ID: 1092648311

View in Genome Browser
Species Human (GRCh38)
Location 12:10604103-10604125
Sequence ATATGGAAAAGACTGTGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092648307_1092648311 7 Left 1092648307 12:10604073-10604095 CCAATTCAACAAACTTAAAAAAC 0: 1
1: 0
2: 2
3: 41
4: 522
Right 1092648311 12:10604103-10604125 ATATGGAAAAGACTGTGCTAGGG 0: 1
1: 0
2: 0
3: 29
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092648311 Original CRISPR ATATGGAAAAGACTGTGCTA GGG Intergenic
900664690 1:3806950-3806972 ATTCAGAAAAGACTGTGCTATGG + Intergenic
900963216 1:5939220-5939242 ATAATGAAAAAACTGTGGTATGG + Intronic
903497985 1:23783928-23783950 ATATTGAAAAAACTTTACTATGG - Intronic
907167282 1:52424861-52424883 ATATGGGAAAGATGGTGATAAGG - Intronic
908320354 1:62972507-62972529 ACTTGGCAGAGACTGTGCTAGGG + Intergenic
908439282 1:64137235-64137257 ATATACAAAAGACTGGGCTAAGG - Intronic
909644411 1:77900335-77900357 ACATGGAAAAGACTATGGTATGG - Intronic
910976379 1:92910746-92910768 ATATGGGGAAAACTGTGCAAAGG - Intronic
911151035 1:94596863-94596885 ATGTGGAGAATGCTGTGCTATGG - Intergenic
911834296 1:102596592-102596614 ATTTGCAAAAGACTGGGATATGG + Intergenic
912396330 1:109347042-109347064 ATATGCTAAACACTGTTCTAAGG - Intronic
912956566 1:114157762-114157784 ATTTGGAATAAACTGTACTATGG + Intergenic
913157516 1:116114587-116114609 TTGTGCAAAATACTGTGCTACGG + Intronic
913344484 1:117794439-117794461 ACATGGAAATGACTGGGCTCAGG - Intergenic
916512573 1:165485684-165485706 ATTTCGAAAAGACTTTGCAATGG + Intergenic
916570002 1:166016904-166016926 ATATGGGTAAGACCGTGCTGTGG + Intergenic
917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG + Intronic
918070114 1:181128506-181128528 CTATGGAACAGGCTGTGCCAAGG - Intergenic
918264199 1:182825250-182825272 AAGTAGAAAAGACTGTGCAAGGG + Intronic
918738188 1:188093658-188093680 ATATGGGAAAGAAGGTTCTAGGG + Intergenic
918843912 1:189583805-189583827 AAATGGGAAAGACTCGGCTAAGG - Intergenic
920169510 1:204062426-204062448 AAATTTAAAAGACTGAGCTATGG + Intergenic
920957402 1:210632144-210632166 GCATGGAAAAGAGTGTGTTACGG + Intronic
921507097 1:215984990-215985012 ATCTAAAAAAGACTGTGCTTGGG + Intronic
921664100 1:217845927-217845949 AGATGGAAAAGAGTGTTTTAGGG + Intronic
921712629 1:218387968-218387990 ACATGGAAATGACTGTGATCTGG + Intronic
923229459 1:231970936-231970958 CTAAGGAAGAGACTGAGCTAAGG + Intronic
923981724 1:239332021-239332043 ATTTGCAAAAGACAGTGATATGG + Intergenic
924623319 1:245680907-245680929 ATATGAAAAACACAGTGCTAAGG - Intronic
1064125190 10:12653348-12653370 ATAAGGACAACTCTGTGCTATGG - Intronic
1064239895 10:13617300-13617322 ATATGGTAATGACTGTTCTCTGG - Intronic
1064286976 10:14000151-14000173 ATATAGAAGAAACTGTGCAATGG - Intronic
