ID: 1092642457

View in Genome Browser
Species Human (GRCh38)
Location 12:10530013-10530035
Sequence TTAGTCCATAACATATTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092642456_1092642457 7 Left 1092642456 12:10529983-10530005 CCATAACAAGTGTCAAATGGATT No data
Right 1092642457 12:10530013-10530035 TTAGTCCATAACATATTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092642457 Original CRISPR TTAGTCCATAACATATTTAT AGG Intergenic
No off target data available for this crispr