ID: 1092632366

View in Genome Browser
Species Human (GRCh38)
Location 12:10395735-10395757
Sequence AAAGGCAGTGTGTAGTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092632361_1092632366 5 Left 1092632361 12:10395707-10395729 CCAGCTTATATGATAAATTTTGT 0: 1
1: 0
2: 4
3: 30
4: 380
Right 1092632366 12:10395735-10395757 AAAGGCAGTGTGTAGTCTGGAGG 0: 1
1: 0
2: 3
3: 23
4: 199
1092632359_1092632366 11 Left 1092632359 12:10395701-10395723 CCCTTGCCAGCTTATATGATAAA 0: 1
1: 0
2: 0
3: 17
4: 192
Right 1092632366 12:10395735-10395757 AAAGGCAGTGTGTAGTCTGGAGG 0: 1
1: 0
2: 3
3: 23
4: 199
1092632360_1092632366 10 Left 1092632360 12:10395702-10395724 CCTTGCCAGCTTATATGATAAAT 0: 1
1: 0
2: 4
3: 10
4: 152
Right 1092632366 12:10395735-10395757 AAAGGCAGTGTGTAGTCTGGAGG 0: 1
1: 0
2: 3
3: 23
4: 199
1092632358_1092632366 24 Left 1092632358 12:10395688-10395710 CCATAAAATTTCTCCCTTGCCAG 0: 1
1: 0
2: 1
3: 18
4: 211
Right 1092632366 12:10395735-10395757 AAAGGCAGTGTGTAGTCTGGAGG 0: 1
1: 0
2: 3
3: 23
4: 199
1092632357_1092632366 25 Left 1092632357 12:10395687-10395709 CCCATAAAATTTCTCCCTTGCCA 0: 1
1: 0
2: 2
3: 24
4: 238
Right 1092632366 12:10395735-10395757 AAAGGCAGTGTGTAGTCTGGAGG 0: 1
1: 0
2: 3
3: 23
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092632366 Original CRISPR AAAGGCAGTGTGTAGTCTGG AGG Intronic
900841605 1:5052912-5052934 AAAGGGGGTTTGTTGTCTGGTGG - Intergenic
901209403 1:7515916-7515938 AAAGGGATTGTGGAGCCTGGTGG + Intronic
902229378 1:15018041-15018063 AAAGGGAGTTTGCAGGCTGGGGG - Intronic
902790049 1:18761680-18761702 AAAGGCAGCTTGAAGTCAGGGGG + Intergenic
903839793 1:26230576-26230598 ATATGCACTGTGTGGTCTGGTGG - Intergenic
905307068 1:37027177-37027199 AGAGGCAGTGTGGACCCTGGAGG + Intronic
905824168 1:41016569-41016591 AAATGCAGTGTATAGTCTTTGGG + Intronic
906084980 1:43124601-43124623 AAAGTTACGGTGTAGTCTGGGGG - Intergenic
906144009 1:43549441-43549463 AAAGGCAGGGAGGAGTCTGAGGG + Intronic
909183012 1:72449473-72449495 AAGGGCAGGATGTAGTCCGGTGG - Intergenic
909881938 1:80890851-80890873 AAAAGCAGCGTGTCCTCTGGGGG - Intergenic
911584458 1:99674497-99674519 ATAAGCAGTGTGAGGTCTGGTGG - Intronic
911924780 1:103816614-103816636 CAGGGCAGTGTGCAGTCTGTTGG - Intergenic
913433207 1:118818569-118818591 AAAGGCAGAGTTTAATCTTGAGG - Intergenic
913718169 1:121560574-121560596 AAAAGCAGTGTATATTCTGCCGG + Intergenic
917739419 1:177947910-177947932 AAAAGCAGTGGGGAGACTGGAGG - Exonic
919456523 1:197827005-197827027 CAAGGCTGTGTGTCTTCTGGAGG + Intergenic
920667420 1:207973126-207973148 AAAGGTAGTCTGCAGTCTGGGGG - Intergenic
920725996 1:208435780-208435802 ACAGGCAGTGTGTAGTGGGATGG + Intergenic
920729949 1:208474047-208474069 TCAGGCAGTGTGTAGACAGGAGG + Intergenic
921617823 1:217292287-217292309 AAAGGCAATGTTTCTTCTGGAGG - Intergenic
922291368 1:224211504-224211526 AAGGGCATTTTGAAGTCTGGAGG - Intergenic
