ID: 1092651688

View in Genome Browser
Species Human (GRCh38)
Location 12:10641784-10641806
Sequence CTGGCTGTACAGAATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 338}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092651688_1092651696 6 Left 1092651688 12:10641784-10641806 CCTGCCTCATTCTGTACAGCCAG 0: 1
1: 0
2: 1
3: 30
4: 338
Right 1092651696 12:10641813-10641835 AGGGCAGTTTCCCCTCCCTAGGG 0: 1
1: 0
2: 0
3: 18
4: 156
1092651688_1092651697 11 Left 1092651688 12:10641784-10641806 CCTGCCTCATTCTGTACAGCCAG 0: 1
1: 0
2: 1
3: 30
4: 338
Right 1092651697 12:10641818-10641840 AGTTTCCCCTCCCTAGGGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 137
1092651688_1092651695 5 Left 1092651688 12:10641784-10641806 CCTGCCTCATTCTGTACAGCCAG 0: 1
1: 0
2: 1
3: 30
4: 338
Right 1092651695 12:10641812-10641834 AAGGGCAGTTTCCCCTCCCTAGG 0: 1
1: 0
2: 3
3: 23
4: 207
1092651688_1092651698 12 Left 1092651688 12:10641784-10641806 CCTGCCTCATTCTGTACAGCCAG 0: 1
1: 0
2: 1
3: 30
4: 338
Right 1092651698 12:10641819-10641841 GTTTCCCCTCCCTAGGGAGTGGG 0: 1
1: 0
2: 0
3: 26
4: 113
1092651688_1092651703 21 Left 1092651688 12:10641784-10641806 CCTGCCTCATTCTGTACAGCCAG 0: 1
1: 0
2: 1
3: 30
4: 338
Right 1092651703 12:10641828-10641850 CCCTAGGGAGTGGGTCAGCATGG 0: 1
1: 0
2: 0
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092651688 Original CRISPR CTGGCTGTACAGAATGAGGC AGG (reversed) Intronic
900870525 1:5299024-5299046 ATGGCTGTACCACATGAGGCTGG + Intergenic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902839137 1:19064441-19064463 CTGGCTGTCCAAAAGCAGGCAGG + Intergenic
906065029 1:42974669-42974691 CTGATTCTACAGAAGGAGGCCGG + Intergenic
907057383 1:51382875-51382897 CTGGCTTCACAGAATGAGTATGG - Intronic
907939832 1:59076976-59076998 CTGGATCTACAGAATGAGCGAGG + Intergenic
907977321 1:59444589-59444611 CTGGCTGCACAGCATGAGGTGGG + Intronic
908870920 1:68610718-68610740 CTGGCTTCACAGAATGAGTTGGG + Intergenic
911513430 1:98837151-98837173 CTGGCTGTCACGAATGATGCCGG + Intergenic
912589561 1:110802494-110802516 CTGCTTGTCCAGAATGAGGGAGG - Intergenic
915063646 1:153207088-153207110 CTGACTGTACAGACTCAGGCTGG - Intergenic
915300399 1:154948228-154948250 CTGGCTGTGGAGAACCAGGCTGG - Exonic
917458054 1:175202548-175202570 ATGGCTGTACACAATGAGGTGGG - Intergenic
917473704 1:175349817-175349839 CTGGCTGTGGAGAAGGAGGTAGG - Intronic
918146392 1:181759647-181759669 CTTGCTGCACACAATGAAGCAGG - Intronic
918854115 1:189728990-189729012 CTGGCCTTATAGAATGAGTCAGG + Intergenic
919110782 1:193216580-193216602 CTGGCTTCACAGAATGAGTTAGG - Intronic
920375926 1:205507956-205507978 CTGGCAGTTATGAATGAGGCAGG + Intronic
922386728 1:225093134-225093156 CTGGCATCACAGAATGAGTCAGG - Intronic
923064858 1:230508282-230508304 CTGGCTGTGCTGAACGTGGCTGG - Intergenic
924740431 1:246791577-246791599 CTGGCAGTGCAGGACGAGGCGGG + Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1064970415 10:21060458-21060480 ATAGCTGTGCAGAATAAGGCTGG - Intronic
1065571685 10:27076984-27077006 CTGGCTTTATAGAATGAGTTAGG - Intronic
1066217325 10:33300462-33300484 CGGCCTGGACAGAATCAGGCAGG + Intronic
1066501984 10:36003480-36003502 TTGCCTGAACAGAATGAGCCTGG - Intergenic
1066753909 10:38690194-38690216 CTGGCTGTATAGAATTTGCCAGG + Intergenic
1067079871 10:43206798-43206820 GTGGCTGACCAGTATGAGGCAGG + Intronic
