intergenic
972211349 4:36841700-36841722 TGACAAAAAAATAATATGCTTGG - Intergenic
972514123 4:39796537-39796559 TACCAAAAAAAAAAAAAGGCCGG + Intergenic
972519489 4:39840259-39840281 TGCCAAAAAATTAAGAAATTGGG + Intronic
972589173 4:40467983-40468005 TGGAAAAAAAATAATAAAGGAGG + Intronic
972722656 4:41716143-41716165 AGCCAAAAAAAAAAAAATGTAGG + Intergenic
972727842 4:41761147-41761169 TGTCAAAAAAAAAAGAAGGAAGG + Intergenic
972918987 4:43914698-43914720 TTCCAAAAAATTAAAAAGGAGGG + Intergenic
973130525 4:46642671-46642693 TCAAAAAAAAATAATAAAGTAGG + Intergenic
973773051 4:54224082-54224104 TCTCTAAAAAATAATAAGGCTGG - Intronic
974171016 4:58267607-58267629 TGCCATTAAGATAATAAGATTGG + Intergenic
974957029 4:68654462-68654484 TGCAAAAAAAAGAATAAGATTGG + Intronic
975692526 4:76979845-76979867 TGTCAAAAAAAAAAAAAAGTGGG + Intronic
976328500 4:83800264-83800286 TACCAAAAAAATAATTAGCCGGG - Intergenic
976427553 4:84923387-84923409 TGCAAAAAATGTAATAAGGTGGG - Intronic
976813788 4:89124109-89124131 TTTCAAAAAAAAAAAAAGGTGGG - Intergenic
977152783 4:93533962-93533984 AGCCAGAAAGATAATGAGGTGGG - Intronic
977305624 4:95319797-95319819 TGCCAAAAAAATGATAGGGTGGG + Intronic
977477015 4:97524588-97524610 TGCCATAAAAATAAGATGGCTGG - Intronic
977484228 4:97621733-97621755 TGCCAAAAATTTAAGAAGGAGGG + Intronic
977855269 4:101882762-101882784 TGCCAAAAAAATTCTTAGATTGG + Intronic
978095906 4:104777351-104777373 TTCCAAAAAATTAAAAAGGAGGG - Intergenic
978238156 4:106485485-106485507 TTCAAAAAAAATAATAAGATAGG - Intergenic
978952633 4:114579487-114579509 TGAAAAAAAAATAATAAGATAGG - Intergenic
979403832 4:120284113-120284135 TGACAAAAAAAAAAAAAAGTAGG - Intergenic
979576318 4:122295549-122295571 TTCCAAAAAAATGAAAAGGAGGG + Intronic
980099088 4:128523425-128523447 TGAAAAAACACTAATAAGGTAGG + Intergenic
980437044 4:132790538-132790560 TGAAAAAAAAAGAATAAAGTTGG + Intergenic
980709189 4:136541999-136542021 TGAAGAAGAAATAATAAGGTGGG + Intergenic
981030318 4:140118945-140118967 TGTCAAAAAAATGATTAGGTTGG - Intronic
981299731 4:143173521-143173543 TCCAAAAAAAATAATAACTTTGG + Intergenic
981819481 4:148869213-148869235 TGCTATAAAAATAAATAGGTAGG - Intergenic
983021359 4:162679545-162679567 TGCCAAAAGAATCCTAAGCTTGG + Intergenic
984190808 4:176603877-176603899 TATTAAGAAAATAATAAGGTTGG + Intergenic
984484751 4:180353791-180353813 TACCAAAAAAAAAATTAGCTGGG - Intergenic
984894446 4:184524981-184525003 TTCCAAAAAATTAAAAAGGAAGG - Intergenic
985047139 4:185951917-185951939 TTCCAAAAAAAGAATAGAGTTGG - Intronic
985516575 5:348328-348350 TGCAAAAAAAAAAAAAAGGAGGG - Intronic
985930652 5:3054756-3054778 TTCAAAAAAAAAAATAAGTTGGG - Intergenic
986591734 5:9377648-9377670 AGGCAAAGAAATAATTAGGTTGG + Intronic
986620710 5:9670747-9670769 TTCCAAAAAATTAAGAAGGAAGG + Intronic
986883515 5:12205393-12205415 TGTCAAAAAAAAAAGAAGGAAGG - Intergenic
988799555 5:34683727-34683749 TCTCAAAAAAAAAAAAAGGTGGG - Intronic
989717966 5:44487849-44487871 TGCTAAAAAAATAATAATAATGG - Intergenic
989722235 5:44542915-44542937 TGCCTAGAAAATAATGGGGTTGG + Intergenic
990598496 5:57334172-57334194 TGCCAAAGTTAGAATAAGGTGGG - Intergenic
990674179 5:58164905-58164927 TGACAATAATATAATAAGATTGG + Intergenic
990915507 5:60899787-60899809 TGCCATAAAATTAGAAAGGTGGG - Intronic
991406028 5:66301932-66301954 AGCAAAAAACATAAAAAGGTGGG + Intergenic
991651530 5:68860138-68860160 TGACAAAAAAAGAACAAAGTTGG + Intergenic
991709215 5:69390949-69390971 TGTCAAAAAAAAAAAAAGGCCGG + Intronic
992059958 5:73034158-73034180 TGCCAGGTAAATAATAAGTTGGG - Intronic
992437078 5:76764956-76764978 TTCCAAAAAATTAAAAAGGAGGG - Intergenic
992847444 5:80765463-80765485 TGCAAAAAAAATAAGAAGTTAGG - Intronic
993020098 5:82581748-82581770 TGCCAAACAATTGAAAAGGTGGG - Intergenic
993147153 5:84109963-84109985 TGCTGAAAAAATAATGAGCTTGG + Intronic
993586997 5:89743747-89743769 TTCCAAAAAATTAAAAAGGAGGG - Intergenic
993615652 5:90108706-90108728 TGCAAAAAAAAAAATCAGTTTGG + Intergenic
993689046 5:90975856-90975878 TAAAAAAAAAATAATAAGGCAGG + Intronic
994386340 5:99137300-99137322 TGCCAAAATAGAAATTAGGTGGG - Intergenic
994646365 5:102474127-102474149 TGCAAAAAGAAAAATAAAGTTGG + Intronic
994893267 5:105667132-105667154 TTCCAAAAAATAAATAAGGAGGG - Intergenic
995336075 5:111001358-111001380 AGCCAAGAAAATAATAAATTAGG + Intergenic
995832068 5:116364280-116364302 TGACATAAAGAGAATAAGGTGGG + Intronic
996943522 5:129038931-129038953 TGATCATAAAATAATAAGGTGGG + Intergenic
997267849 5:132506865-132506887 TCTAAAAAAAATAATAAGTTAGG + Intergenic
998116992 5:139545722-139545744 TTCCAAAAAAAAAAAAATGTAGG - Intronic
998616368 5:143744830-143744852 TGCAAAAAAAACAAAAAAGTAGG + Intergenic
998961677 5:147494563-147494585 TGTCAAAAGAATAATAAAGGAGG + Intronic
999509499 5:152233780-152233802 TACAAAAAAAAAAATTAGGTAGG - Intergenic
999775412 5:154808963-154808985 TGCAAAAAATATTATAACGTAGG - Intronic
1000355203 5:160387844-160387866 TTCCAAAAAAATGAAAAGGGAGG - Intergenic
1000420907 5:161036864-161036886 TGCATAAAAAATGATAAAGTGGG + Intergenic
1002430548 5:179201349-179201371 TGTCATATAAATAATAAGTTAGG + Intronic
1002948120 6:1781852-1781874 TGCCAAAAAAAAAAAAAAGTTGG - Intronic
1002984850 6:2179298-2179320 TGCCAAAAAAAAAATATTTTAGG + Intronic
1004484680 6:16055068-16055090 TGCCAAAAAAAAAAAAAAATTGG + Intergenic
1004511817 6:16289402-16289424 TGTCAAAAAAGTAAAAACGTGGG - Intronic
1004658461 6:17687956-17687978 TACCAAAAAAAAAATTAGCTAGG + Intronic
1004767537 6:18747600-18747622 TACCAAAAAAAAAAAAAAGTTGG - Intergenic
1004928825 6:20441992-20442014 TAGCAAAAAAAAAAAAAGGTTGG - Intronic
1005462740 6:26084522-26084544 TGTCAAAAAAAAAAAAAGATAGG + Intergenic
1005827038 6:29638998-29639020 TACAAAAAAAATAATTAGCTGGG + Intergenic
1006284767 6:33084483-33084505 TGCCTAAGAAATAATAATCTGGG + Intronic
1007381034 6:41490135-41490157 TTCCAAGAAAATAAAATGGTGGG - Intergenic
1007780213 6:44248311-44248333 TGGCAGAAAAATCATAATGTTGG - Intronic
1008082281 6:47207114-47207136 AGGCAAAACAATTATAAGGTGGG + Intergenic
1008358115 6:50579760-50579782 TGCTATAAAAATAGAAAGGTAGG + Intergenic
1008590411 6:52988280-52988302 TGCTAAAAAAAAAAAAAGGTAGG + Intronic
1008763829 6:54885157-54885179 TTCCAAAAAAAAAATAATGTTGG + Intronic
1009953564 6:70424296-70424318 TGTCAAATAAATTATAAGCTAGG - Intronic
1009977621 6:70689514-70689536 TTCGAAAAAAATAACAAAGTTGG - Intronic
1010251082 6:73707853-73707875 TGCCAAAAAAAGAAAAAATTGGG - Intronic
1010405259 6:75497580-75497602 TACCAAAAAAACAATAAAATTGG - Intergenic
1010859768 6:80895405-80895427 AACCAAGAAAATAAAAAGGTCGG - Intergenic
1010960395 6:82139123-82139145 TGCCAACAATATAGTAAGATGGG + Intergenic
1011769263 6:90657786-90657808 TACCTAAAAAATAAGAAAGTAGG - Intergenic
1011906253 6:92372267-92372289 TGCGAAAAGAAGGATAAGGTTGG - Intergenic
1012022299 6:93939347-93939369 TGCCAAAAAAAAAAAAAGACAGG + Intergenic
1012155757 6:95818095-95818117 TTCCAAAAAATTGAAAAGGTGGG + Intergenic
1012370995 6:98507239-98507261 TACCAAAAAAAAAATTAGCTGGG - Intergenic
1013626079 6:111938341-111938363 TGCCAAAAAGAAAGTAGGGTTGG - Intergenic
1013744062 6:113323574-113323596 AGCCAAAAAAATAATAAGGAAGG - Intergenic
1013968924 6:115991722-115991744 TAACAAAAAAATAATACTGTAGG - Intronic
1014422879 6:121267124-121267146 TTCTAAAAAAAAAAAAAGGTCGG + Intronic
1014564067 6:122927141-122927163 TTCCAAAAAATTAAAAAGGAGGG - Intergenic
1014772335 6:125471219-125471241 TTCAAAAAAAATCATAAAGTTGG + Intergenic
1015166630 6:130206579-130206601 TGCCAAATATATACTAAGGCAGG + Intronic
1015774469 6:136799790-136799812 TGGCTTAAAAATAATATGGTAGG + Intergenic
1016288677 6:142504188-142504210 TTCCAAAAAATTAAAAAGGAGGG - Intergenic
1016671267 6:146711616-146711638 TGCCAAAATATAAATTAGGTGGG - Intronic
1016684965 6:146870827-146870849 TGAAAAAAAAATAATAAACTTGG + Intergenic
1017137857 6:151164116-151164138 TTCCAAAAAAAAAATTAGCTGGG - Intergenic
1018361070 6:163068914-163068936 AGTCAAAAAAATAATAAGTCAGG - Intronic
1020168446 7:5826031-5826053 TACCAAAAAAAAAATTAGCTGGG + Intergenic
1020468457 7:8507805-8507827 TGCCAAACAAATCATGAGGCAGG - Intronic
1020862571 7:13513271-13513293 TTTGAAAAAAATAATAATGTAGG + Intergenic
1021060397 7:16103943-16103965 TGCAAAAAAAAGAATAAAATGGG + Intronic
1021062660 7:16132756-16132778 TACCAAAAAAATAAAAAGTTAGG + Intronic
1021371706 7:19857189-19857211 TTCCAAAAAAATGAAAAGGAGGG + Intergenic
1021782965 7:24124177-24124199 TGCAAAAAGGATAAAAAGGTAGG + Intergenic
1021921467 7:25489666-25489688 TGCAAAAAAAAAAATTAGCTGGG + Intergenic
1022651300 7:32278124-32278146 TGCCAAAAAAAAAAAAATGCAGG + Intronic
1022869824 7:34464559-34464581 CACCAAAAAAATAAAAAGGAAGG - Intergenic
1023040507 7:36168754-36168776 TCTCAAAAAAAAAAAAAGGTTGG + Intronic
