ID: 1092651928

View in Genome Browser
Species Human (GRCh38)
Location 12:10644169-10644191
Sequence CACCTTCTCCCTGTTCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092651928_1092651934 15 Left 1092651928 12:10644169-10644191 CCAGTAGGAACAGGGAGAAGGTG 0: 1
1: 0
2: 3
3: 23
4: 253
Right 1092651934 12:10644207-10644229 AGCATGAGGGAGTTTCTTTATGG 0: 1
1: 1
2: 7
3: 32
4: 228
1092651928_1092651930 -10 Left 1092651928 12:10644169-10644191 CCAGTAGGAACAGGGAGAAGGTG 0: 1
1: 0
2: 3
3: 23
4: 253
Right 1092651930 12:10644182-10644204 GGAGAAGGTGTGACTTTGAAGGG 0: 1
1: 0
2: 0
3: 28
4: 262
1092651928_1092651933 2 Left 1092651928 12:10644169-10644191 CCAGTAGGAACAGGGAGAAGGTG 0: 1
1: 0
2: 3
3: 23
4: 253
Right 1092651933 12:10644194-10644216 ACTTTGAAGGGGTAGCATGAGGG 0: 1
1: 1
2: 7
3: 33
4: 218
1092651928_1092651931 -9 Left 1092651928 12:10644169-10644191 CCAGTAGGAACAGGGAGAAGGTG 0: 1
1: 0
2: 3
3: 23
4: 253
Right 1092651931 12:10644183-10644205 GAGAAGGTGTGACTTTGAAGGGG 0: 1
1: 0
2: 4
3: 14
4: 284
1092651928_1092651932 1 Left 1092651928 12:10644169-10644191 CCAGTAGGAACAGGGAGAAGGTG 0: 1
1: 0
2: 3
3: 23
4: 253
Right 1092651932 12:10644193-10644215 GACTTTGAAGGGGTAGCATGAGG 0: 1
1: 0
2: 12
3: 38
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092651928 Original CRISPR CACCTTCTCCCTGTTCCTAC TGG (reversed) Intronic
900433362 1:2613176-2613198 CACTTTCTCCCTGTTTCCACCGG - Intronic
900664506 1:3805658-3805680 AACCTTCTGCCTGTTCCGCCCGG - Intergenic
900691441 1:3982920-3982942 CATCTTCTCCCTGTACCCACAGG - Intergenic
901065628 1:6492910-6492932 CCCCTTCTCCCTGTGCCCCCTGG + Intronic
901234092 1:7658218-7658240 CACCTGCTCCGAGTTCCCACAGG + Intronic
901290550 1:8120793-8120815 AACCTTCTCCATGTGCCTCCAGG - Intergenic
901529965 1:9846672-9846694 CTTCTTCTCCCTGTCCCTGCAGG - Intergenic
904805490 1:33128583-33128605 CACCCTCTTCCTGTGTCTACAGG + Intergenic
904899671 1:33846996-33847018 CATCTGCTTCCTGTTCCCACAGG - Exonic
905563436 1:38944929-38944951 CATCTTCTCCTTGTCCCTTCAGG - Intergenic
906013847 1:42555206-42555228 CACCTTCTCTCTTTTGCTTCGGG + Intronic
906513396 1:46424128-46424150 CACCTGCTCCCTGTGTCTGCGGG - Intergenic
907381079 1:54089846-54089868 CACCTTCACCATGTTCCTCTTGG + Intronic
907445809 1:54506991-54507013 CAACTTCTACCTGTTCTTCCAGG - Intergenic
910444918 1:87290491-87290513 CCCCTTCTCCCTGTCCCTGCTGG - Intergenic
913066175 1:115257481-115257503 CATCTTCTCCCTGTGTCTTCAGG + Intergenic
913573387 1:120143841-120143863 CAATTTCTCCCTGTCCCCACTGG - Intergenic
914004907 1:143724017-143724039 CACCTTGTCCCTGGACTTACTGG - Intergenic
914294644 1:146308639-146308661 CAGTTTCTCCCTGTCCCCACTGG - Intergenic
914555687 1:148759422-148759444 CAGTTTCTCCCTGTCCCCACTGG - Intergenic
915030788 1:152878998-152879020 CACCTTCTCCCTCTGCCCACAGG - Intronic
915569351 1:156735896-156735918 CACCCTCACCCTGTTCCTGAAGG - Exonic
915936959 1:160095246-160095268 CTCCTTCTGCCTTTCCCTACAGG - Exonic
916611678 1:166397900-166397922 CACCTTCTTTATGTTCTTACAGG - Intergenic
920761275 1:208785894-208785916 CATCTTGTCCCTGTCCCTGCAGG + Intergenic
921053839 1:211529353-211529375 CATCTTCTCCGTGTTGCTGCGGG + Intergenic
922026969 1:221759140-221759162 CACCTTCTCCCTCTTTTTATAGG + Intergenic
923094220 1:230761762-230761784 CACCTCCTACCCGTTCCTTCTGG - Intronic
924073136 1:240304303-240304325 CACATTCTCCCTCTTCCCAAGGG + Intronic
1063391182 10:5650770-5650792 CACCTGCTCCCTGAGCCTGCAGG + Intronic
1065245615 10:23754003-23754025 CCCCTCCTCCCTGTTCTCACTGG + Intronic
1065819040 10:29508374-29508396 CAACTCCTCCTTCTTCCTACAGG + Intronic
1069591576 10:69645313-69645335 CACCTCGTCCCAGTTCCTCCAGG + Intergenic
1070263309 10:74878924-74878946 CACCATCTCTCTATTCCCACAGG + Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1076364792 10:129914804-129914826 CACCTTCTCCCTGCACCCAACGG + Intronic
1076679734 10:132165551-132165573 CACCTTCTGCCTCATCCTTCCGG + Intronic
1076688612 10:132209364-132209386 CAGCTTCTGCCTGGTCCTGCAGG - Intronic
1077456272 11:2683031-2683053 GACCTTCTCCCACTTCTTACAGG + Intronic
1077907881 11:6547808-6547830 CACCTTCCACCTTTTTCTACTGG + Intronic
1080276011 11:30504211-30504233 AACATTTTCCCTGTTCCTGCTGG - Intronic
1080759907 11:35238401-35238423 CACCTTCACCCTCTTCTTTCTGG - Intergenic
1081907515 11:46679084-46679106 CACCTTCACCAAGTTCCTTCTGG - Exonic
1081992892 11:47347139-47347161 GACCCTCTCTCTGTTCCTTCTGG + Intronic
1082763737 11:57150093-57150115 CACCTTGTCCTTGTGCCTCCAGG - Intergenic
1083069889 11:59967060-59967082 TACCTACTCCATGTTCCTAAAGG - Intergenic
1083476186 11:62917165-62917187 CACCATCTCACTGATCCCACAGG - Intronic
1083705606 11:64512224-64512246 CTCCTGCCCCCTGTTCCTCCAGG + Intergenic
1084600514 11:70142804-70142826 CACCTTCTCCCTGTGTCCTCAGG + Intronic
1084942601 11:72620920-72620942 CACCTTCACTGTGCTCCTACTGG + Intronic
1085394639 11:76201112-76201134 CACCTTCTCCCTGAGCCTTCTGG - Intronic
1085469373 11:76747473-76747495 CTCATTTTCCCTATTCCTACAGG + Intergenic
1086530034 11:87774159-87774181 CACCTTCTGCCTTGTCCTGCTGG - Intergenic
1088832292 11:113547662-113547684 CACCTTCCCACTTGTCCTACTGG + Intergenic
1089235604 11:117022033-117022055 CACCTTCTACCTGTAACAACAGG + Intronic
1089667714 11:120030847-120030869 CTCCTCCTCCCTGTTCCCCCAGG - Intergenic
1090773565 11:129944079-129944101 CACCTTCTCACTGTCCTCACAGG - Intronic
1091779563 12:3205317-3205339 AACCTTTTCCCTGTTCCAGCAGG - Intronic
1092651928 12:10644169-10644191 CACCTTCTCCCTGTTCCTACTGG - Intronic
1093469677 12:19487221-19487243 ATCCTTCTCCCTGTTTCTAATGG + Intronic
1095977879 12:47952128-47952150 CCCCTTGTCCCTTTTCCCACAGG - Intergenic
1096113924 12:49044159-49044181 CACCTTCTCCCAGGCCCCACTGG + Intronic
1096219950 12:49822976-49822998 CACCTGCTCCCTTGTCCTAGGGG - Intronic
1096391023 12:51229153-51229175 CACCTTCTCCCTGTTGCACCGGG - Intergenic
1096465929 12:51847879-51847901 CACCTTCACCCTGGGGCTACAGG - Intergenic
1097066430 12:56323974-56323996 CACCCTCTCCCTGATATTACAGG + Intronic
1099018256 12:77371448-77371470 CACCCTCTCCCTCTTCCCACTGG - Intergenic
1100405864 12:94272525-94272547 CACCATCTCCCAGTGCCTCCTGG + Intronic
1100406073 12:94273940-94273962 CACCATCTCCCAGTACCTCCTGG + Intronic
1100548377 12:95624301-95624323 CACCTCCTCCCTGCACCTGCAGG + Intergenic
1100623021 12:96298893-96298915 CACCTTCTTCATGTTCCAATCGG + Exonic
1101071492 12:101080592-101080614 CATCTTCTCCCTGTGTCTTCAGG + Intronic
1101717830 12:107326413-107326435 CACTGTCTCCCTCTACCTACTGG - Intronic
1102055718 12:109895030-109895052 CACCTCCTCCCAGTTCCTCAAGG - Intergenic
1102688778 12:114744169-114744191 CACCTTTCCCCTTTTCCCACAGG - Intergenic
1105320972 13:19321918-19321940 CATCTTCTGCCTTTTCCTCCTGG + Intergenic
1105465193 13:20633401-20633423 CACCTTGTCCCCCTTCCTAGAGG - Intronic
1106343453 13:28853325-28853347 CTTGTTCTCCATGTTCCTACTGG + Intronic
1107306176 13:39022316-39022338 AACATTTTACCTGTTCCTACAGG + Exonic
1108344206 13:49528780-49528802 CAGCTCTTCCCTGTTCTTACTGG + Exonic
1109561246 13:64052899-64052921 CTCCTTCTCCCTGTACAAACTGG - Intergenic
1112549242 13:100404230-100404252 CTCCTTCTCCCTGTGCAAACTGG - Intronic
1113469112 13:110531813-110531835 GACCTTCTCCCTGGTCCTGGGGG + Intronic
1114618725 14:24082233-24082255 TATCTTCTCCCTGCTCCTCCTGG + Intronic
1115536185 14:34375608-34375630 CACCTTTTCCCTTTCCCTAAAGG - Intronic
1116182389 14:41551438-41551460 CACTTTCTCCTTCTTCATACAGG - Intergenic
1117503525 14:56377521-56377543 CCCCTTTTCCCTGTTACTAGTGG + Intergenic
1118550020 14:66939996-66940018 CCCCTTCTCCCTGTACAGACTGG - Intronic
1118927292 14:70204163-70204185 CTCCTTCTCCCGGTTCCTCAAGG - Intergenic
1119436961 14:74603799-74603821 CAGCCTCTCCATGTTCCTCCAGG - Intronic
1120142867 14:80947780-80947802 GACTTTCTCCCTATGCCTACAGG - Intronic
1121001708 14:90455787-90455809 CACCCTCACCCTGGTCCCACTGG - Intergenic
1121209757 14:92199455-92199477 CTCCTCCTTCCTGTTCCTTCTGG - Intergenic
1121452317 14:94016826-94016848 CTCCAACTCCCTGTGCCTACCGG + Intergenic
1121748417 14:96322626-96322648 CACCTCCTTCCTCTTCCTCCTGG + Exonic
1122166348 14:99827252-99827274 CATCTTCTCCCTGTGTCTTCAGG - Intronic
1122530022 14:102418937-102418959 CTCCTTCTCCCCGTGCCTCCAGG - Intronic
1122802459 14:104238506-104238528 CACCTCCTCCCTGTTCCTCCGGG + Intergenic
1123026662 14:105427618-105427640 CACCGTACCTCTGTTCCTACAGG - Intronic
1125744271 15:41988121-41988143 CATCTTCTCCCTGAACCTGCTGG - Exonic
1126424849 15:48516257-48516279 CCAGTTCTCCCTGTTCCTCCTGG - Exonic
1127614418 15:60669585-60669607 AACCTGCTCTCTGTTCTTACTGG + Intronic
1128358703 15:66945695-66945717 CACCCTCTCCCTGATCCTGAGGG + Intergenic
1128449905 15:67799452-67799474 CACCTGCTCTCTCTTCCTCCCGG - Intronic
1128764077 15:70240363-70240385 CCACTTCTCCCTGTTCTTCCTGG + Intergenic
1132310312 15:100852814-100852836 CACCTTTACCCTGGTCCTCCAGG - Intergenic
1132675401 16:1119287-1119309 CACCTTCCCCCGGTGGCTACTGG - Intergenic
1136145264 16:28312696-28312718 CTCCTTGCCCCTGTTCCAACAGG - Intronic
1136452396 16:30360792-30360814 TGCCTTCTCCCTGTTGCTATGGG + Intronic
1137289459 16:47042022-47042044 AACCTTCTCCCTGACCCTGCTGG + Intergenic
1140153011 16:72391288-72391310 CACCTGCTCTCTGTCCCTCCTGG + Intergenic
1141533488 16:84662581-84662603 CACCTCCTCCCCGTTCCTGGTGG - Intronic
1142066505 16:88065923-88065945 CACCTCCTTCCTGTCCCTCCTGG + Intronic
1142152029 16:88516880-88516902 CACCCTGTCCCTGTTCATCCCGG - Intronic
1142642112 17:1290236-1290258 CACTGGCTCCCTGTTCCTGCAGG + Intronic
1143321732 17:6072726-6072748 CACCTTCTCCCTGGGCCTCCTGG + Intronic
1143499488 17:7330441-7330463 CACCTTCTCCATGGCCCCACTGG - Intergenic
1143967792 17:10769279-10769301 CACCATTTCCTTTTTCCTACAGG + Intergenic
1145864557 17:28232401-28232423 CACGTTCTCCCTTTTTCTAATGG + Intergenic
1146469863 17:33115455-33115477 CACTTTCTCCCTGCTCTCACAGG + Intronic
1147132179 17:38415895-38415917 TACCTTCTCCCTGTTCCCCAGGG + Intergenic
1147732179 17:42610536-42610558 CTCCTCCTCCATGTTCCGACAGG - Exonic
1147739138 17:42660262-42660284 CTCCTCCTCCATGTTCCGACAGG - Exonic
1149679460 17:58495267-58495289 CACCTTCTCTCTGAGCCCACTGG + Exonic
1149731187 17:58947816-58947838 CACCTTATCTCTGTTCCAACTGG + Intronic
1150222986 17:63507752-63507774 CACATGCTCCCTGGTCCTAGGGG + Intronic
1152313532 17:79566125-79566147 CACCTTCTCCCTGTTCCTTGTGG - Intergenic
1152784071 17:82238991-82239013 TACCTCCTCCCTGTGCCTGCCGG - Exonic
1155724497 18:29062659-29062681 CACCTTTGCCCAGTACCTACAGG - Intergenic
1155901401 18:31395607-31395629 CACCTTCTCCATTTTCATTCGGG + Intronic
1156198109 18:34798493-34798515 CACCTTCTCCCTGCTTCCCCAGG + Intronic
1156520929 18:37721796-37721818 CAGCTTCTCCCTGTCCCTTGTGG + Intergenic
1160076086 18:75679219-75679241 CAGCTCCTCCCTGTTCCTTCAGG + Intergenic
1167796417 19:51712641-51712663 CACCTTCTTCCTGTTGCTGAGGG - Intergenic
1168299889 19:55398407-55398429 TACCATCTCACTGTTCCAACTGG + Intronic
924990706 2:310393-310415 AGCCATCTCCCTGTTCCGACAGG - Intergenic
925213724 2:2073850-2073872 AACTTTCTCCCTGTTCCTCATGG + Intronic
925300086 2:2805522-2805544 CTCCTTCTCCTTGATTCTACTGG - Intergenic
925778142 2:7355077-7355099 CACCTACTCCCTGGTGCTTCAGG + Intergenic
926314760 2:11701109-11701131 CACATGCTCCCTTTTCCTCCTGG + Intronic
927105092 2:19817344-19817366 CAGCTTCCCCCAGCTCCTACAGG - Intergenic
928353503 2:30585745-30585767 CACCTTATCCCTGTTGCTCTTGG + Intronic
928759929 2:34570312-34570334 CACCTTCTCCCAGTTCCTAAAGG + Intergenic
929865349 2:45712715-45712737 CAGCTCCTCCCTGTACCTACAGG + Intronic
932337435 2:70939041-70939063 CACCTCCTCCCTGATCCCGCTGG - Intronic
932993754 2:76821870-76821892 CTCTCTCTCCCTGTTCCTCCTGG + Intronic
934077030 2:88437215-88437237 CACCTTTTACCTGTTGCTTCAGG + Intergenic
935058763 2:99590320-99590342 CACCTCCTGCCTGTTTCTGCAGG - Intronic
935294714 2:101638960-101638982 CACCTTCTCTGTGTTCCTCCAGG - Intergenic
936098630 2:109554603-109554625 CATATTCTCCCTGTATCTACAGG - Intronic
936626374 2:114153713-114153735 CACCTTCCCCCTATTGCTTCTGG + Intergenic
936952829 2:117995249-117995271 CAGGTTCTCCCTGTGCATACTGG + Intronic
937888557 2:126917046-126917068 CAGCCTCAGCCTGTTCCTACGGG - Intergenic
938615804 2:132997037-132997059 CAGCTTCTCCCTCTTACTAAGGG + Intronic
940327262 2:152438428-152438450 TACTTTCTCCCTCTTCCTCCAGG - Intronic
945266447 2:207895740-207895762 TACCTTCTGCATGTTCTTACTGG + Intronic
947121588 2:226820973-226820995 AACCTTCCCTCTGTTCCTCCAGG + Intergenic
947830821 2:233140288-233140310 CACCTTCATCCTGCTCCTCCTGG - Intronic
948607949 2:239147740-239147762 CACCTGCTCCCTGTTCCCTAAGG - Intronic
948797429 2:240412141-240412163 CACCTTCTCCCGGATCCTCCAGG + Intergenic
948907864 2:240988392-240988414 CCCCTTCTCAGTGTTCCTCCAGG - Intronic
949003330 2:241630457-241630479 CAGCTTCTCTCTGTTCCTCTTGG - Intronic
1168947806 20:1776425-1776447 CACTCTGTCTCTGTTCCTACTGG - Intergenic
1169171430 20:3468873-3468895 CACATACTCCCCATTCCTACAGG - Intergenic
1170464828 20:16612929-16612951 CAGCTTCTCCCAGTTCCTCAGGG - Intergenic
1173909203 20:46651529-46651551 CGCCCTCTCCCTGCTCCTCCTGG + Intronic
1174393723 20:50233617-50233639 CTCCTTCTCCCTGTTCCACGTGG + Intergenic
1174783972 20:53415457-53415479 CCCCTTCTTCCTCTTCCTCCAGG + Intronic
1175303724 20:57961362-57961384 CACCTGCTACCTGTTCCCAGGGG - Intergenic
1176109790 20:63406031-63406053 CGTCTTCTCCCTGTACCTTCTGG - Intronic
1179156763 21:38857769-38857791 CACCTTCTCCATGGACCTGCTGG - Intergenic
1179937033 21:44612568-44612590 CACCTTCTCCCCATGCCAACAGG + Exonic
1180599569 22:17007462-17007484 CACCCTCTCCCTTTCCCTCCCGG - Intronic
1181621428 22:24094137-24094159 CAGCTCCTCTCTGTTCCTGCAGG - Intronic
1181638815 22:24186453-24186475 CACCTCCTCCCCATTCCTGCAGG + Intronic
1181997704 22:26895940-26895962 CACCATCTCCCTGGTCCTATCGG + Intergenic
1182711997 22:32328990-32329012 CTCCTGCTTCCTCTTCCTACTGG + Intergenic