1064395229 10:14976196-14976218 ATATGGAAAATAATGTCCCAGGG - Intronic
1065288316 10:24206524-24206546 ATATGGAATAGTCGGTGCAAGGG + Intronic
1065453500 10:25882591-25882613 ATATGGAAAAAAGTGTTCCAGGG - Intergenic
1066584420 10:36916756-36916778 ATGTGCAAGACACTGTGCTAGGG + Intergenic
1066667176 10:37795534-37795556 ATATGGAAAAGACTTTTATAAGG - Intronic
1067013462 10:42736927-42736949 AAATGGAAAGGACTGAGCTGTGG + Intergenic
1067310317 10:45106823-45106845 AAATGGAAAGGACTGAGCTGTGG - Intergenic
1068295469 10:55065997-55066019 TTATGGAAAATACTGTGTTTGGG - Intronic
1068704406 10:60057489-60057511 ATAAAGAATAGAGTGTGCTATGG - Intronic
1069280972 10:66652984-66653006 ATATGGAATTTACTGTGTTAAGG - Intronic
1070078398 10:73160859-73160881 AAATGGAAAAGTATGTGCAAAGG + Intronic
1072728981 10:97832074-97832096 AGATGGGAAAGACCCTGCTAGGG + Intergenic
1073846625 10:107563336-107563358 ATATATAAAAGGCTGTGCTATGG + Intergenic
1075339489 10:121634414-121634436 ATATGCAAAACAGTGTGGTATGG + Intergenic
1076020384 10:127067387-127067409 AGATGGAACAGACTATGCCAAGG - Intronic
1077576553 11:3387684-3387706 ATATGGAAAATAATGTCCCAGGG - Intergenic
1079537243 11:21528969-21528991 TCAGGGAAAAGACTGTGCTCAGG - Intronic
1079568878 11:21917606-21917628 ATCCAGAAAAGACAGTGCTATGG + Intergenic
1079871036 11:25798226-25798248 ATATGTATAAGACTTTGATACGG - Intergenic
1080119474 11:28660711-28660733 ATATGGCAAACACTGTTCAAGGG - Intergenic
1080752617 11:35164994-35165016 GTCTGGAAAATACTGTGGTAGGG - Intronic
1081101711 11:39010277-39010299 ATATTGAATTGACTTTGCTAAGG + Intergenic
1081329185 11:41783339-41783361 ATATGGAACAGCCTATGCAAAGG - Intergenic
1082099174 11:48157695-48157717 ATATGTAAGATCCTGTGCTAGGG + Intronic
1082235301 11:49815830-49815852 ATATGGAAAATACTGTCCCAGGG - Intergenic
1082608986 11:55276800-55276822 ATATGGAAAATAATGTCCCAGGG - Intergenic
1082652617 11:55812219-55812241 AAATGGAAAGGACTGTTCCATGG - Exonic
1084228489 11:67732468-67732490 ATATGGAAAATAATGTCCCAGGG - Intergenic
1084324631 11:68392782-68392804 ATCTGGAAAACACAATGCTATGG - Intronic
1084373925 11:68763484-68763506 ATCTGGGAGAGACTGTGCTGGGG + Intronic
1084846780 11:71907224-71907246 ATATGGAAAATAATGTCCCAGGG + Intronic
1085089092 11:73694453-73694475 ATATGGAAAGCACTGTGAAAGGG + Intronic
1086701561 11:89905451-89905473 ATATGGAAAATAATGTCCCAGGG + Intergenic
1086704606 11:89939074-89939096 ATATGGAAAATAATGTCCCAGGG - Intergenic
1086890769 11:92255429-92255451 CTGTGGCAAGGACTGTGCTAGGG - Intergenic
1087417716 11:97879065-97879087 AAATTGAAAAGACAGTGTTATGG - Intergenic
1088535522 11:110856438-110856460 GTCTATAAAAGACTGTGCTATGG + Intergenic
1090543290 11:127732723-127732745 ATATGGAAAATAGCCTGCTAAGG - Intergenic
1090604487 11:128407191-128407213 ATATGGAAAAGCATGTGTCATGG + Intergenic
1091135597 11:133186202-133186224 ATATGCAAAAGAATCTGCTGTGG + Intronic
1091152226 11:133339463-133339485 ATAGTGAAAAGACTGTGTTTGGG - Intronic
1092433160 12:8424689-8424711 ATATGGAAAATAATGTCCCAGGG - Intergenic
1092648311 12:10604103-10604125 ATATGGAAAAGACTGTGCTAGGG + Intergenic
1094216327 12:27946661-27946683 ATATGGAAAAAATTGAGCAAAGG + Intergenic
1098526544 12:71493425-71493447 ATTTGGAAAATATTTTGCTATGG + Intronic
1099289340 12:80756206-80756228 ATATGGAAAAGCATCTTCTAGGG - Intergenic
1100622840 12:96296404-96296426 ATATGGATAACACATTGCTAAGG - Intronic
1101525359 12:105523526-105523548 ATATGGAGAATATGGTGCTAAGG + Intergenic
1104097591 12:125572203-125572225 ACATGGAAAACAGGGTGCTATGG + Intronic
1107076149 13:36322981-36323003 AAATGGAAAAGTTTTTGCTAGGG + Intronic
1107207253 13:37807615-37807637 CTATAGAAAAGGCTGTGCTCTGG + Intronic
1108894645 13:55310075-55310097 ATATGGGAAAAACTGGGCAAGGG - Intergenic
1109339675 13:61039839-61039861 AAATGAAAAAGACTGTACGAAGG - Intergenic
1109660283 13:65449689-65449711 ATATGGAGGACATTGTGCTAAGG + Intergenic
1110099869 13:71585340-71585362 ATAAGGTAAAGACTTTGCTGAGG + Intronic
1112315215 13:98355424-98355446 ATATGGAAATGTATGTACTAAGG + Intronic
1113241083 13:108337892-108337914 GTAAGTAAAACACTGTGCTAAGG - Intergenic
1114838590 14:26234408-26234430 TTAGGGAACAGGCTGTGCTATGG - Intergenic
1115437339 14:33390096-33390118 AGATGGGAAGGATTGTGCTAAGG + Intronic
1117127020 14:52640089-52640111 ATATGCCAAAAACTATGCTATGG + Exonic
1121658367 14:95615464-95615486 CTATGGAAAGGTCTGTGCTTGGG - Intergenic
1122197106 14:100096523-100096545 AAATGGAGAAGAATGTGATATGG - Intronic
1125220763 15:37331777-37331799 AAATTGAAAAGACTGTTTTAAGG - Intergenic
1126525517 15:49649963-49649985 AGATGGAAAAGCCTGTGATAAGG + Exonic
1128645556 15:69376381-69376403 CTATGCAAAACACTTTGCTAAGG + Intronic
1130106168 15:80930191-80930213 ACATGGAAAAGACTTTGCAAAGG + Intronic
1130413307 15:83665435-83665457 ATACGGAATACACTCTGCTAAGG - Intronic
1131206361 15:90451709-90451731 TCAGGGAAAAGACAGTGCTATGG - Intronic
1132160478 15:99536899-99536921 AAATGGAAAAGGCTGTGATCTGG + Intergenic
1132470469 16:100033-100055 AAATGCAAAAGACTGGGGTAGGG + Intronic
1133770056 16:8862669-8862691 ATAGGGAACAGCCTGTGCAAAGG + Intronic
1133976127 16:10600937-10600959 ATTTGAAAAACACTGAGCTAAGG - Intergenic
1134093773 16:11405524-11405546 AGATGGAAGAGCCTGTGCAAAGG + Intronic
1135420822 16:22304573-22304595 ATAGGGAAAAGCATGTGCAAAGG + Intronic
1137870989 16:51950179-51950201 ACATGGAAAAGCCTAGGCTATGG - Intergenic
1137905816 16:52320864-52320886 ACATGTAAAAGCATGTGCTAAGG - Intergenic
1138781039 16:59786725-59786747 ATCTGCAAAAGAGTGTGCTGGGG + Intergenic
1138859395 16:60737103-60737125 ACATGGTAAACACTGTGATAGGG - Intergenic
