ID: 1092644393

View in Genome Browser
Species Human (GRCh38)
Location 12:10553507-10553529
Sequence CCAAAACTGTTACCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092644393_1092644395 6 Left 1092644393 12:10553507-10553529 CCAGTAACAGGTAACAGTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1092644395 12:10553536-10553558 GTATCTTCAGATCTGTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092644393 Original CRISPR CCAAAACTGTTACCTGTTAC TGG (reversed) Intergenic
908337104 1:63137718-63137740 CGAAAACTGTTAACTCTTCCTGG - Intergenic
911909041 1:103608561-103608583 GCTAAATTATTACCTGTTACTGG + Intergenic
911913878 1:103670900-103670922 GCTAAATTATTACCTGTTACTGG - Intronic
916203851 1:162296891-162296913 CAAAAACTGTCCACTGTTACTGG + Intronic
917732995 1:177894984-177895006 CCAACAATGGTGCCTGTTACTGG + Intergenic
918740337 1:188122765-188122787 CCAATTCTTTTACATGTTACAGG - Intergenic
918933430 1:190887647-190887669 CCAAATCTGTTACCTACTAATGG + Intergenic
919993420 1:202725794-202725816 CCAATTCTGTCTCCTGTTACAGG + Exonic
920384382 1:205558483-205558505 GCAATCTTGTTACCTGTTACTGG - Intergenic
923483326 1:234405050-234405072 CCAAGACTTCTACATGTTACTGG + Intronic
1068488357 10:57688980-57689002 CGGAAACTTTTACCTGTTACTGG - Intergenic
1069433044 10:68354458-68354480 CAAAAAGTGTTACATGATACTGG - Intronic
1072997257 10:100256380-100256402 CTAAAACTATAACCTGGTACTGG + Exonic
1074869465 10:117565360-117565382 CCAAAACTGATGCCTGGGACAGG - Intergenic
1076091172 10:127687004-127687026 CCAAAACAGTCTCCTGTTAGTGG - Intergenic
1084147614 11:67273425-67273447 CCAACACTGCTCCCTGATACTGG - Intronic
1087933571 11:104005582-104005604 CCAGAAATGTTAGCTGTTATTGG - Intronic
1088112568 11:106278627-106278649 CCAAAAGTGTTAGCTAATACAGG + Intergenic
1088401173 11:109423519-109423541 CCAAAACTGCTCCCTGTAGCGGG - Exonic
1091588137 12:1827644-1827666 CCACAACTGTCACCTGTCCCTGG - Intronic
1092265825 12:6979712-6979734 CCCAAAGTGTTTCCTGTTTCAGG + Intronic
1092644393 12:10553507-10553529 CCAAAACTGTTACCTGTTACTGG - Intergenic
1095280523 12:40347084-40347106 CTAAAACTGCTACCTTTTTCAGG - Intronic
1097425336 12:59437207-59437229 CAAAAATTTTAACCTGTTACTGG - Intergenic
1097616160 12:61886734-61886756 CTTATACTGTTACCTCTTACAGG + Intronic
1098071662 12:66682286-66682308 CCTTAACTGTCACCTGTTTCTGG - Intronic
1098568441 12:71961557-71961579 CCAAGACTGTTAGCTGCTATTGG + Intronic
1099967247 12:89461776-89461798 CCAAAACCGTTATCTCTTCCTGG + Intronic
1101165355 12:102024593-102024615 CCAAGCCTTTTACCTGCTACTGG - Intronic
1102831506 12:116005928-116005950 CCAAATCTGTTACCTGTGTAAGG + Exonic
1103490516 12:121315097-121315119 CCAAACTTATTACCTGTAACAGG - Intronic
1103750984 12:123160641-123160663 TCAAAACTTTTAGCTTTTACGGG - Intronic