1067123395 10:43494372-43494394 GTTCCTGTACAGAATGGGGCAGG + Intergenic
1068462663 10:57347922-57347944 CTGGCCTCACAGAATGAGTCAGG + Intergenic
1068802669 10:61160041-61160063 CTGGCATAACAGAATGAGGGTGG - Intergenic
1069024863 10:63528604-63528626 CTGGCTTTCCTGAGTGAGGCAGG - Intronic
1071032528 10:81202462-81202484 CTGGCTTTAAGCAATGAGGCTGG - Intergenic
1071199486 10:83203020-83203042 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1071368727 10:84928345-84928367 CTGGCTGTCCAGAGTGTGGGAGG + Intergenic
1071606015 10:86990505-86990527 CTGGCTGCATAGGATGAGGGAGG + Intergenic
1072433115 10:95390983-95391005 CTGGCTTAGCAGACTGAGGCAGG + Intronic
1072771962 10:98148877-98148899 CTGGCTGTGTAGAATGAGTTGGG + Intronic
1073823631 10:107293796-107293818 CTGGCTGCACAAAATGAGTTTGG + Intergenic
1074206269 10:111285745-111285767 CTGGCTGTCCAGCTTGAGGGTGG + Intergenic
1074759032 10:116651426-116651448 CTGGCTTTATAGAATGAGTTAGG + Intergenic
1074843530 10:117376672-117376694 CTGGCTGTACCTAAGGAGCCAGG + Intergenic
1075388837 10:122077652-122077674 CTGGCAGAACAGAATGAAGGGGG + Intronic
1077225245 11:1436678-1436700 CTGGGTGTAGAGGAAGAGGCTGG + Intronic
1078280157 11:9893168-9893190 CTGGCTGGACAGTATGAGGATGG + Intronic
1079009167 11:16814401-16814423 CAGGCTGTACAGAGGTAGGCAGG - Intronic
1080192500 11:29568902-29568924 CTACCTGTACAGAATGGGGGAGG - Intergenic
1080216939 11:29854448-29854470 CTGGCTCCACAGAATGAGTTAGG - Intergenic
1080796159 11:35565558-35565580 CCAGCTGGGCAGAATGAGGCAGG + Intergenic
1081049483 11:38319827-38319849 CTGGCTTTACAGAATGAGTTTGG - Intergenic
1081216334 11:40403787-40403809 CTGCTTGTAGAGAATGAGCCTGG - Intronic
1081463447 11:43293741-43293763 CTGGCTTTGTAGAATGAGTCAGG - Intergenic
1083456850 11:62784934-62784956 CTGGCCTTACAGAATGATGTGGG + Intronic
1084341016 11:68501021-68501043 CTGGCAGTTCAGAATGTTGCAGG + Intronic
1084508675 11:69587692-69587714 TTGGGTCTGCAGAATGAGGCAGG - Intergenic
1085352640 11:75809671-75809693 CTGACGGCATAGAATGAGGCTGG - Intergenic
1085708881 11:78811490-78811512 ATGGCTGTATAGATTGAGGCTGG - Intronic
1086270972 11:85066431-85066453 CTGGCTTTGTAGAATGAGTCAGG - Intronic
1086787114 11:90982807-90982829 CAGGCTGGACAGAATGGTGCAGG - Intergenic
1088395909 11:109369338-109369360 CTGGCTTCACAGAATGAGCTAGG + Intergenic
1092651688 12:10641784-10641806 CTGGCTGTACAGAATGAGGCAGG - Intronic
1092704398 12:11267699-11267721 CTGGCTTTCCCGGATGAGGCGGG + Exonic
1093261002 12:16937910-16937932 CTGGACCTACAGAAAGAGGCAGG - Intergenic
1095845919 12:46744522-46744544 CTGGCTTCATAGAATGAGTCAGG - Intergenic
1099463845 12:82958011-82958033 CTGGCTTCATAGAATGAGTCAGG - Intronic
1101011628 12:100456797-100456819 TTGGCTGTACAGAAGGAAACAGG + Intergenic
1101527461 12:105544689-105544711 CTGGGTGTGCAGGGTGAGGCTGG - Intergenic
1102383626 12:112488123-112488145 CTGGTTGGACAGAATGAAACAGG - Intronic
1104588846 12:130068477-130068499 CTGGTTGTACAGATGCAGGCAGG - Intergenic
1104768763 12:131346833-131346855 CTGGAGGTGCAGAACGAGGCTGG + Intergenic
1106462652 13:29986317-29986339 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1106985925 13:35349892-35349914 CTGGCTGAAAAGCATGAGACAGG + Intronic
1107323621 13:39216008-39216030 CTGGCTTTGAAGAATGAGGAAGG - Intergenic
1109504657 13:63284733-63284755 CTGGCTTCATAGAATGAGGTAGG + Intergenic
1110638611 13:77794965-77794987 CTGGCTTCATAGAATGAGTCGGG - Intergenic
1110742440 13:79013596-79013618 CTGGCTTCACAGAATGAGATAGG + Intergenic
1112866112 13:103900766-103900788 CTGGCTTTGCAGAATGAGTTTGG - Intergenic
1114519753 14:23325725-23325747 CTGGCTGGACAGGAGCAGGCAGG - Exonic
1114762651 14:25333571-25333593 CTGGCCGTATAGAATGAGTTAGG - Intergenic
1115507334 14:34104909-34104931 CTGGCCTCACAGAATAAGGCTGG - Intronic
1115947753 14:38682028-38682050 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1115963305 14:38860325-38860347 CTGGCTCCACAGAATGAGTTAGG + Intergenic
1116269543 14:42743312-42743334 CTGGCTGCATAGAATGAGTTTGG - Intergenic
1116537017 14:46044324-46044346 CTTGCTGTATAGAATGAGTTTGG + Intergenic
1116745615 14:48814689-48814711 CTGCCTGTACTGAATGGGGTTGG - Intergenic
1117651521 14:57911783-57911805 CTGGCTTCACAGAATGAGTTAGG + Intronic
1118839072 14:69497550-69497572 CTGGCTGAAGAGAAAGAGGGAGG + Intronic
1120344046 14:83261399-83261421 CTGGCTTTATAGAATGAGTTAGG + Intergenic
1121047834 14:90800880-90800902 CTGGCTTTAAAGAAGGAGGAAGG + Intronic
1121163124 14:91764007-91764029 CAGGCTTTGCAGAATGAGTCAGG - Intronic
1121340097 14:93099966-93099988 GTGGCTGGCCAGAGTGAGGCTGG - Intronic
1121573360 14:94964106-94964128 TTGACCCTACAGAATGAGGCTGG + Intergenic
1121965756 14:98303526-98303548 CTGGCTTTGCAGAATGAGTTAGG + Intergenic
1121978365 14:98428175-98428197 CTGGCTGTATAGAGTAAGGAAGG + Intergenic
1122415062 14:101545453-101545475 ATGGCTGTAGAGGAGGAGGCGGG - Intergenic
1122426505 14:101610758-101610780 CTGGCTTCACAGAATGAGTTAGG - Intergenic
1122584484 14:102795772-102795794 CTGCCTCTAGGGAATGAGGCAGG - Intronic
1123983019 15:25621120-25621142 CTGGATGTACATAATGCTGCTGG + Intergenic
1124187680 15:27544291-27544313 GAGTCTGCACAGAATGAGGCTGG + Intergenic
1124217752 15:27823024-27823046 CTGTGTGTACGGAATGAGGTAGG + Intronic
1124923867 15:34051982-34052004 CTGGCTTCATAGAATGAGTCAGG - Intronic
1125579198 15:40773812-40773834 CTGGCTGTCCAGAATGAAGTTGG - Exonic
1126279633 15:46929827-46929849 CTGACTTTACAGAATGAGTTAGG + Intergenic
1126282416 15:46970196-46970218 CTGGCTTTATAGAATGAGTTAGG - Intergenic
1127101386 15:55568695-55568717 CTGCCTATACAGTATGATGCTGG + Intronic
1128545470 15:68563998-68564020 CTGGGTTTATAGAATGAGCCAGG - Intergenic
1129737706 15:77975244-77975266 AGGGCTGTAAAGAGTGAGGCAGG + Intergenic
1129848375 15:78778372-78778394 AGGGTTGTACAGAGTGAGGCAGG - Intronic
1130253546 15:82315566-82315588 AGGGCTGTACAGAGTGAGGCAGG + Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1133254061 16:4505625-4505647 CTGGCTGCACTGAATCAGGTGGG + Intronic
1133970205 16:10562056-10562078 CTGGCCTCACAGAATGAGGTGGG - Intronic
1134249832 16:12566466-12566488 CTGGCTGTGCTGAATGATGATGG + Intronic
1136728836 16:32386991-32387013 CTGGCTGTATAGAATTTGCCAGG - Intergenic
1137675867 16:50303683-50303705 CTGAGTGTCCAGCATGAGGCTGG + Intronic
1138637786 16:58356117-58356139 CTGGCCTTATAGAATGAGTCAGG + Intronic
1139358514 16:66381994-66382016 CTGGCTGTAGAGAAACAGGCTGG + Intronic
1139428127 16:66895734-66895756 CTGGCTGTAGGGAATGGGGTAGG - Intronic
1139721749 16:68861712-68861734 CTGGGTGTACATTATGAAGCTGG + Intronic
1140653578 16:77115900-77115922 CAGGCTGTACAGAATTAGGAAGG - Intergenic
1202997600 16_KI270728v1_random:130748-130770 CTGGCTGTATAGAATTTGCCAGG + Intergenic
1203024287 16_KI270728v1_random:443090-443112 CTGGCTGTATAGAATTTGCCAGG + Intergenic
1142978900 17:3660327-3660349 CTGTTTGTACAGAAAGAGACCGG + Exonic
1145054585 17:19692671-19692693 TTGGCTTTACAGAATGAGTTTGG - Intronic
1146614367 17:34341841-34341863 CAGGATCTACAGAATGAGTCAGG + Intergenic
1147283006 17:39378075-39378097 CAGACTGTACAGAATTAGGTTGG + Intronic
1148872257 17:50665465-50665487 ATGGCAGTCCAGAATCAGGCAGG + Intronic
1150970885 17:70026461-70026483 CTGGCTTTATAGAATGAGTTGGG + Intergenic
1151196314 17:72433900-72433922 ATGGCTGTTCAGAATGAAGCTGG - Intergenic
1152558485 17:81066446-81066468 CTCGTTGTCCAGAGTGAGGCAGG + Intronic
1153067897 18:1067476-1067498 CTGGTTTTACAGAATGAGTTGGG + Intergenic
1154129769 18:11726894-11726916 CTGGTTGGACAGAATGGGACAGG + Intronic
1156794564 18:41027615-41027637 CTGGCTGTACAAAATGATTCTGG - Intergenic
1157045332 18:44095960-44095982 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1157318698 18:46617774-46617796 GGGGCAGAACAGAATGAGGCTGG - Intronic
1158599637 18:58846393-58846415 CTGTCTGTAAAGAACGAGGTGGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1163326139 19:16604525-16604547 CTGGATGTGCAGGCTGAGGCTGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1164011768 19:21209922-21209944 CTGCTTGTGCAGAGTGAGGCTGG + Intergenic
1164822412 19:31260324-31260346 CTGGCTGTACTTAGTTAGGCAGG - Intergenic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1167109804 19:47453376-47453398 CTGCCTGCTCAGACTGAGGCAGG + Intronic
1167289197 19:48615175-48615197 CTGGCTGTTGGGAAGGAGGCAGG + Intergenic
1167867167 19:52337616-52337638 AGAGCTGTACAGAATGAGGGAGG + Intronic
925196392 2:1929327-1929349 CTGGCAGTAGAGGATGAGGGAGG - Intronic
925322092 2:2980099-2980121 CTGGCTTTGCAGAATGAGTTAGG - Intergenic
925492053 2:4405830-4405852 ATTGCTGCACAGAATGAAGCTGG + Intergenic
925912788 2:8584039-8584061 CAAGCTGTGCGGAATGAGGCTGG - Intergenic
926347116 2:11957563-11957585 CTTGCAGTACAGAGGGAGGCTGG + Intergenic
926623303 2:15068152-15068174 CTGGCTGTATAGCCTCAGGCAGG + Intergenic
929851598 2:45596258-45596280 CTTGCTGAATAGAATGAGGAGGG - Intronic
930381442 2:50635126-50635148 CTGGCTGCACCGAATGTTGCTGG + Intronic
931528221 2:63182647-63182669 CTGGCTCTGTAGAATGAGTCAGG + Intronic
932161659 2:69465778-69465800 CTGCTTGTACAGAATGGGACAGG + Intronic
932401877 2:71486340-71486362 CAGGCTGTAAAGAATGAGGGAGG - Intronic
933181548 2:79232543-79232565 CTGGCTTTACAGAATGAATTAGG + Intronic
933450962 2:82451008-82451030 CTGGCCTTACAGAATGAGTTTGG - Intergenic
934174188 2:89564707-89564729 CTGGCTGGATGAAATGAGGCAGG + Intergenic
934185112 2:89664887-89664909 CTGGCTGTACAGAATTTGCCAGG - Intergenic
934284504 2:91639056-91639078 CTGGCTGGATGAAATGAGGCAGG + Intergenic
935171014 2:100611629-100611651 CTGGCAGGGCAGAATGAAGCTGG + Intergenic
937732927 2:125256936-125256958 CTGGCTTCACAGAATGAGTTGGG - Intergenic
938302047 2:130222818-130222840 GTGGCTGTGAAGAATAAGGCTGG + Intergenic
938454653 2:131451634-131451656 GTGGCTGTGAAGAATAAGGCTGG - Intergenic
939163137 2:138612444-138612466 CTGGCTGTAGAGTATCAAGCAGG + Intergenic
939531469 2:143367840-143367862 ATGGCTGTAAAGAAGGTGGCCGG - Intronic
942272378 2:174289585-174289607 CTGGCCTTACAAAATGAGTCAGG - Intergenic
942386175 2:175445499-175445521 CTGGGTGTGCAGCATCAGGCTGG + Intergenic
943890188 2:193276871-193276893 CTGGCTGTCCAGAATGAAGTTGG - Intergenic
945339464 2:208634682-208634704 CAGTTTGTTCAGAATGAGGCAGG - Intronic
946407973 2:219502209-219502231 CTGGCTGTTCAGAAGTAGGGAGG + Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
1169011560 20:2255452-2255474 CTGGCTCTATTGATTGAGGCTGG - Intergenic
1169671037 20:8102742-8102764 CTGGCTTTGTAGAATGAGTCAGG + Intergenic
1170054743 20:12189260-12189282 CTGGATTTACAGAATGAGTCAGG - Intergenic
1170241213 20:14168840-14168862 CTGGCTTTACAGAATGATTTAGG - Intronic
1170657389 20:18301901-18301923 CTGGCCTCACAGAATGAGTCAGG - Intronic
1171242014 20:23578110-23578132 CTGGCTTTACAGAATGATTTAGG + Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1172066333 20:32223291-32223313 CTGTCTGGAAAGAATGAGGGGGG - Intronic
1172669189 20:36622701-36622723 CTGGCTGTGAAGACTGAGGAAGG - Intronic
1174066105 20:47867277-47867299 GTGGCTGCACAGAGCGAGGCTGG - Intergenic
1174215266 20:48911645-48911667 CCGGCTTTAAAGATTGAGGCGGG - Intergenic
1174939340 20:54907289-54907311 CTGGCTTCACAGAATGAGTTTGG - Intergenic
1179117544 21:38507732-38507754 CTGGCTGGACTGAATGAAACTGG - Intronic
1179543231 21:42097790-42097812 CTGGCTGTACAGCAAGTGTCTGG - Intronic
1180543648 22:16477994-16478016 CTGGCTGTATAGAATTTGCCAGG + Intergenic
1181031570 22:20150741-20150763 CTGGCTGGACAGAAAGAGCCCGG + Exonic
1181794705 22:25297783-25297805 CTGGCTTTGCAGAATGAGTTAGG - Intergenic
1181834690 22:25594338-25594360 CTGGCTTTGCAGAATGAGTTAGG - Intronic
1182936166 22:34223679-34223701 CTGGCTGTGCAGGACGAGACTGG + Intergenic
1183879797 22:40817930-40817952 CTGGCTGAACTGAATGAACCAGG + Intronic
949702672 3:6777104-6777126 CTGGCTGAAAAGGATGACGCGGG + Intronic
950398797 3:12754346-12754368 ATGGCTGTACAGAAAGAGGATGG + Intronic
950720103 3:14876621-14876643 CTGGCTGAACAGAAGGTAGCTGG + Intronic
952494630 3:33905005-33905027 TTGCCTGTACAGCATGGGGCTGG + Intergenic
952530491 3:34257528-34257550 CTTGGTGGTCAGAATGAGGCTGG + Intergenic
953634216 3:44648780-44648802 CTGGCTCTGCAGCAGGAGGCTGG - Exonic
953721538 3:45360126-45360148 CTGGCTTTGAAGAATGAGGTAGG + Intergenic
953916958 3:46926490-46926512 CTGCCTGAAAAGACTGAGGCAGG - Intronic
958562187 3:95760313-95760335 CTGACTTTACAGAATGAGTTAGG - Intergenic
959424106 3:106164895-106164917 CTGGCTGTATAGAATGATTTAGG - Intergenic
960792181 3:121445113-121445135 CTGGCCTCACAGAATGAGTCTGG + Intronic
961334694 3:126165427-126165449 CTGGCTTCACAGAATGAGTCAGG + Intronic
961473563 3:127133620-127133642 CTGGCTTTGAAGAAGGAGGCAGG - Intergenic
962758848 3:138489710-138489732 CTGGCCTCACAGAATGAGGTTGG + Intergenic
963701719 3:148634820-148634842 CTGGCCTTACAGAATGAGTTAGG - Intergenic
963880437 3:150522401-150522423 GTTGCTGTACTGAATGTGGCAGG + Intergenic
966054002 3:175659896-175659918 CAGCCTGAACAGACTGAGGCAGG - Intronic
966361398 3:179133216-179133238 CTGGCCTTATAGAATGAGTCAGG - Intergenic
968538265 4:1148787-1148809 CAGGCTGTGGAGACTGAGGCAGG - Intergenic
968559325 4:1269570-1269592 CTGGCTGCATAGAATGAGTTAGG + Intergenic
968911712 4:3479782-3479804 CTGCCTGTTCAGAATGGGACAGG + Intronic
969828044 4:9773653-9773675 CTGGCTGGATGAAATGAGGCAGG + Intronic
970707370 4:18821438-18821460 CTGGCTGTACAGAATGAGTTTGG - Intergenic
970734804 4:19153305-19153327 CTGGCTTCACAGAATGAGTTAGG + Intergenic
971933110 4:33111491-33111513 CTGGCTTCACAGAATGAGTTAGG + Intergenic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
973850575 4:54957672-54957694 CTGGTAGGCCAGAATGAGGCAGG - Intergenic
974364837 4:60933513-60933535 CAGGTGGTACAGAATGAAGCAGG - Intergenic
974376082 4:61077901-61077923 CTGGCTTCACAGAATGAGTTAGG - Intergenic
974562811 4:63543039-63543061 CTGGCTTTATAGAATGAGTTAGG - Intergenic
975152950 4:71040889-71040911 CTGGCTGCATAGAATGGGTCAGG + Intergenic
975275964 4:72502119-72502141 CTGGCTTTATAGAATGAGTTAGG + Intronic
976801618 4:88998744-88998766 CCAGCTGTACAGAATCAGACTGG + Intronic
976908514 4:90270155-90270177 CTGGCCTTACAGAATGAGTTTGG - Intronic
976966223 4:91044524-91044546 CAGTCTGCACAAAATGAGGCTGG - Intronic
977509751 4:97947909-97947931 CTGGCTTAACAGAATGAGTTAGG + Intronic
977830037 4:101579377-101579399 CTGGCTTTTCAGAATGAGTTAGG + Intronic
978911925 4:114074011-114074033 CTGGTTTCACAGAATGAGGTTGG - Intergenic
979834739 4:125350770-125350792 CTTACTGTAGAGAATGAGGAGGG - Intronic
979892484 4:126116359-126116381 CTGGCTTTATAGAATGAGATTGG + Intergenic
979896745 4:126167566-126167588 CTGGCTTTATAGAATGAGTTAGG - Intergenic
979927625 4:126587381-126587403 CTGGCTTTATAGAATGAGTTAGG - Intergenic
980550625 4:134329029-134329051 CTGGGAGCACAGAATCAGGCTGG - Intergenic
981954835 4:150457784-150457806 CTGGGTGTACAAACTGAGGTAGG - Intronic
983397777 4:167223959-167223981 ATGGCTGTAGAGAATGATGATGG - Intronic
983444633 4:167834000-167834022 CTGGTTGTAAAGAATGAATCCGG - Intergenic
984467304 4:180116865-180116887 ATGGCTGTACAGAGTACGGCTGG - Intergenic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
987697109 5:21345940-21345962 CTGGCTTCACAGAATGAGTTAGG + Intergenic
989494549 5:42097113-42097135 CTGGCTGCATAGAATGAGTTAGG + Intergenic
989527341 5:42468483-42468505 CTGGCTCTGCAGCAGGAGGCTGG + Intronic
989651372 5:43694809-43694831 CTGGCCTTACAGAATGAGTTAGG + Intronic
992479286 5:77134592-77134614 CTGCCTGTACACAATGGGACAGG + Intergenic
992496438 5:77298585-77298607 CTGGTTGTTTAGAAAGAGGCTGG + Intronic
994127641 5:96186854-96186876 CTGGCTTTACAGAATGAGTTAGG + Intergenic
994129408 5:96207801-96207823 CTGGCTTTATAGAATGAGCTGGG + Intergenic
995722860 5:115154820-115154842 CTGGCTTCACAGAATGAGTTAGG - Intronic
996265804 5:121538264-121538286 CTGGCTTCACAGAATGAGTTAGG - Intergenic
998357446 5:141552456-141552478 CTGGCTTTAAAGATTGAGGAAGG + Intronic
1000400376 5:160820527-160820549 CTGGCTTCACAGAATGAGTTTGG - Intronic
1000428809 5:161125575-161125597 CTGGCTTTGTAGAATGAGTCAGG + Intergenic
1000475706 5:161704310-161704332 CTGGGAGGACACAATGAGGCTGG + Intergenic
1000690331 5:164310490-164310512 CTAGCTATTCAGGATGAGGCAGG + Intergenic
1002378488 5:178806746-178806768 CTGGCTTTGCAGAATGAGTCAGG - Intergenic
1003274228 6:4635070-4635092 GTTGCTGAAAAGAATGAGGCAGG + Intergenic
1005401581 6:25439564-25439586 CTGACTCTGCAGAATGATGCTGG + Intronic
1005553753 6:26952464-26952486 CTGGCTTCACAGAATGAGTTAGG - Intergenic
1005883548 6:30077434-30077456 CTGGCTTTGGAGACTGAGGCAGG + Intergenic
1006274632 6:32993030-32993052 CTGGCTTCACAGAATGAGTTGGG + Intergenic
1006609842 6:35287744-35287766 CTGGCCGTACAGACAGAGGTGGG + Exonic
1007024720 6:38558884-38558906 CTAGCTTCACAGAATGAGGTAGG + Intronic
1007216064 6:40239188-40239210 CTGGCTTTATAGAATGAGCTGGG - Intergenic
1008083016 6:47213678-47213700 CTGGCTGTATAAAATGAGTTAGG - Intergenic
1008315437 6:50033817-50033839 CTGGCTTCACAGAATGAGGTAGG - Intergenic
1008998632 6:57688075-57688097 CAGGCTGTACAGAAAACGGCTGG + Intergenic
1009325355 6:62342359-62342381 CTGGCTTTATAGAATGAGCTGGG - Intergenic
1010076072 6:71800201-71800223 CTGGCTGCACAGAATGAATTAGG + Intergenic