1023370753 7:39509931-39509953 TGCAACAGAAATACTAAGGTAGG + Intergenic
1023386677 7:39664803-39664825 TGCCAAAAAAAAAAAATAGTGGG + Intronic
1023412986 7:39905801-39905823 TGCCAAAAAAATACTACAGCTGG + Intergenic
1023886017 7:44356803-44356825 TTTCAAAAAATTAATAAGATAGG - Intergenic
1023915598 7:44586534-44586556 TACCAAAAAAAAAATTAGCTGGG + Intergenic
1024521836 7:50311960-50311982 TACCAAAAAAATAATGACCTGGG + Intronic
1024523862 7:50331436-50331458 TGCAAAAAAAAAAAAAAAGTGGG + Intronic
1024751778 7:52474741-52474763 TGCCAAAATAAAAATTAAGTGGG - Intergenic
1024791864 7:52973993-52974015 TCCCAGATAAATAATAATGTAGG - Intergenic
1024917746 7:54522746-54522768 TGCAAAAAAAAAAATAAAATAGG - Intergenic
1025226248 7:57166790-57166812 TACAAAAAAAATAATTAGCTGGG + Intergenic
1025844449 7:65183747-65183769 TGAATAAAAAATAATAAGGCCGG - Intergenic
1025894777 7:65690078-65690100 TGAATAAAAAATAATAAGGCCGG - Intergenic
1025948466 7:66123746-66123768 TCTCAAAAAAAAAAAAAGGTGGG + Intronic
1026604388 7:71803476-71803498 TGCCAAAAAAAGAAAAAAGAAGG - Intronic
1027280970 7:76609148-76609170 TACCAAAAATAGAATAAGTTGGG + Intergenic
1027499840 7:78935604-78935626 ATCCAAAAACATAATAAGATGGG - Intronic
1027788788 7:82613657-82613679 TGCCAAAAAAATGGTGAGGTGGG + Intergenic
1027912066 7:84263123-84263145 TGCCCAAAAAATAATATTGAGGG - Intronic
1028616075 7:92768239-92768261 TGCCAAAAAGAAAATAAACTGGG + Intronic
1028766923 7:94570194-94570216 GGACAAAAAAATAATAAGACAGG - Intergenic
1028767305 7:94574263-94574285 TTCCAAAAAATTAAGGAGGTGGG - Intergenic
1028851598 7:95543866-95543888 TGCTATAAAAATTATAAGGTTGG - Intergenic
1028927819 7:96378874-96378896 TGGAAAAAATAGAATAAGGTAGG - Intergenic
1029446608 7:100616530-100616552 TACAAAAAAAATAAAAAGGAGGG + Intergenic
1029594709 7:101531269-101531291 TGATAAAGAAATAAAAAGGTAGG - Intronic
1030254122 7:107488547-107488569 AGCCAAAAGAATAATAGGCTGGG + Intronic
1030403496 7:109082389-109082411 TTCCAAAAAATTAAAAAGGAAGG - Intergenic
1030922202 7:115405425-115405447 TGGCAAAATACTAATTAGGTAGG - Intergenic
1031220152 7:118955513-118955535 TGGCAACAAAATAATAATGAGGG - Intergenic
1031831348 7:126630489-126630511 TTCCAAAAAATTGAAAAGGTTGG + Intronic
1032872535 7:136001696-136001718 TGAAAAAAAAATGAGAAGGTAGG + Intergenic
1032938149 7:136757702-136757724 TGCTAGAAAAATAATTGGGTGGG - Intergenic
1032980438 7:137276026-137276048 TCCCAAATACATAATAATGTGGG - Intronic
1032998573 7:137477350-137477372 TGCTAAAAACATATTAAGATTGG - Intronic
1033023954 7:137754654-137754676 TGCTAAGAAAAGAACAAGGTGGG + Intronic
1033718434 7:144028668-144028690 TGCTAGAAAAATAATAATGTTGG - Intergenic
1034058788 7:148067080-148067102 TGCCAGAAAAATAATTCGGTAGG - Intronic
1034152456 7:148927699-148927721 AGCCCTAAAAATAATTAGGTAGG - Intergenic
1034204510 7:149304062-149304084 TGTCAAAAAAAAAAAAAGGGAGG - Intergenic