923905516 1:238379605-238379627 AAAGGGAGTTTGTTCTCTGGTGG + Intergenic
924098349 1:240578093-240578115 AAAGGCAGAGAGTAGAATGGTGG - Intronic
924116126 1:240748946-240748968 AAAGGCAGAGAGTAGACTGGTGG + Intergenic
1066587649 10:36954502-36954524 AAAGGCATTGAGGAGTCTAGAGG + Intergenic
1067697106 10:48543282-48543304 CAAGGCAGTGAGGAGCCTGGAGG - Intronic
1068213094 10:53947735-53947757 AAAAGCAGTGTCTAGTCTTTTGG - Intronic
1071175530 10:82922612-82922634 AAATGGAATGTGTTGTCTGGAGG + Intronic
1071706609 10:88006260-88006282 AAAGGCAGGGTGAAGGGTGGGGG + Intergenic
1072909145 10:99484564-99484586 ACAGGAAGGGGGTAGTCTGGGGG - Intergenic
1073095311 10:100976011-100976033 AAAAGCAGTGAGGAGGCTGGGGG + Intronic
1075244379 10:120807549-120807571 AGAGGCAGTGTGTGGTCTGGTGG - Intergenic
1076086641 10:127637653-127637675 CAGGGCAGGGTGCAGTCTGGTGG + Intergenic
1076322124 10:129591028-129591050 AAACGCAGTGTGTTTTCTGTAGG + Intronic
1077051089 11:567375-567397 AAAGGCTGTGTGTGGTCTTGGGG - Intergenic
1077067624 11:650085-650107 AAAGGCAGAGACTAGTGTGGTGG + Intronic
1078977437 11:16494983-16495005 CAAGGCAGGATGCAGTCTGGAGG - Intronic
1083765916 11:64841630-64841652 GAGGTCAGTGTGGAGTCTGGGGG - Exonic
1084651756 11:70493690-70493712 AAAGCCAGTGTGGTATCTGGTGG + Intronic
1085280462 11:75326688-75326710 AAAGGCAGTGTGTAGTAAGAGGG - Intronic
1085900451 11:80693452-80693474 AAAGGCATTGAGGAGTCTAGAGG - Intergenic
1086123551 11:83326540-83326562 CAGGGCAGTGTGTGGTCTGTTGG + Intergenic
1087717561 11:101625976-101625998 GAAGGCAGTCTGTAGTTTGGAGG - Intronic
1088344692 11:108809562-108809584 AATGGAAGAGTGGAGTCTGGGGG + Intronic
1088400722 11:109420858-109420880 AAAGGCTGTCTGTAATCTGGGGG - Intergenic
1088805881 11:113351662-113351684 TAAGGCAGTGAATAGTGTGGGGG + Intronic
1089134250 11:116236529-116236551 AAAGACGGTGGGAAGTCTGGAGG + Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1090234615 11:125138511-125138533 AAAGGCAGTTTTTCCTCTGGGGG + Intergenic
1092632366 12:10395735-10395757 AAAGGCAGTGTGTAGTCTGGAGG + Intronic
1093208878 12:16283850-16283872 AAAGGAAGTTTGCAGTCTGCTGG - Intergenic
1095866446 12:46977995-46978017 TAAGGCTGTTTGTTGTCTGGGGG + Intergenic
1098394750 12:70005903-70005925 AAGGGCAGTATGCAGTCTGGTGG - Intergenic
1098467523 12:70804734-70804756 GAAGTCAGTGGGTAGTGTGGTGG - Intronic
1106256510 13:28026977-28026999 AAAGGCACCGTGAAGTCTGTGGG - Intronic
1106953272 13:34907928-34907950 AAAGGGCTTGTGTAGTCTAGAGG - Intergenic
1107518945 13:41160237-41160259 AAAGGGGGTTTGTTGTCTGGCGG - Intergenic
1108814020 13:54268404-54268426 AAAGGGAGTTTGTTCTCTGGCGG - Intergenic
1109349824 13:61164763-61164785 AAAGGCAGAATTTGGTCTGGAGG - Intergenic
1109725400 13:66334220-66334242 AAAGGCAGAGTGCAGAATGGTGG - Intronic
1112417378 13:99214815-99214837 AAAGGCTGTTTGTAGACTGTGGG + Intronic
1112900157 13:104348259-104348281 AAAGGTAGTGTGCAGTATGCTGG + Intergenic
