ID: 1092644445

View in Genome Browser
Species Human (GRCh38)
Location 12:10554431-10554453
Sequence CACGTAACAAGCCACAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092644445_1092644447 -3 Left 1092644445 12:10554431-10554453 CCTCTCTTGTGGCTTGTTACGTG No data
Right 1092644447 12:10554451-10554473 GTGAAAATAACGACAGTGTTGGG No data
1092644445_1092644448 24 Left 1092644445 12:10554431-10554453 CCTCTCTTGTGGCTTGTTACGTG No data
Right 1092644448 12:10554478-10554500 ATAGAAATTCTAGTTTATCTTGG No data
1092644445_1092644446 -4 Left 1092644445 12:10554431-10554453 CCTCTCTTGTGGCTTGTTACGTG No data
Right 1092644446 12:10554450-10554472 CGTGAAAATAACGACAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092644445 Original CRISPR CACGTAACAAGCCACAAGAG AGG (reversed) Intergenic
No off target data available for this crispr