ID: 1092644446

View in Genome Browser
Species Human (GRCh38)
Location 12:10554450-10554472
Sequence CGTGAAAATAACGACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092644445_1092644446 -4 Left 1092644445 12:10554431-10554453 CCTCTCTTGTGGCTTGTTACGTG No data
Right 1092644446 12:10554450-10554472 CGTGAAAATAACGACAGTGTTGG No data
1092644442_1092644446 1 Left 1092644442 12:10554426-10554448 CCCCTCCTCTCTTGTGGCTTGTT No data
Right 1092644446 12:10554450-10554472 CGTGAAAATAACGACAGTGTTGG No data
1092644444_1092644446 -1 Left 1092644444 12:10554428-10554450 CCTCCTCTCTTGTGGCTTGTTAC No data
Right 1092644446 12:10554450-10554472 CGTGAAAATAACGACAGTGTTGG No data
1092644443_1092644446 0 Left 1092644443 12:10554427-10554449 CCCTCCTCTCTTGTGGCTTGTTA No data
Right 1092644446 12:10554450-10554472 CGTGAAAATAACGACAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092644446 Original CRISPR CGTGAAAATAACGACAGTGT TGG Intergenic
No off target data available for this crispr