1113862552 13:113498461-113498483 AAAGGCAGCGGATCGTCTGGAGG + Exonic
1116876585 14:50118372-50118394 AAAGGCAGTCTGTACAATGGGGG + Exonic
1116895468 14:50311797-50311819 AAAGGCAGTGTATAGAGTAGAGG - Intronic
1117956657 14:61128481-61128503 ACTGGCAGTGTGGAGACTGGAGG - Intergenic
1118489794 14:66247869-66247891 GAAGGCAGTGTGAAATCAGGGGG - Intergenic
1119291525 14:73499151-73499173 AAAGGCAGTGTTGAGTGGGGAGG + Intronic
1119662755 14:76463328-76463350 AAAGGCAGTGTAAAGTCTGGTGG + Intronic
1120050824 14:79863762-79863784 AAATGAAGTGTGTCCTCTGGAGG + Intronic
1121242831 14:92442294-92442316 AGAGGCAGTAAGTAGACTGGTGG + Intronic
1123994352 15:25707927-25707949 AAGGGCAGTGTGGAGTTTGCAGG - Intronic
1125905544 15:43388512-43388534 CAAGGCAGTTTCTAGTCTAGAGG + Intronic
1128303305 15:66580977-66580999 TAAGGCAGTGTGAAGAATGGGGG - Intergenic
1128463779 15:67891538-67891560 AAAGGCAGTGTACAGCCAGGAGG + Intergenic
1130746654 15:86661315-86661337 AAAGGCAATTTTTAGACTGGAGG + Intronic
1131739010 15:95366266-95366288 AAAGGAAGGGGGTAGGCTGGGGG + Intergenic
1132364098 15:101243529-101243551 AAAGCCAGTGTGGAGGCTGTGGG - Intronic
1133157400 16:3884779-3884801 GAAGGCAGAATGTGGTCTGGTGG + Intergenic
1133446882 16:5868854-5868876 AACGGCAGTGTTTCCTCTGGTGG + Intergenic
1134357792 16:13500589-13500611 AAAGACAGAGTGGAGTGTGGGGG + Intergenic
1134390641 16:13816857-13816879 GAAGGGAGTGTGTTGTGTGGAGG - Intergenic
1137891260 16:52164763-52164785 AAAGGTAGTGAGGGGTCTGGAGG + Intergenic
1139377518 16:66509363-66509385 AAAAGAAGTGTGTAGTGGGGTGG - Exonic
1141952525 16:87348134-87348156 AGAGGCAGTGGGTGGGCTGGGGG - Intronic
1142783693 17:2202953-2202975 AAAGCCAGGGTGTCCTCTGGAGG - Intronic
1147131713 17:38413497-38413519 GAATGCATTGTGGAGTCTGGCGG + Intergenic
1147290121 17:39435276-39435298 AAAGGTAGTGGGTACTCTCGAGG + Intronic
1147948273 17:44092723-44092745 AAAGGCAGTTTGTAGGAGGGAGG + Exonic
1148074285 17:44926656-44926678 AGAGGCAGTGTGTAGGGTTGGGG + Intronic
1152590488 17:81209159-81209181 AAAGGCAGTGGGTGGTCAGAGGG + Intronic
1154161149 18:11981572-11981594 ACAGGGAGTGTGGAGCCTGGCGG + Exonic
1156194196 18:34754801-34754823 AAAGGCATTGTGTGCTGTGGAGG + Intronic
1156365426 18:36421824-36421846 ATAGGCAGTCTATAGTGTGGGGG + Intronic
1158916362 18:62135436-62135458 AAAGCCACTGTGTCCTCTGGGGG - Intronic
1160043324 18:75365275-75365297 AGGTGCAGTGTGCAGTCTGGAGG + Intergenic
1162003209 19:7761085-7761107 CAGGGCAGGATGTAGTCTGGTGG + Intergenic
1165017383 19:32890883-32890905 CAGGGCAGGATGTAGTCTGGTGG - Intronic
1165461993 19:35949397-35949419 AGAGGCAGTGGGTGGTCAGGGGG + Intergenic
1168645436 19:58056322-58056344 AGAGGCAGTGTGGAGTCAGGTGG - Intergenic
925044409 2:761092-761114 AAAAGCAGTGATTAATCTGGGGG - Intergenic
925262413 2:2540108-2540130 AAAGGCAGTGAGTTTTCTTGAGG - Intergenic
928138629 2:28708362-28708384 AAAGGCAGTTTGTTGTCTGTTGG - Intergenic