1139085450 16:63579802-63579824 AGAAGGAAAAGTCTGTGCAAAGG + Intergenic
1139664046 16:68443830-68443852 ATAGGGAAAAAACAGTGGTAAGG + Intronic
1140122700 16:72097307-72097329 ATAGAGAAAGGACAGTGCTATGG + Intronic
1140446195 16:75030318-75030340 ATATGGAAAAGAATGTGGTTTGG + Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1144049505 17:11486477-11486499 ATATGCAAAGTACTATGCTAAGG + Intronic
1146425001 17:32729681-32729703 ATATGGAAAAGACAGTCATAAGG + Intronic
1146876823 17:36420489-36420511 ATATTAATAAGACTGTGGTAAGG - Intronic
1149204915 17:54232962-54232984 ATATGAATAAGTCTCTGCTAGGG + Intergenic
1149608985 17:57945668-57945690 ATATGCAAAACATTGTGCTAGGG + Intronic
1150314626 17:64158156-64158178 AAAGGGAAGAGACTTTGCTAGGG + Intronic
1151525528 17:74663873-74663895 ATATTGAAAAGACTGTGCAGAGG + Intergenic
1156671241 18:39472634-39472656 ATGTGGAAAAGACTTTGTCATGG + Intergenic
1160085599 18:75774439-75774461 ATTTGGAAAAGAAAATGCTAAGG + Intergenic
1160575748 18:79852906-79852928 AAATGACAAAGACTCTGCTAAGG - Intergenic
1160729998 19:637363-637385 ATATGGAGAAGATTGTCCTGGGG - Intergenic
1161573856 19:5044805-5044827 TTCTGGAAAAGGCTGAGCTATGG - Intronic
1163259923 19:16182849-16182871 ACCTGGAAAAGACTGTGCAGAGG - Intergenic
1163298678 19:16429602-16429624 ATAGGGACAAGACTGGGATAGGG - Intronic
1165461841 19:35948533-35948555 AAATGGAAGAGCCTGTGCTGAGG + Intergenic
1166443481 19:42837355-42837377 TTATGGAAAAGACTCTGACAAGG - Intronic
1166463175 19:43008015-43008037 TTATGGAAAAGACTATGAAAAGG - Exonic
1166480445 19:43168108-43168130 TTATGGAAAAGACTCTGACAAGG - Intronic
1166618522 19:44273374-44273396 TTGTGGAAAAGACTGTGTGAAGG + Exonic
1167217473 19:48174096-48174118 ACAAGCAAAAGACAGTGCTAGGG - Intronic
926574004 2:14560463-14560485 ATAAGGGAAAGAATGTTCTAAGG - Intergenic
928784605 2:34867476-34867498 ATATGGAAACCTCTGTGATATGG + Intergenic
930002723 2:46871855-46871877 AGAAGGAAAAGACTGGGCTGAGG - Intergenic
930114317 2:47705830-47705852 ATGTGGCAAAGACAGGGCTAAGG + Intronic
931262140 2:60629659-60629681 ACATGGAAAAGAATGTGCACTGG + Intergenic
932349250 2:71019138-71019160 ATATGGAAAATAATGTCCCAGGG + Intergenic
933699529 2:85244571-85244593 AAATGGAGAAGACTGTGGGAGGG + Intronic
934896837 2:98126897-98126919 AGATGGAGCAGACTGTGCCAAGG - Intronic
935177503 2:100662656-100662678 ATATGGAATTGAATGTGTTAAGG + Intergenic
936654846 2:114473007-114473029 AGATGGAAGAGACTGTTCTTGGG + Intronic
936778640 2:116004491-116004513 ATAAGGAAAACATTGTGCAAAGG + Intergenic
936937020 2:117848426-117848448 ATTTGGAACAGAGTGTGCCAAGG + Intergenic
937384216 2:121412836-121412858 ATATGGAACAGACTTTGCTCTGG - Intronic
938226477 2:129620740-129620762 ACATGCAAAATACTGTTCTATGG - Intergenic
938467696 2:131534066-131534088 ACATGGACATGGCTGTGCTATGG - Intergenic