1105718091 13:23086822-23086844 GCTAAACTATTACCTGTGACTGG - Intergenic
1112784249 13:102934382-102934404 CCAAAACTATTACAGATTACAGG - Intergenic
1113257362 13:108521477-108521499 CCAAAACAGCTATCTGTTAGAGG + Intergenic
1114258699 14:21022851-21022873 CCCACACTGTTACCTGTCCCTGG + Exonic
1114499382 14:23156730-23156752 CCAAAACAGTTTCCTGTTTCAGG + Intronic
1114844760 14:26308180-26308202 CCCAAATTGTTACCTTTTATAGG - Intergenic
1127729934 15:61790424-61790446 CCAAAACTGTTTTTTGTCACTGG + Intergenic
1132322205 15:100933920-100933942 CCAAAACTCTTTCCTGTTCTTGG + Intronic
1133993181 16:10726659-10726681 CCCAAACTGATGCCAGTTACAGG + Intergenic
1142421993 16:89976932-89976954 CAAAAACTTTTACCTCTTGCTGG + Intergenic
1149244596 17:54690640-54690662 CCAATTCTGTTACCTTTTACTGG + Intergenic
1153185795 18:2484842-2484864 TCTATACTGTTAACTGTTACTGG - Intergenic
1153641135 18:7158170-7158192 GCAAAACTGTCACCTTTTAAAGG - Intergenic
1155653660 18:28171496-28171518 CCAAAATTGTTTACTTTTACTGG + Intronic
1155917094 18:31567711-31567733 GCAATACTGATACCTGTTAAAGG + Intergenic
1158781075 18:60652606-60652628 ACAAAAATGTTACCTTTTATAGG + Intergenic
1160164271 18:76496101-76496123 CCAAAACGCTCTCCTGTTACAGG + Intronic
1163260710 19:16188201-16188223 CCAAACCTGTTACCTTCCACTGG - Intronic
1164086945 19:21911635-21911657 TCCTACCTGTTACCTGTTACTGG + Intergenic
1164120205 19:22259113-22259135 TCCTACCTGTTACCTGTTACTGG - Intergenic
1164172705 19:22739363-22739385 TCCTACCTGTTACCTGTTACTGG - Intergenic
1164180061 19:22810513-22810535 TCCTACCTGTTACCTGTTACTGG + Intergenic
925871595 2:8276467-8276489 CCAAAGCTCTTACCTGTAAATGG + Intergenic
931304400 2:61014523-61014545 GCAAATCTGTCTCCTGTTACCGG + Intronic
932210440 2:69924072-69924094 CCAGAACTTGTACATGTTACTGG + Intronic
934968688 2:98745437-98745459 CCAAAACTGTTACCGCTTTTTGG + Intergenic
939365374 2:141223651-141223673 CCAAAACTGGTACATGGTACTGG + Intronic
942700825 2:178707901-178707923 GCAACAGTGTTACCTGTTAGAGG - Intronic
943208849 2:184936435-184936457 TCAAAACTGTTACCACTAACAGG - Exonic
944456122 2:199896522-199896544 GAAGAACTGTTACCTGTAACAGG - Intergenic
947418722 2:229922573-229922595 CAAAGACTATTACCAGTTACTGG + Exonic
1169738197 20:8860510-8860532 ATAAAACTGTTACCTCTTAAAGG - Intronic
1184623749 22:45705412-45705434 TCAAACCTGTTACTTGTTACAGG + Intronic
949566589 3:5251048-5251070 CCACAACTGTTTCCTGGTGCTGG + Intergenic
952113914 3:30157090-30157112 CAAAAACTGTTATCTGTAATGGG + Intergenic
952350406 3:32530694-32530716 CCAAAACTGTAGCTAGTTACTGG - Intronic
958114280 3:89195352-89195374 CTAAATCTGTTAGCTGTTAATGG - Intronic
961273592 3:125709185-125709207 CCACAACTGTCACCTGTATCAGG + Intergenic
961724164 3:128915106-128915128 CCTTGCCTGTTACCTGTTACAGG + Exonic
962487571 3:135860182-135860204 CCTAAACTATTACCTGTATCCGG + Intergenic