1034668197 7:152836583-152836605 TTTCAAAAAAAAAAAAAGGTTGG + Intronic
1034693302 7:153031504-153031526 TACCAAAAAAAAAATTAGTTGGG - Intergenic
1035261527 7:157664596-157664618 CTCCAAAAAAATAATTAGCTAGG + Intronic
1035852578 8:2935431-2935453 TGTCAAAAAAATTATAAAGAGGG - Intronic
1035869143 8:3118175-3118197 TGCCAAGGAAATTATAAGGATGG - Intronic
1035963056 8:4158587-4158609 GGCCAGAAAAATAAGAAGGAGGG - Intronic
1036087545 8:5628627-5628649 TGCCAAAAAAAAAAAAAAATGGG + Intergenic
1036195845 8:6713712-6713734 TACCAAAAAAAAAATTAGCTGGG - Intronic
1036513693 8:9423629-9423651 TGACAAAAAACTAAAAATGTGGG + Intergenic
1036712994 8:11094078-11094100 TGTCAAAAAAAAAAAAAGGCCGG - Intronic
1036869556 8:12426350-12426372 TCTCAAAAAAAAAAAAAGGTTGG + Intronic
1037007956 8:13805674-13805696 TGCTTAAGAAATAATAGGGTAGG + Intergenic
1037123054 8:15313182-15313204 TGCCAAAAAATTTATTTGGTTGG - Intergenic
1038268383 8:26053645-26053667 TGTCAAAAAAAAAAAAAGGGGGG - Intergenic
1038852490 8:31293604-31293626 TGCCAGTAACAGAATAAGGTAGG + Intergenic
1038992999 8:32889921-32889943 TCCCAACAACATAATAAAGTAGG - Intergenic
1039047528 8:33463501-33463523 TCTCAAAAAAAAAAAAAGGTGGG + Intronic
1040030354 8:42818346-42818368 TGCAAAAAAAAAAATTAGCTGGG + Intergenic
1040408247 8:47130249-47130271 TGCCAAAAAAGCAAAAAGGTTGG + Intergenic
1040647139 8:49412417-49412439 TGCCAACAGAAAAAGAAGGTAGG - Intergenic
1040849036 8:51879306-51879328 TGACTAAAAAAAAATAAAGTTGG + Intronic
1041079581 8:54203393-54203415 TGCCAAAAAAAGAAAACTGTAGG - Intergenic
1041324900 8:56653513-56653535 TTTCAAAAAAAAAAAAAGGTGGG - Intergenic
1041481876 8:58331565-58331587 TGCTAAAAGAAAAAAAAGGTGGG + Intergenic
1041563036 8:59242301-59242323 TACCAAAAAAAAAAAAAGGATGG - Intergenic
1042320068 8:67465989-67466011 TTCCAAAAAATTAAGGAGGTAGG - Intronic
1042509685 8:69598107-69598129 GGCCAAAAAAAAAAAAAGGGGGG + Intronic
1042883083 8:73516092-73516114 TACCAAAAAAAAAATTAGTTGGG - Intronic
1042911368 8:73830645-73830667 TACCAAAAAAAAAATTAGCTGGG - Intronic
1043324079 8:79028147-79028169 TGCCAAAATAACCATAAGCTTGG + Intergenic
1043451980 8:80377088-80377110 TGCCACAAAATGAAAAAGGTAGG - Intergenic
1043755720 8:84000820-84000842 TGCCAACAAAACATTAAGGTGGG + Intergenic
1044184074 8:89231142-89231164 TGCAAAAAAAATACTAAAATGGG + Intergenic
1044433522 8:92135854-92135876 TGCAAAAAAAAAAATTAGCTGGG - Intergenic
1045521330 8:102905521-102905543 TACAAAAAATAAAATAAGGTTGG + Intronic
1045580050 8:103468518-103468540 TACCAAAAAAAAAATTAGCTGGG - Intergenic
1045595227 8:103647459-103647481 TTCCAAAAAATTAAAAAGGAGGG - Intronic
1045922576 8:107548260-107548282 TTCCAAAAAAAAATTAAGGTAGG - Intergenic
1046069041 8:109228244-109228266 TGACAAAGAAACATTAAGGTTGG + Intergenic
1046954714 8:120051548-120051570 GGCCACAAAACTAATAAAGTGGG + Intergenic
1048260900 8:132944267-132944289 TGCCAAGAAAATAATAATACAGG - Intronic
1049120435 8:140732082-140732104 TAACAAAGAAATAATAAGTTTGG - Intronic