939228063 2:139388676-139388698 AGAAGGAAGAGACTGTGCTAAGG + Intergenic
942026040 2:171911980-171912002 ATAAGGAAATGGCTGTGCTTTGG + Intronic
943069804 2:183127093-183127115 ATAAGGAAAACAATGGGCTATGG - Intronic
943624515 2:190183352-190183374 TTATGGAGAAGACTGCTCTATGG - Intronic
943797201 2:192011337-192011359 CTGTGCAAAACACTGTGCTAGGG + Intronic
943836291 2:192517845-192517867 TAATGAAAAAGGCTGTGCTAGGG + Intergenic
945700447 2:213162887-213162909 ATTTGAAAAATACTGTTCTAGGG - Intergenic
946706474 2:222463271-222463293 AGATGGTAAAGACAGTGCTTGGG - Intronic
947230911 2:227885263-227885285 AAATGGAAAAAACTGTGGCAAGG + Intronic
947251548 2:228111363-228111385 ATATGTGAAACACTGTGCCATGG + Intronic
947552982 2:231060618-231060640 ATATGGAGAACACTGTGCTTGGG + Intronic
1169389099 20:5175061-5175083 ATCTGGAAAGGACTGAGCTCAGG + Intronic
1169941428 20:10942024-10942046 ATATGTAGAAGACTTTGCCAGGG + Intergenic
1170511236 20:17079079-17079101 AAATGGAAAAGAACTTGCTATGG - Intergenic
1170757232 20:19214790-19214812 ATGCGGAAAAGGCCGTGCTATGG - Intronic
1171217591 20:23363093-23363115 ACATGGAAAAGACTGCCCTCTGG - Intronic
1172461772 20:35124345-35124367 ATAGAGAAAAGTTTGTGCTAAGG + Intronic
1173347617 20:42215409-42215431 ATATGCCAAAGACCATGCTAGGG - Intronic
1175154316 20:56959382-56959404 ACATGTAAAGGATTGTGCTATGG + Intergenic
1175431162 20:58904409-58904431 ATATGGAAAAGACTTTCCTCTGG + Intronic
1177876685 21:26641871-26641893 ATGTGCAGAAAACTGTGCTATGG + Intergenic
1177906282 21:26974675-26974697 ATATGCAAAGGACTGAGCTAGGG - Intergenic
1180018925 21:45107473-45107495 ATATGGAAAATAGTGTGGCAAGG + Intronic
949207968 3:1463201-1463223 ATATGGAAAATTTAGTGCTAAGG - Intergenic
949636343 3:5985686-5985708 ATATGGAAAACATTGTGAAAGGG - Intergenic
949882311 3:8671719-8671741 ATATGGAAAATAATGTCCCAGGG + Intronic
949886839 3:8702151-8702173 ATATGGAAAACAGTGTCCCAGGG + Intronic
951507320 3:23462534-23462556 GTAGGGAAAGGACTGTGCTGGGG - Intronic
951659811 3:25050177-25050199 ATATTGAAATGACTATGCAACGG + Intergenic
951845372 3:27079158-27079180 AGATGGGAAAGACTCTACTAGGG + Intergenic
951919528 3:27839089-27839111 ATATGTAAATGCCTGTGCCAAGG + Intergenic
952131708 3:30371663-30371685 ATCTGGAAAAGACTCAGCTGGGG + Intergenic
954193280 3:48979883-48979905 AGATGGAAAAGACTGTCTGATGG - Intronic
957045079 3:75367206-75367228 ATATGGAAAATAATGTCCCAGGG - Intergenic
957836008 3:85590259-85590281 ATATGACAAAGACTATGCTAAGG + Intronic
957972356 3:87398907-87398929 ATATTTAAAACACTGTCCTATGG - Intergenic
959492821 3:107012112-107012134 ATAGGCCAAAGAGTGTGCTAGGG + Intergenic
959990324 3:112624084-112624106 ATATGAAAAAGACAGTAATAAGG + Intronic
960156606 3:114302730-114302752 AGCTGGAAAAGAATGTGCTAGGG - Intronic