933217015 2:79642695-79642717 CATGGCAGAGTGTATTCTGGTGG + Intronic
936032285 2:109081951-109081973 AAATGCAGTGAGCAGTGTGGAGG - Intergenic
936743184 2:115540018-115540040 AAAGAGAGTGTATAGTGTGGGGG + Intronic
936883011 2:117279015-117279037 AAAGGGAGTTTGTTCTCTGGCGG - Intergenic
937681583 2:124650275-124650297 ACAAGCAGTGTCTAGTCTGGAGG - Intronic
938894743 2:135738848-135738870 AAAGGCAGAGTGTGGGGTGGTGG - Intergenic
939233054 2:139455124-139455146 CAGGGCAGTGTATAGTCTGTTGG + Intergenic
939682052 2:145148542-145148564 GAAGGCAATGTGTAGACTGAGGG - Intergenic
939837679 2:147150406-147150428 AAATGGAGTCTGCAGTCTGGAGG + Intergenic
940017243 2:149120067-149120089 GAAGGCAGGGTATAGTCTTGGGG + Intronic
941635830 2:167934046-167934068 AAAAGCAGTTTGGAGTCGGGAGG + Intergenic
944203604 2:197134650-197134672 TTAGGAAGTGTGTAGTCTAGTGG - Intronic
944513937 2:200492143-200492165 AACCTCAGTGTGGAGTCTGGTGG - Intronic
946588408 2:221216451-221216473 AAGCGTAGTGTGTAGTTTGGGGG - Intergenic
946962178 2:224997154-224997176 AAAGGCAGTGTTGAATTTGGTGG - Intronic
1170428016 20:16255067-16255089 AAAGGCAGAGAATAGTTTGGTGG + Intergenic
1174499736 20:50975793-50975815 AAGGGCAGAGTGTAGTGTGCAGG - Intergenic
1175286589 20:57840803-57840825 AAAGACTGTGTGTAGCCCGGGGG - Intergenic
1178571022 21:33737327-33737349 AAAGACAGGGAGAAGTCTGGGGG - Intronic
1178759205 21:35384543-35384565 AAAGACAGTGTAGAGTTTGGTGG - Intronic
1179170423 21:38968815-38968837 AGAGGCACTGGGTTGTCTGGGGG + Intergenic
1180901631 22:19377232-19377254 TCAGGGAGTGTGTAGGCTGGTGG - Intronic
1182302725 22:29346768-29346790 AAAGGCAGTCTGGAGGCAGGTGG + Intronic
1183044776 22:35211032-35211054 CATGGCAATGTGTAGCCTGGAGG - Intergenic
1183851544 22:40593128-40593150 AAAGGCAGGGTGGAGACTGGCGG - Intronic
1183927401 22:41216102-41216124 AGAGGCTATGTGTAGCCTGGCGG - Intronic
1184720501 22:46309735-46309757 AAGGGCAGTGTGTGGCGTGGCGG - Intronic
950669880 3:14519626-14519648 AGAGGAAGTGGGTGGTCTGGGGG - Intronic
951333949 3:21398870-21398892 CAAGACAGTGTGAAGTCTGTTGG - Intergenic
953168020 3:40482514-40482536 CAAAGCAGAGTGTAGTCTGAGGG + Intronic
953489009 3:43331850-43331872 AATAGCAGTGTGTTGTCTGTTGG + Intronic
954128730 3:48548865-48548887 AAAGGCAGTCTCCAGTCTGAAGG + Intronic
954499178 3:50994002-50994024 AATGGCAGTGAGGAGTCTGCAGG + Intronic
957790188 3:84930615-84930637 AAAGGCAGAGAGTAGAATGGTGG - Intergenic
958631742 3:96693183-96693205 AAGGGTAGTGTGGAGTATGGGGG - Intergenic
961084960 3:124059066-124059088 AAAGGAATTGTGTAGTGTGGAGG + Intergenic
961863134 3:129933916-129933938 AAAGGCTGGGTGTGTTCTGGAGG + Intergenic
963764489 3:149320097-149320119 AAAGCCAGGGAGTAGGCTGGGGG - Exonic
965949026 3:174281106-174281128 ATAGCTAGTGTGTAATCTGGGGG - Exonic
967133775 3:186496234-186496256 CAAGGCAGGGTGGAGGCTGGTGG - Intergenic