1050159679 9:2704798-2704820 GGCAAAAAAAAAAAAAAGGTGGG - Intergenic
1050161699 9:2726486-2726508 AGCCAAAAAAAAAAGAAGTTTGG + Intronic
1050563548 9:6858824-6858846 TACCAAAAAAATGATAAAGCTGG - Intronic
1051089554 9:13390223-13390245 TTTGAAAAAAATAATAAGATAGG + Intergenic
1051111337 9:13640664-13640686 TTCCAAAAAACTTAAAAGGTGGG + Intergenic
1052262115 9:26529062-26529084 TGGACAATAAATAATAAGGTAGG + Intergenic
1052439702 9:28480264-28480286 TGCAAAGAAAATCATAAGGTGGG - Intronic
1052468078 9:28855620-28855642 TGCCAAAGAAAATATAAGATAGG + Intergenic
1052875792 9:33561703-33561725 TGCAAAAAAAATTATAAAGTTGG - Intronic
1053500219 9:38582640-38582662 TGCAAAAAAAATTACAAAGTTGG + Intergenic
1055084323 9:72298886-72298908 TGAAAAAATAAAAATAAGGTAGG + Intergenic
1055278229 9:74643596-74643618 TGCCATAAAAATATTGAAGTAGG + Intronic
1055281917 9:74683939-74683961 TGAAAAAAAATTAATAATGTTGG + Intronic
1055656158 9:78452312-78452334 TGCCAAAAAAAAAAAAAAGCAGG + Intergenic
1055724195 9:79210249-79210271 TGGCAAAAAAATAAAATAGTAGG - Intergenic
1056105678 9:83344028-83344050 TTCCAGAAAAATAGCAAGGTGGG + Intronic
1056546550 9:87618663-87618685 TGTCAATAAAATCATAGGGTGGG - Intronic
1056803094 9:89707654-89707676 TGTCAAAAAAAAAAAAAGGAAGG - Intergenic
1058197305 9:101993774-101993796 TGTAAGAAAAATAATAAAGTAGG - Intergenic
1058199084 9:102016631-102016653 TGCCAAAAAAATAAAAAGATAGG + Intergenic
1058304097 9:103415097-103415119 TGCCAAAATAAGAATAATGGTGG - Intergenic
1058406904 9:104687008-104687030 TGTCTCAAAAATAATAAGTTAGG + Intergenic
1058630199 9:106978699-106978721 AGCCAAAAACAAAATAAGGCTGG - Intronic
1059159110 9:112017292-112017314 AGACAAAAAAAAAAAAAGGTGGG - Intergenic
1059177014 9:112176338-112176360 TGAAAAAAAAAAAATTAGGTGGG + Intergenic
1059259106 9:112959020-112959042 TACCATAAAAATAATTTGGTAGG - Intergenic
1059380884 9:113923036-113923058 TGCCAAAAAAATAAAAACGTAGG - Intronic
1060001100 9:119959210-119959232 TGCAAAAAAAAAAATTAGCTAGG + Intergenic
1060369856 9:123058259-123058281 TGCATTAAAAATACTAAGGTAGG + Intronic
1060417661 9:123443953-123443975 TCTCAAGAAAAAAATAAGGTGGG + Intronic
1060577035 9:124705777-124705799 TGTCAAAAAAAAAAAAAGGGGGG - Intronic
1060802307 9:126552455-126552477 TGCCTCAAAAATAACAAGGCCGG + Intergenic
1061617378 9:131789231-131789253 TGTCAAAAAAAGAAGAAGGAAGG - Intergenic
1061708568 9:132471569-132471591 TGCTATAAACATAATCAGGTAGG + Intronic
1203758536 Un_GL000218v1:159061-159083 TTACAAAAAAATAATAATGAAGG + Intergenic
1186044272 X:5517816-5517838 TTTCAAAAAAATAATGAGTTGGG - Intergenic
1186248849 X:7644620-7644642 TGCCCAAAAAAGATTAAAGTGGG - Intergenic
1186793433 X:13021327-13021349 TACAAAAAAAAAAATTAGGTGGG + Intergenic
1187756105 X:22528530-22528552 TGCAAAAAAATTGATAAGGAGGG + Intergenic
1189345391 X:40237275-40237297 TGCCAAAAAAAAAAAAAGGCTGG - Intergenic