960188153 3:114669697-114669719 ATATGGAAAATACTATGCACAGG - Intronic
960825498 3:121779151-121779173 ACATGGAAAAAACTGTGCCAAGG - Intronic
960982630 3:123245355-123245377 ATTTGGGATAGACAGTGCTAAGG - Intronic
961189319 3:124944479-124944501 GTTTGGAAAACACTGTGCTAGGG + Intronic
961214077 3:125146416-125146438 AAATGGCAAAGTGTGTGCTATGG + Intronic
961271400 3:125692367-125692389 ATATGGAAAATAATGTCCCAGGG + Intergenic
961277303 3:125738258-125738280 ATATGGAAAATAATGTCCCAGGG + Intergenic
961407422 3:126691222-126691244 ATATGGCAAAGGCAGTGCTAAGG + Intergenic
961642064 3:128370943-128370965 AGAAGGAACAGAGTGTGCTAGGG + Intronic
961877121 3:130031408-130031430 ATATGGAAAATAATGTCCCAGGG - Intergenic
965495145 3:169388973-169388995 AGATGGCAAAGAATGTGATACGG + Intronic
965932941 3:174069469-174069491 ATAAGGAAAGGAATGTCCTAGGG + Intronic
969274676 4:6127410-6127432 AGATGGGAGAGACTGTGCCAGGG + Intronic
969752778 4:9124714-9124736 AAAAGGAAAACACTGGGCTAAGG + Intergenic
969787757 4:9473081-9473103 ATATGGAAAATAATGTCCCAGGG + Intergenic
970343593 4:15131558-15131580 AAGTAGAAAAGACTGTGCTGTGG + Intergenic
970936436 4:21576382-21576404 AAATGCAAAATACTGTGCTCTGG - Intronic
970936667 4:21579206-21579228 AAATGCAAAATACTGTGCTCTGG - Intronic
972711982 4:41606590-41606612 GTATAGAAAAGACTGACCTAAGG + Intronic
974227599 4:59066775-59066797 ACATGGAAAAAAATGTGCTTGGG + Intergenic
976998958 4:91471294-91471316 CTATGGAAAATACTATGCTGTGG + Intronic
977381405 4:96278742-96278764 AAAGGGAAAAGCATGTGCTAAGG - Intergenic
979158766 4:117431279-117431301 ATATAGCAGAGACTGTACTATGG + Intergenic
979791068 4:124781550-124781572 ATATTGAATATACTGTGGTAGGG + Intergenic
980213088 4:129814766-129814788 ATGTGGGAAAGAATGAGCTATGG - Intergenic
980949319 4:139357170-139357192 ATATGAAAGGGATTGTGCTAGGG + Intronic
982195349 4:152906366-152906388 AAATGGCAAAGACTGTGAGAGGG - Intronic
983112110 4:163764320-163764342 ATATGAAAAAGACTATGTAAGGG + Intronic
986513911 5:8541071-8541093 TTAAGGAAAGGATTGTGCTATGG - Intergenic
988435261 5:31166944-31166966 CTATGGAAAAGATGGTGATATGG + Intergenic
988631795 5:32939506-32939528 ATATGGAAAAGCATGTATTAAGG + Intergenic
989224793 5:39013670-39013692 CCATGTAAAAGACTGTGCCATGG - Intronic
990410913 5:55539977-55539999 ATATGGAAAAAACAAAGCTAGGG - Intergenic
991056141 5:62322834-62322856 ATATGGTAAAGATTGTTTTATGG + Intronic
992120248 5:73585249-73585271 ATGTGGAACAGACTGAGATACGG + Intergenic
992706363 5:79398344-79398366 ATATGTAAAGAACTGTGATAGGG - Intronic
994683776 5:102923721-102923743 ATATGGAAACCTCTGTGATAGGG - Intronic
995406815 5:111806993-111807015 AAAGGGAACAGACTGTGCTGGGG + Intronic
997173520 5:131750117-131750139 ATTTGGATCAGACTGTGCCAAGG + Intronic
997861812 5:137424703-137424725 ATCTAAAAAAGATTGTGCTAAGG + Intronic