967627437 3:191702891-191702913 CAGGGCAGGATGTAGTCTGGTGG - Intergenic
968612917 4:1565141-1565163 AAAGGCTGTGAGCAGTCGGGTGG - Intergenic
969855790 4:9998524-9998546 ACAAGCAGTGTGTTGTCTGCTGG + Intronic
970556874 4:17242796-17242818 TAAGGCAGTGTCTAATCTGGAGG - Intergenic
971240613 4:24885423-24885445 AAAGCCAGTGTGTTCTCTGTAGG - Intronic
971772273 4:30912149-30912171 AAAGGCAGTTTGAAGTATGGAGG + Intronic
972281941 4:37610618-37610640 AAACGCAGTGTGTTGTCTTGTGG - Intronic
972541215 4:40041132-40041154 AAAGGAAGTGTGTACTCTTGAGG - Intergenic
972736216 4:41844209-41844231 ACAGGCATTGAGTAGTCTTGTGG - Intergenic
973728391 4:53799388-53799410 AAAGCCAGTGTTTATTATGGTGG - Intronic
974766087 4:66348546-66348568 CAAGACAGGATGTAGTCTGGTGG - Intergenic
975933414 4:79554132-79554154 AAAGGGAGTTTGTTCTCTGGCGG + Intergenic
978749573 4:112231892-112231914 AAAGGCAGTGTTTACTCCAGCGG - Exonic
978924286 4:114223850-114223872 AAAGGCAGTGTGGTGTAGGGAGG - Intergenic
982537975 4:156630062-156630084 TAAGGCAGGGTGGATTCTGGTGG - Intergenic
983689194 4:170447368-170447390 AAAATTAGTGAGTAGTCTGGTGG - Intergenic
985059809 4:186066323-186066345 AAAGATAGTGTATAGTCTGTAGG - Intergenic
985384406 4:189430526-189430548 AAGGGCAGTTTGGAGGCTGGAGG - Intergenic
986750113 5:10779643-10779665 CAGGGCAGAATGTAGTCTGGTGG - Intergenic
986913184 5:12583340-12583362 AAAGGTAGTGTGTGGGGTGGTGG - Intergenic
991301723 5:65134876-65134898 AAAGGCACTGTGTAGATTGGGGG - Intergenic
992614347 5:78534725-78534747 ACAGGCAGTGTTTTGTCAGGAGG + Intronic
993338004 5:86685668-86685690 AAAAGCAGTGAGTAGAATGGTGG + Intergenic
993431845 5:87841635-87841657 TAGGGCAGGATGTAGTCTGGTGG + Intergenic
994615970 5:102105224-102105246 ATAGGCAGTGTGTTTTCTGTAGG + Intergenic
995169951 5:109096432-109096454 ACAGGCAGTATGTAATTTGGTGG + Intronic
995190059 5:109310297-109310319 GAAGGCAGTGTGGGCTCTGGAGG + Intergenic
998390944 5:141786776-141786798 AAGGGCAGTTTGTTGTTTGGAGG - Intergenic
998995850 5:147868850-147868872 AAAGGGAGTTTGTTCTCTGGCGG - Intergenic
998996027 5:147870002-147870024 AAAGGGAGTTTGTTCTCTGGTGG + Intergenic
998996706 5:147874244-147874266 AAAGGGAGTTTGTTCTCTGGCGG + Intronic
1001444649 5:171774012-171774034 GGAGGCAGTGTGTGGTTTGGTGG + Intronic
1001629692 5:173165478-173165500 AAGGGCAGTGTGGAGGCTGAAGG + Intergenic
1001761134 5:174209373-174209395 TCATGGAGTGTGTAGTCTGGCGG + Intronic
1004026808 6:11827182-11827204 CAAGGCAGGGTGTAATCTGGCGG + Intergenic
1004903333 6:20212906-20212928 AAAGGAAGTAGGGAGTCTGGTGG - Intergenic
1006866757 6:37214840-37214862 GGAGGCAGTGTGTTGTCTAGTGG + Intronic
1007171156 6:39864583-39864605 AAAGGCAGTTTGGTGTGTGGGGG - Intronic
1007683616 6:43651307-43651329 AAAGGCAGTGGGTAGGCTCTGGG + Intronic
1009440773 6:63675590-63675612 GAAGGAAGTGTGTTGTCAGGAGG + Intronic
1011771194 6:90675158-90675180 AAAGGGAGTTTGTTCTCTGGCGG + Intergenic