1184399541 22:44265874-44265896 CTCCTGCTTCCTCTTCCTACTGG + Intronic
1184607788 22:45584073-45584095 CACCTCCTCCCAGTTCCTTAAGG - Intronic
1185281755 22:49972646-49972668 CTCCTCCTCCCTGGTCCCACTGG + Intergenic
949684727 3:6555734-6555756 CACCTCCTACCTGTTCCTTGAGG + Intergenic
950986423 3:17373840-17373862 CTCCATTTCCCTGTTCCTACAGG - Intronic
951482360 3:23174762-23174784 TACCTTCTGCCTGCTCCCACAGG - Intergenic
952159794 3:30682099-30682121 GCCCTTCTGCCTGTTCCTCCTGG + Intronic
952399117 3:32947663-32947685 TACCTTGTCCCTGTTACTCCTGG + Intergenic
953200812 3:40777080-40777102 CATCTTCTCCATGTTGCCACAGG - Intergenic
953236417 3:41111382-41111404 CAGCCTCTACCTGGTCCTACAGG - Intergenic
954417750 3:50402205-50402227 CACCCTCTCCCTGTTCACACTGG - Intronic
955350417 3:58189289-58189311 GACCTTCTCCCTGACCCTGCTGG - Intergenic
961426817 3:126854923-126854945 CACCTTCTACCTGTTGAGACTGG + Intronic
966074039 3:175914744-175914766 CACCTTCTCCATATTGCTATAGG + Intergenic
966486465 3:180476503-180476525 CACCTTCTCTCTGTTTCTCTTGG - Intergenic
968815025 4:2817746-2817768 CACCTTCTCCACTTTCCTGCGGG - Intronic
970609798 4:17714454-17714476 GGCCTTCTCCCTGGTCCTTCAGG - Intronic
970990962 4:22212656-22212678 CCCTTTCTCCCTCTACCTACTGG - Intergenic
974287192 4:59883710-59883732 CTCCTTCTCACAGTTCCTGCTGG + Intergenic
975454066 4:74568448-74568470 TACCTTTTCCCTGATCTTACAGG - Intergenic
975948336 4:79736702-79736724 CCCCTTCTCTCTCTTCCTCCTGG + Intergenic
977369373 4:96115675-96115697 TACCTGCTCACTGTGCCTACTGG + Intergenic
978498331 4:109384010-109384032 CACCTGTTCCCAGTTCCCACCGG - Intergenic
984031343 4:174607582-174607604 CACCTTCTCCATTTTCCTTAAGG - Intergenic
985510951 5:313617-313639 CACCCTGTCCATGTTCCTGCAGG + Intronic
985891370 5:2717639-2717661 CACCTCCCCTCTGTTCCCACTGG + Intergenic
986865221 5:11978272-11978294 CACCTTCTCCATCTTATTACTGG + Intergenic
986982607 5:13466534-13466556 CAGATTCTCCCTGCTCCTTCAGG - Intergenic
988284512 5:29194027-29194049 CAGCAACTCCCTGTTCATACTGG - Intergenic
988736055 5:34022534-34022556 CCCCATCTCCCTGTCCCTATGGG - Intronic
990019396 5:51106788-51106810 CAGCCTCTTCCTGGTCCTACTGG + Intergenic
990609002 5:57439150-57439172 CTCCTTCTCCCTATTTCTCCTGG + Intergenic
992506422 5:77391573-77391595 CTGCTTCTCCCTGTACCTAGTGG + Intronic
992995172 5:82325319-82325341 CACATTCTCACTGTGCCTTCTGG + Intronic
995016401 5:107314343-107314365 CAGCTCCTCCCTGTTTCTGCTGG - Intergenic
997573878 5:134957830-134957852 AACTTTCTCCCTTTTCCTATAGG + Intronic
1000307740 5:160010687-160010709 CCTCTTCTCCCTGGTCCTCCTGG - Exonic
1002548726 5:179971275-179971297 CACCTTCTCCCTGTTTGGCCAGG - Intronic
1003195970 6:3915308-3915330 CACCTCCTCCCAGTTCCTCAAGG + Intergenic
