ID: 1092629031

View in Genome Browser
Species Human (GRCh38)
Location 12:10358826-10358848
Sequence GAGGGCAAACAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2287
Summary {0: 6, 1: 75, 2: 308, 3: 635, 4: 1263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092629031_1092629044 24 Left 1092629031 12:10358826-10358848 CCACCCTGCTTCTGTTTGCCCTC 0: 6
1: 75
2: 308
3: 635
4: 1263
Right 1092629044 12:10358873-10358895 CCAGTCCCAATTAGATGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092629031 Original CRISPR GAGGGCAAACAGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr