ID: 1092644442

View in Genome Browser
Species Human (GRCh38)
Location 12:10554426-10554448
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092644442_1092644448 29 Left 1092644442 12:10554426-10554448 CCCCTCCTCTCTTGTGGCTTGTT No data
Right 1092644448 12:10554478-10554500 ATAGAAATTCTAGTTTATCTTGG No data
1092644442_1092644446 1 Left 1092644442 12:10554426-10554448 CCCCTCCTCTCTTGTGGCTTGTT No data
Right 1092644446 12:10554450-10554472 CGTGAAAATAACGACAGTGTTGG No data
1092644442_1092644447 2 Left 1092644442 12:10554426-10554448 CCCCTCCTCTCTTGTGGCTTGTT No data
Right 1092644447 12:10554451-10554473 GTGAAAATAACGACAGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092644442 Original CRISPR AACAAGCCACAAGAGAGGAG GGG (reversed) Intergenic
No off target data available for this crispr