998987775 5:147781181-147781203 ATTTGGAAACGGCTGGGCTAGGG + Intronic
1000459198 5:161491952-161491974 GTAATGAAAAGAATGTGCTATGG + Intronic
1000475956 5:161707075-161707097 ATATAGCAAACACTGTTCTAAGG - Intergenic
1000896449 5:166861060-166861082 ATATGGAGAGGTCTGTACTAAGG - Intergenic
1001794972 5:174494308-174494330 ATATGGAAAAGATTGTTTTACGG + Intergenic
1002353565 5:178604365-178604387 ATATGGAAAAGCTTGTGTTTTGG - Intronic
1002891434 6:1336013-1336035 ATAAGGAAAAGCCTGGGGTAGGG - Intergenic
1005807680 6:29490303-29490325 ATGAGGATAAGACAGTGCTAAGG + Intergenic
1010855657 6:80835296-80835318 AAATGGAATTGACTGTGCAAGGG + Intergenic
1012739336 6:102994622-102994644 ATATGCCAAACTCTGTGCTAAGG - Intergenic
1014600334 6:123403513-123403535 ATATGGAAAAGTCTGGGAAATGG + Intronic
1016163583 6:140910921-140910943 AAATAGAAAAGATTGTGCAAGGG + Intergenic
1017560070 6:155617048-155617070 ATATGGTATATACTGTACTATGG + Intergenic
1019920350 7:4159195-4159217 AAATGGAAAAGACAGTGCTTTGG - Intronic
1020463033 7:8444527-8444549 GTGTGAAAAAGACTGTGCCAGGG - Intronic
1021417256 7:20402062-20402084 GTATGGAAAATACTGTGAAAAGG + Exonic
1026563242 7:71467980-71468002 ATGTGGGAAAGACTATGGTATGG + Intronic
1030433240 7:109480258-109480280 ATGTGGAATAGACTCTGCCAGGG - Intergenic
1031635996 7:124101612-124101634 ATATGGAAGAATTTGTGCTATGG + Intergenic
1031665924 7:124481866-124481888 GTAAGGAAAAGACTGTGCAGAGG + Intergenic
1031673238 7:124577957-124577979 ATATGCAAAAGACTTTTCTGAGG + Intergenic
1033205109 7:139413345-139413367 ATTTGGAAAAGACTGAGAAAGGG - Intronic
1036853537 8:12223093-12223115 AAAAGGAAAACACTGGGCTAAGG - Intergenic
1036907100 8:12716148-12716170 ATATGGAAAACAATGTTCCAGGG - Intergenic
1037620116 8:20556108-20556130 CTCTGTGAAAGACTGTGCTAAGG + Intergenic
1038375691 8:27038050-27038072 ATATGTAAAAGACTTCTCTATGG + Intergenic
1038703678 8:29874544-29874566 AAGTTGAAATGACTGTGCTATGG + Intergenic
1038797200 8:30720432-30720454 ATGTGCAAAACACTGTTCTAGGG + Intronic
1039316477 8:36378277-36378299 AGATGGAAAACACTTTTCTATGG + Intergenic
1040696065 8:50000246-50000268 AGATGGAAATGTCTTTGCTATGG - Intronic
1041028423 8:53710262-53710284 ATATGAAGTAGACTGTGATAAGG - Intergenic
1041277180 8:56174187-56174209 ATATGGAAAAACCTGTTTTAAGG - Intronic
1041384623 8:57287708-57287730 ATGGGCAAAAGACTGTGCTCAGG - Intergenic
1041460917 8:58110328-58110350 ATATGGAAAAGAATTTACTTAGG + Intronic
1042670490 8:71257550-71257572 TTATTGAAAAGAAGGTGCTAGGG + Intronic
1042981533 8:74534738-74534760 ATATGAAAAAAACTGTGGAAAGG + Intergenic
1043531969 8:81161136-81161158 AGATGGAACAGGCTGTGCAAAGG + Intergenic
1043997187 8:86832584-86832606 AGATGGAAAAGCCTGTGGTGTGG - Intergenic
1044101096 8:88140031-88140053 ATTTGGAAAAGCCTTGGCTAGGG + Intronic