1013042637 6:106451081-106451103 AAAGGCAGTGTGTATGGGGGAGG + Intergenic
1015270109 6:131328949-131328971 AAAGGCGGTTTGTTCTCTGGTGG - Intergenic
1017182359 6:151565214-151565236 CAAGGCAGGGTGATGTCTGGTGG + Intronic
1019323024 7:424232-424254 AAAGGAAGTGTGTTCTCTGGGGG - Intergenic
1021948410 7:25751190-25751212 AATGGCAGTGTGTTCTCTAGTGG - Intergenic
1024311304 7:47971679-47971701 AAAGCCAGTGTGTAGTCTGCTGG + Intronic
1025158930 7:56636215-56636237 ATAAGCAGTGTGTAGTTTGTGGG - Intergenic
1026208477 7:68280162-68280184 CAAGGCAGGATGCAGTCTGGTGG - Intergenic
1026235756 7:68525747-68525769 AAATGTAGTGTGAATTCTGGAGG - Intergenic
1028492813 7:91432486-91432508 CAAGGTAGGATGTAGTCTGGCGG + Intergenic
1029225766 7:99027354-99027376 AAAGGAAGTGTGTAGGCAGCAGG - Intergenic
1030705931 7:112692882-112692904 AAAGGTAGTGGGGAGTATGGGGG - Intergenic
1033381691 7:140826895-140826917 AAATGCAGTGTGTAATCCTGAGG - Intronic
1034524857 7:151651861-151651883 AAAGGCAGCGAGTAGAATGGAGG + Intronic
1035007431 7:155676904-155676926 AAAGGGAATGTGTACTGTGGTGG - Intronic
1040732141 8:50461022-50461044 AAATGCAATGTGTATTCTGATGG - Intronic
1043689764 8:83135880-83135902 AAAGGCGGTGTATAGTCCAGAGG + Intergenic
1044892262 8:96850011-96850033 GAAGGCTGGGTGTAGTCTGATGG - Intronic
1046194787 8:110847390-110847412 GAAGGCAGTGTGTAGAATGGTGG + Intergenic
1048518430 8:135131895-135131917 GAAGGCCTTGTGTAGTTTGGGGG - Intergenic
1048899561 8:139024393-139024415 AAAGGCAGTGGATAGTCAAGGGG + Intergenic
1051104741 9:13566543-13566565 CAAGGCAGTTTGTTGTCTGGGGG - Intergenic
1052772781 9:32704824-32704846 GAAGGAACTGTGTTGTCTGGAGG - Intergenic
1056323476 9:85458587-85458609 AAAGGCGGTTTGTTCTCTGGCGG - Intergenic
1056324724 9:85466758-85466780 AAAGGCGGTTTGTTCTCTGGCGG - Intergenic
1058428934 9:104900972-104900994 AAAGGCAGTTTGTAGCCTTGTGG - Intronic
1059532818 9:115052750-115052772 AAAGGCAGTGAGGGGTCTGGTGG + Intronic
1059695611 9:116727504-116727526 AAATGCAGTGTGGGGTGTGGGGG + Intronic
1060988589 9:127835592-127835614 GAAGCCAGAGTGCAGTCTGGTGG + Intronic
1061176779 9:129002356-129002378 AAGGGAAGTGGGTGGTCTGGGGG + Intronic
1186467104 X:9792177-9792199 ACAGGGAGGGTGTATTCTGGAGG + Intronic
1187097001 X:16159593-16159615 AATGTCAGTGTTTAGGCTGGGGG + Intergenic
1189831298 X:44976215-44976237 AAAGGCAGAAAGTAGACTGGTGG - Intronic
1193684821 X:84564730-84564752 AAAGTCAGAGTGCTGTCTGGGGG - Intergenic
1195982707 X:110597031-110597053 AAAGGCAATCTGTAGAGTGGAGG - Intergenic
1197199842 X:123738792-123738814 AAAGGCAATGTGTCATCTAGTGG + Intergenic
1197643564 X:128993157-128993179 CAGGGCAGGGTGCAGTCTGGTGG + Intergenic
1197942115 X:131801430-131801452 GAAGGCACTGTGGAGGCTGGGGG + Intergenic
1198929505 X:141838526-141838548 CAAGACAGTGTGCAGTCTGTTGG + Intronic
1202378302 Y:24257233-24257255 GAAGGCTGTGTGGAGTGTGGGGG + Intergenic
1202492480 Y:25412888-25412910 GAAGGCTGTGTGGAGTGTGGGGG - Intergenic