1010923668 6:81716743-81716765 TTGTCTGTAGAGTATGAGGCAGG - Intronic
1010929633 6:81785626-81785648 GTGGGTGTACATAATGAGGGTGG - Intergenic
1011062310 6:83284379-83284401 CTGGCTTCACAGAATGAGTTAGG - Intronic
1012487281 6:99736437-99736459 CAGGATGTACTGAGTGAGGCTGG - Intergenic
1012883503 6:104818521-104818543 CTGGCTTTATAGAATGAGTTAGG - Intronic
1013437718 6:110128767-110128789 CAGGCTGTACAGCAGGAGGTGGG + Intronic
1014227191 6:118861927-118861949 CAGGCTGTTCAGGATGAGGGAGG + Intronic
1015247886 6:131095282-131095304 CTGGCCTCACAGAATGAGTCTGG - Intergenic
1016879629 6:148898137-148898159 CTAGCAAGACAGAATGAGGCTGG + Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017352223 6:153455905-153455927 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1018865915 6:167747012-167747034 TAGGTTGTACAGGATGAGGCAGG - Intergenic
1019009550 6:168832320-168832342 CTGGCTTTATAGAATGAGTTGGG + Intergenic
1019322404 7:421711-421733 CGGGCTGCAGAGACTGAGGCTGG - Intergenic
1019367810 7:644338-644360 CTGGAGGTACACAATGAGGTGGG + Intronic
1020005712 7:4782948-4782970 CTGGGTGTGCAGAGTGAGGTGGG + Intronic
1023075625 7:36479517-36479539 CTGGCCGTATAGAATGAGTCAGG + Intergenic
1025788348 7:64665170-64665192 CTGGGTGTCCGGAATGTGGCTGG + Intergenic
1026376389 7:69755196-69755218 CTGGATTTATAAAATGAGGCTGG - Intronic
1026930762 7:74221810-74221832 TTGGGTGGACAGAAGGAGGCTGG + Intronic
1027627151 7:80560446-80560468 CTGGCCTCACAGAATGAGGTAGG + Intronic
1028213156 7:88100537-88100559 GTGACTGTACAGAATCAGACTGG - Intronic
1029097001 7:98094199-98094221 CTGGCTTCATAGAATGAGACAGG + Intergenic
1029481575 7:100816669-100816691 CTGGGGGTACAGAGTGAAGCAGG + Intronic
1029939268 7:104462744-104462766 CTGGCTTTATAGAATGAGTTTGG + Intronic
1030604791 7:111628705-111628727 CTGGTTTTACAGAATGAGTTAGG + Intergenic
1030718737 7:112843779-112843801 CTGGCTTCATAGAATGAGGTGGG - Intronic
1036590789 8:10166118-10166140 CTGGCTCTCCAGAGTGAAGCTGG - Intronic
1037396788 8:18451884-18451906 CTGGCTTTGGAGAATGAGGAAGG - Intergenic
1037939015 8:22936587-22936609 CTGGCTTCACAGAGTGAGTCAGG - Intronic
1038196612 8:25373917-25373939 GAGGCTGTACAGGAAGAGGCAGG + Intronic
1038478384 8:27884897-27884919 CAGGGAGTACAGAGTGAGGCAGG + Intronic
1038740954 8:30216144-30216166 CTGGCTGTAGAGACAGAGGAGGG - Intergenic
1039627500 8:39069025-39069047 CTGGCTATAGAGAATAAGGAGGG - Intronic
1040483234 8:47845818-47845840 CTGGCTTCAGAGAATGAGTCAGG - Intronic
1040905726 8:52468231-52468253 ATGGCTGTGCAGTGTGAGGCAGG - Intergenic
1041646235 8:60255271-60255293 GTGTCTGTCCAGAATTAGGCGGG - Intronic
1042540864 8:69906016-69906038 CAGGCTGTGCAGAATGGGGCAGG - Intergenic
1043228755 8:77770926-77770948 CTGGCTGTGTAGAATGAGTTTGG + Intergenic
1043324879 8:79037546-79037568 CTGGCTGCATAGAATGAGTAAGG - Intergenic
1044300726 8:90580235-90580257 ATGGCTGTTCTGACTGAGGCAGG + Intergenic
1046421171 8:113984747-113984769 CTGGCTTCACAGAATGAGTTAGG - Intergenic
1046449290 8:114367078-114367100 CTGGCTTCATAGAATGAGGTTGG - Intergenic
1047565911 8:126043381-126043403 CTGGCTACACAGAATGAGCTAGG + Intergenic
1047699907 8:127438531-127438553 CTGGCTTCACAGAATGAGTTAGG - Intergenic
1047753620 8:127901135-127901157 CTGGCTGGATATCATGAGGCTGG + Intergenic
1048800665 8:138191228-138191250 CTGGCTGTCCAGCATTGGGCAGG - Intronic
1049066141 8:140316761-140316783 CTGGCTTCACAGAATGAGTTTGG + Intronic
1050972035 9:11890087-11890109 CTGGCTTTATAGAATGATGGAGG + Intergenic
