ID: 1092643835

View in Genome Browser
Species Human (GRCh38)
Location 12:10547631-10547653
Sequence CTCAAATAGAGGTGTTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092643835_1092643841 30 Left 1092643835 12:10547631-10547653 CCCTGGAAACACCTCTATTTGAG No data
Right 1092643841 12:10547684-10547706 ATTCCAGAACCAAACTGCCTAGG No data
1092643835_1092643839 -7 Left 1092643835 12:10547631-10547653 CCCTGGAAACACCTCTATTTGAG No data
Right 1092643839 12:10547647-10547669 ATTTGAGGTAAACTTCAACAAGG No data
1092643835_1092643840 7 Left 1092643835 12:10547631-10547653 CCCTGGAAACACCTCTATTTGAG No data
Right 1092643840 12:10547661-10547683 TCAACAAGGACTTTAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092643835 Original CRISPR CTCAAATAGAGGTGTTTCCA GGG (reversed) Intergenic
No off target data available for this crispr