ID: 1092629578

View in Genome Browser
Species Human (GRCh38)
Location 12:10363666-10363688
Sequence CCTTTTAAGCATTTCGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092629578_1092629587 28 Left 1092629578 12:10363666-10363688 CCACCCACGAAATGCTTAAAAGG No data
Right 1092629587 12:10363717-10363739 CCTTTGGATGTTAATCCAAGTGG No data
1092629578_1092629583 -2 Left 1092629578 12:10363666-10363688 CCACCCACGAAATGCTTAAAAGG No data
Right 1092629583 12:10363687-10363709 GGTAACTTGACTCTTTGTTTGGG 0: 3
1: 19
2: 84
3: 44
4: 164
1092629578_1092629585 12 Left 1092629578 12:10363666-10363688 CCACCCACGAAATGCTTAAAAGG No data
Right 1092629585 12:10363701-10363723 TTGTTTGGGGCTCAGTCCTTTGG 0: 9
1: 20
2: 60
3: 66
4: 217
1092629578_1092629584 -1 Left 1092629578 12:10363666-10363688 CCACCCACGAAATGCTTAAAAGG No data
Right 1092629584 12:10363688-10363710 GTAACTTGACTCTTTGTTTGGGG 0: 3
1: 11
2: 27
3: 83
4: 161
1092629578_1092629582 -3 Left 1092629578 12:10363666-10363688 CCACCCACGAAATGCTTAAAAGG No data
Right 1092629582 12:10363686-10363708 AGGTAACTTGACTCTTTGTTTGG 0: 6
1: 26
2: 16
3: 22
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092629578 Original CRISPR CCTTTTAAGCATTTCGTGGG TGG (reversed) Intergenic
No off target data available for this crispr