ID: 1092645536

View in Genome Browser
Species Human (GRCh38)
Location 12:10567453-10567475
Sequence GTCCAACAGTAGTGGCACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092645533_1092645536 -1 Left 1092645533 12:10567431-10567453 CCTTATTTGCTGAAACAGTAGTG No data
Right 1092645536 12:10567453-10567475 GTCCAACAGTAGTGGCACTAGGG No data
1092645532_1092645536 24 Left 1092645532 12:10567406-10567428 CCTGTGTTCTTTGTCTTATATGT No data
Right 1092645536 12:10567453-10567475 GTCCAACAGTAGTGGCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092645536 Original CRISPR GTCCAACAGTAGTGGCACTA GGG Intergenic
No off target data available for this crispr