1189668179 X:43380121-43380143 TGCTCAAAAAAGAATAAGCTAGG + Intergenic
1189823359 X:44892391-44892413 TACCAAAAAAATACAAAGCTGGG + Intronic
1190251882 X:48733108-48733130 TCTCAAAAAAATAATAAAATAGG - Intergenic
1190498110 X:51046759-51046781 TGGTAAAAAAATAATAAAATAGG + Intergenic
1190811189 X:53885761-53885783 TTCCAAAAAAATGAAAAGGAGGG - Intergenic
1190870772 X:54423017-54423039 TACCAAAAAAAAAATTAGCTGGG + Intergenic
1191147302 X:57180739-57180761 TTCCAAAATATTAATAAGGAAGG + Intergenic
1193292116 X:79787156-79787178 TTTTAAAAAAATAATAGGGTTGG + Intergenic
1193559001 X:82994436-82994458 TGAAAAAAAAATAATGAGATAGG - Intergenic
1193785758 X:85757865-85757887 TGAAAAAAAAATACAAAGGTGGG - Intergenic
1193793557 X:85845928-85845950 TTCCAAAAAACTTAAAAGGTGGG + Intergenic
1193860668 X:86662589-86662611 TCTCAAAAAAAAAAAAAGGTGGG + Intronic
1194180168 X:90701431-90701453 TGGAAAAAAATTAATAAGATAGG + Intergenic
1194225765 X:91255163-91255185 AGCAAACAAAAAAATAAGGTGGG - Intergenic
1194668708 X:96704559-96704581 TGGCAAAAAAATCATATGGTAGG - Intronic
1194694937 X:97035458-97035480 TGTCTAAAATATAACAAGGTGGG + Intronic
1195270459 X:103223920-103223942 TGCCAAAAAATTGATGAGGAGGG + Intergenic
1195884015 X:109621843-109621865 TGCCAAAAATAAAAGAAGCTGGG - Intergenic
1195898376 X:109772010-109772032 TGTCAAAAAAAAAAAAAGGAAGG + Intergenic
1195916440 X:109940907-109940929 TGCCATGAAAATAATAAAATAGG + Intergenic
1196284141 X:113860286-113860308 TTCCAAACAATTAAAAAGGTGGG - Intergenic
1197024540 X:121732766-121732788 TGAAAAAATAATAATAAGGAGGG - Intergenic
1197517867 X:127458586-127458608 TGCCAAGGAAATAATAAGAAAGG + Intergenic
1197577162 X:128229227-128229249 TGCTAAAATAAAAATAAGATGGG + Intergenic
1197690556 X:129495931-129495953 TGCAAAAAAAAAAATTAGCTGGG - Intronic
1198285711 X:135189305-135189327 TTCCAAAAAAATGATAAGAAAGG + Intergenic
1198361545 X:135900524-135900546 TTCCAAAAAATTAAAAAGGAGGG - Intronic
1198578926 X:138042103-138042125 TTCCAAAAAATTAAAAAGGAGGG + Intergenic
1198713385 X:139529747-139529769 TACCAAAAGAAGAATAAAGTTGG + Intergenic
1198834595 X:140790496-140790518 TCTGAAAAAAATAATAATGTAGG - Intergenic
1199030111 X:142987695-142987717 TGTGATAAATATAATAAGGTAGG - Intergenic
1200371491 X:155729750-155729772 TACCAAAAAAAGAAAAAGTTGGG + Intergenic
1200526825 Y:4283593-4283615 TGGAAAAAAAATAATAAGATAGG + Intergenic
1202164577 Y:21973174-21973196 TGCCAAAAGAAGAGTAAGGTAGG - Intergenic
1202175157 Y:22091993-22092015 TGACAAAAAAATAGAAAGTTGGG - Intronic
1202216205 Y:22494390-22494412 TGACAAAAAAATAGAAAGTTGGG + Intronic
1202226779 Y:22613198-22613220 TGCCAAAAGAAGAGTAAGGTAGG + Intergenic
1202316341 Y:23582462-23582484 TGCCAAAAGAAGAGTAAGGTAGG - Intergenic
1202326981 Y:23701674-23701696 TGACAAAAAAATAGAAAGTTGGG - Intergenic
1202543788 Y:25968378-25968400 TGACAAAAAAATAGAAAGTTGGG + Intergenic
1202554423 Y:26087596-26087618 TGCCAAAAGAAGAGTAAGGTAGG + Intergenic