966254761 3:177905156-177905178 CCTTAATTGTTGCCTGTTACAGG + Intergenic
966587182 3:181639762-181639784 CCAATACTGATACCTGTGAGTGG - Intergenic
966697689 3:182809084-182809106 CCAAAACTGTTCCCTCCTATAGG + Intronic
968615892 4:1577648-1577670 CCAACATTGTTAATTGTTACCGG - Intergenic
974865693 4:67578423-67578445 CTCTAACTTTTACCTGTTACTGG - Intronic
978100051 4:104827909-104827931 CCAAAATTGTTTCCCTTTACTGG + Intergenic
982703689 4:158684607-158684629 CCAAATCTGTCTTCTGTTACAGG - Exonic
983662298 4:170141691-170141713 CCAAAACTGTTACCTAATGCAGG - Intergenic
984693848 4:182759145-182759167 CCAATACTGTGACATGTTAATGG - Intronic
986012670 5:3730452-3730474 CCAAAACTGTGACATGTAAGTGG - Intergenic
993792373 5:92223384-92223406 TCAACACTGTTACCAGTTGCTGG + Intergenic
994240428 5:97413253-97413275 GCAAAACTGTCAACTGTTTCAGG + Intergenic
997681645 5:135760444-135760466 CCCAAACTGATGCCAGTTACAGG + Intergenic
1000789289 5:165585714-165585736 CCAGCACTGTTGGCTGTTACAGG - Intergenic
1005884977 6:30090755-30090777 GCAAAGCTGTTACCTGTGCCTGG + Intergenic
1010337848 6:74709544-74709566 CAAAAACTTTTAACTCTTACAGG + Intergenic
1010871008 6:81039366-81039388 CTGATTCTGTTACCTGTTACTGG - Intergenic
1017202834 6:151774428-151774450 CAGAAACTGTTACCTGTTCTTGG - Intronic
1024601116 7:50982566-50982588 CCAAAGCTGTTACCTGAACCAGG + Intergenic
1024626149 7:51209905-51209927 CCAAACCTGTCACCAGTTATTGG - Intronic
1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG + Intronic
1028978283 7:96938459-96938481 CCAAAACTGTTTCCTGTTTATGG + Intergenic
1035759189 8:2056783-2056805 TCAAAACTGTTAGGTGCTACTGG - Intronic
1039504944 8:38045005-38045027 CCAAAAATGCTTCCTGTTCCCGG + Intronic
1039768694 8:40660609-40660631 CCAAAACTGCTACCTGAAAATGG - Intronic
1040603458 8:48907138-48907160 CCAAAATTTTTGCCTGTGACTGG - Intergenic
1041367417 8:57123237-57123259 CTAGAAGTGTTAGCTGTTACAGG - Intergenic
1041990076 8:63977013-63977035 CCAAAAATATAACCTTTTACGGG + Intergenic
1042911297 8:73829683-73829705 CCAAAACTGTTTCCTCTGAAAGG + Intronic
1045230081 8:100296702-100296724 CAGAAACTGTTAACTTTTACTGG - Intronic
1045834259 8:106501737-106501759 CCACATCTGTTTCCTGTTGCAGG + Intronic
1058145927 9:101411480-101411502 CAAGAACTGTTCACTGTTACTGG - Intergenic
1188106285 X:26151571-26151593 CCAAAAGTGTTACCTGTAACAGG + Intergenic
1189251621 X:39604688-39604710 CCAAAACTGTTTCCTCTTCCTGG + Intergenic
1191975568 X:66867411-66867433 CCAAAACTGTGCCATGTTCCAGG + Intergenic
1193285527 X:79710096-79710118 TCAAAACTGATCCATGTTACGGG + Intergenic
1195418696 X:104648705-104648727 TCAAAAGTGTTATGTGTTACAGG - Intronic
1197902562 X:131389845-131389867 CCAAAGCTGTCTCCTGTTAGTGG + Intronic
1200386111 X:155892545-155892567 CAATAGCTGTTACCTTTTACTGG + Intronic