1051142030 9:13988127-13988149 CTGGGAGCACAGAATCAGGCTGG - Intergenic
1056172147 9:83996754-83996776 CAGGCTGTACAGGAGCAGGCTGG + Intronic
1056349445 9:85734390-85734412 CTGGCCTTATAGAATGAGGTAGG - Intronic
1057164634 9:92916087-92916109 CTGGCTACACAGAATGATGTTGG - Intergenic
1057219317 9:93247531-93247553 CTGCCTTTACAGATTGAGTCTGG + Exonic
1057755709 9:97833404-97833426 CTGGCTGTTGAGAATGTTGCTGG - Intergenic
1058283501 9:103147502-103147524 CTGGCCTTACAGAATGAGTTAGG + Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1059383260 9:113945100-113945122 CTGGCAGGACAGAGTGAGGTAGG - Intronic
1059604304 9:115816993-115817015 CTGCCTTTAAAGACTGAGGCTGG + Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1061927299 9:133812213-133812235 CTCGCTGCACAGGAGGAGGCGGG + Exonic
1062276753 9:135735006-135735028 ACGGCTGTAAAGAATGAGGCTGG - Intronic
1062423070 9:136493374-136493396 GTGGCTGTACTGAGTGATGCCGG + Intergenic
1062462426 9:136667492-136667514 CTGGCTGTGCAGCAGGAGCCAGG - Intronic
1186203785 X:7180487-7180509 CTGGCTGCACAGCAGGAGGTGGG - Intergenic
1186424600 X:9454122-9454144 CTGGCTGTAGAGAATAAGCATGG - Intergenic
1186748692 X:12598452-12598474 CTGGCAGGAGAGAATGAGGATGG - Intronic
1187406025 X:19004650-19004672 CTGGGTGTACAGGGTAAGGCAGG + Intronic
1188077864 X:25801289-25801311 CTGGCCTTATAGAATGAGTCTGG + Intergenic
1188757654 X:33984045-33984067 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1189862404 X:45287062-45287084 CGGGCTGTGCAGAATCATGCTGG - Intergenic
1189895761 X:45654519-45654541 CTGGCCTTATAGAATGAGTCAGG + Intergenic
1191214416 X:57920484-57920506 CTGGCTCTACAGAATGCATCTGG + Intergenic
1191605193 X:63054009-63054031 CTGGCTTTAAAGAATGAGTTAGG + Intergenic
1191888619 X:65917057-65917079 CTGGCTTTACAGAATGATTTAGG + Intergenic
1191984678 X:66967282-66967304 CTGGCTGTATAGAGTGAGCTTGG + Intergenic
1192158253 X:68762803-68762825 CCTGCTGTTCAGAATGAGCCAGG - Intergenic
1192341298 X:70265717-70265739 CCGGGTGTACAGAATGAGGGTGG + Intergenic
1192540524 X:71966796-71966818 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1192540782 X:71970250-71970272 CTGGCCTCACAGAATGAGTCTGG + Intergenic
1193282202 X:79666329-79666351 CTGGCTTCATAGAATGAGGTAGG - Intergenic
1193502823 X:82300991-82301013 CTGGCTTTGCAGAATGAGTGTGG - Intergenic
1194097698 X:89663729-89663751 CTGGCTTTATAGAATGAGTTTGG + Intergenic
1194177541 X:90668934-90668956 CTGGCTACACAGAATGAGTTAGG - Intergenic
1194257173 X:91648504-91648526 CTGGCTTTATAGAATGAGTTTGG + Intergenic
1194359317 X:92929340-92929362 CTGGCTGTAAAGAAGGTGGAAGG - Intergenic
1194516465 X:94861673-94861695 CTGGCCTTACAGAATGAGTTTGG - Intergenic
1194887673 X:99337520-99337542 CTGGCTTTATAGAATGAGTTAGG + Intergenic
1197010070 X:121550073-121550095 CTGGCTGCATAGAATGAGTTGGG - Intergenic
1197034917 X:121861593-121861615 CTGGCTTTACAGAATGAGCTGGG - Intergenic
1198082998 X:133256689-133256711 CTGGCTTCACAGAATGAGTTTGG - Intergenic
1199194909 X:145016839-145016861 CTGGCCTCACAGAATGAGGTTGG - Intergenic
1200450718 Y:3325102-3325124 CTGGCTTTATAGAATGAGTTTGG + Intergenic
1200524212 Y:4251081-4251103 CTGGCTACACAGAATGAGTTAGG - Intergenic
1200575883 Y:4887774-4887796 CTGGCTTTATAGAATGAGTTTGG + Intergenic
1200667512 Y:6045175-6045197 CTGGCTGTAAAGAAGGTGGAAGG - Intergenic
1201306886 Y:12558440-12558462 CTGGCTTCACAGAATGAATCAGG + Intergenic