1044545103 8:93450518-93450540 ATGTGGCAAACACTGTGCTAGGG + Intergenic
1044755793 8:95459964-95459986 AAAAGGAAAAAACAGTGCTAGGG + Intergenic
1045118492 8:99010451-99010473 AAGTGGAAAACACTGTGCTTAGG + Intergenic
1046029188 8:108763061-108763083 ATATGGGAATGACTGTGGAAAGG - Intronic
1046230242 8:111346433-111346455 ATATGGAGAAGACTTGGCTTTGG - Intergenic
1047003599 8:120597003-120597025 ATATGGCAAAGACTTTGCAGAGG + Intronic
1050240772 9:3632123-3632145 ATATGGGAAAATCTGTGCTTTGG - Intergenic
1051034935 9:12733195-12733217 TTAGGGAAAAGATTGTGCAAGGG - Intergenic
1051788526 9:20773238-20773260 CTATGGCAAACACTTTGCTATGG + Intronic
1051855891 9:21564804-21564826 ATCAGGAAAAGAAAGTGCTAGGG + Intergenic
1052742429 9:32406012-32406034 ATCTGGAAAAGACAGTGCAAAGG - Intronic
1052760074 9:32581215-32581237 ATAAGGGAAACACTGTGCAAAGG + Intergenic
1052841076 9:33291230-33291252 ATTTGGAAAACACTGATCTATGG - Intronic
1053067175 9:35076953-35076975 AGATGGTAAAGACAGTCCTAGGG - Exonic
1057395353 9:94675061-94675083 GTAGTGAAAAGACTGTTCTAAGG - Intergenic
1058007935 9:99939628-99939650 ATTGGGAAAAGACTGAGGTAGGG - Intronic
1058278489 9:103079154-103079176 ATATGCCAAAAACTGTGTTAAGG + Intergenic
1059306976 9:113361407-113361429 ATATGTGAAGCACTGTGCTATGG + Intronic
1059686619 9:116643669-116643691 ATGTGCCAAAAACTGTGCTAAGG - Intronic
1059723254 9:116982340-116982362 ATGTGCCAAAGACTGTGCTGAGG - Intronic
1060716929 9:125940433-125940455 ATGTGCCAAATACTGTGCTAGGG + Intronic
1060765437 9:126292186-126292208 ATAGGGAACAGCCTGTGCAAAGG - Intergenic
1060989812 9:127842000-127842022 ATGTGCTAGAGACTGTGCTAGGG - Intronic
1186318163 X:8393661-8393683 ATATGGAAAACAGTATTCTAAGG + Intergenic
1186829008 X:13371723-13371745 ATATGGAAACCACTGTTATATGG - Intergenic
1186987156 X:15029381-15029403 ATATAGAACATACTGTGGTATGG + Intergenic
1187545666 X:20249722-20249744 CTATGAAAAAGACTCTGCGAAGG - Intronic
1188663807 X:32793276-32793298 ATATGGCAAAAGCAGTGCTAAGG + Intronic
1189259314 X:39666883-39666905 ATATGGAAATAGCTGTGCCATGG + Intergenic
1189503683 X:41588971-41588993 AAATGGAAACTACTGTGTTAGGG + Intronic
1190404042 X:50068418-50068440 ATATGGAAAGGACTTTGGTTGGG + Intronic
1192708458 X:73553914-73553936 ATATGAAATAGACTGTGATATGG + Intergenic
1193920915 X:87425205-87425227 ATGAGCAAAAGACTATGCTAGGG + Intergenic
1194622667 X:96192326-96192348 ATATGCAAAACATTGTACTAGGG - Intergenic
1195088232 X:101433887-101433909 AAATAGAAAAGAATGTTCTAAGG - Intronic
1195201587 X:102555492-102555514 ATATGCATTAGACTGTGATAAGG + Intergenic
1195356418 X:104043972-104043994 AGATGGAAAAGATTCTGCTTGGG + Intergenic
1197750731 X:129961872-129961894 ATATAGAAACCACTGTGCTGTGG - Intergenic
1199264365 X:145813307-145813329 ATATGGTAAAGTATGTGCTGTGG - Intergenic