1003557325 6:7151702-7151724 CACCTTCTCCCTGACCCTGCAGG - Intronic
1003833188 6:10037613-10037635 CAGATTCTCCCTGTTCCTAAAGG - Intronic
1005172561 6:23004987-23005009 CACCTTTTCTCTGTCCCTACAGG + Intergenic
1005647752 6:27857335-27857357 CATCTTCTCCCTGTGTCTCCAGG - Intronic
1006068482 6:31479404-31479426 TCACTTCTCCCTGTTCCTGCTGG - Intergenic
1007100215 6:39240802-39240824 CAACATCTTCCTGTTCCTCCAGG - Intergenic
1007200820 6:40107093-40107115 TTCCTTTCCCCTGTTCCTACAGG - Intergenic
1007380824 6:41488962-41488984 CACCTGGTCCCTGCTCCTGCTGG - Intergenic
1007795204 6:44341580-44341602 CAACTTCTGCCTGGTCCTCCTGG + Intronic
1010258079 6:73783153-73783175 CCCCTTCTCCCTGTGACTCCTGG - Intronic
1012223060 6:96674403-96674425 CACCTTCTCCCTGCTATAACTGG - Intergenic
1012804717 6:103879296-103879318 CTCCTTCTCCCTGTGCAAACTGG + Intergenic
1013301746 6:108810454-108810476 GATCTTCTCCCTGGTCTTACTGG - Intergenic
1013462933 6:110392976-110392998 CACCTTCTCCCTGATGTTGCAGG + Exonic
1017163486 6:151388276-151388298 CAGCTTTTCCAAGTTCCTACAGG + Intronic
1017443039 6:154482167-154482189 CACATTCTCCCTATGCCTAAGGG + Intronic
1017952427 6:159147276-159147298 CCCCTTCTCCAGCTTCCTACCGG - Intergenic
1018362642 6:163087414-163087436 CACCTTCTCTCTTTTCATCCTGG - Intronic
1018889079 6:167968768-167968790 AACATTTGCCCTGTTCCTACTGG - Intronic
1019254837 7:42814-42836 CACCTTTTCTCTGTTTTTACTGG - Intergenic
1019922957 7:4174479-4174501 CGCCTGCTCCCTGTTCCTGAGGG - Intronic
1021081826 7:16373794-16373816 CTTCTTCTCCCTGTTTCTTCTGG - Intronic
1021412955 7:20348809-20348831 CATATTCTCCTTGTTCCCACTGG - Intronic
1022089346 7:27097316-27097338 CACCTCCTCCCCTTTCCAACTGG + Intergenic
1026462685 7:70628895-70628917 CACCCCCTCCCTGTTCCATCAGG - Intronic
1026895523 7:74007992-74008014 CACCTTCCTCCTGGTCCTAGAGG - Intergenic
1028490474 7:91405868-91405890 CTCCTTCTCCCTTGTCCAACTGG + Intergenic
1029231195 7:99070247-99070269 CACCTGCTGCCTGTCCCCACGGG + Intronic
1029331499 7:99860006-99860028 CACCTTCTCCCTCCTTCTCCAGG - Intronic
1029420897 7:100471347-100471369 CACCTTCTCCACTGTCCTACTGG - Intronic
1029498608 7:100912973-100912995 TATTTTCTCCCTGTACCTACAGG - Intergenic
1031991751 7:128203143-128203165 CACCTTCCCCGTGTCCCTCCTGG - Intergenic
1032005596 7:128299879-128299901 CATCTTCTCCCTGTGTCTATAGG - Exonic
1034433463 7:151052109-151052131 CACCTTCCCCCTCATCCTAGGGG - Intronic
1038435378 8:27532122-27532144 CACCTGCTGCCTGTTGCTCCTGG + Intronic
1038662075 8:29506096-29506118 AACCTTCTCCCTGCTTCTTCTGG + Intergenic
1039364437 8:36915633-36915655 CTCCTTCACCCTGTTCACACTGG + Intronic
1041778232 8:61548208-61548230 CACATTCTTTCTGTTCCTTCAGG - Exonic
1042152843 8:65807595-65807617 TACCTTGTTCCTGGTCCTACAGG + Intronic
1042685035 8:71428888-71428910 CACCTTTTCCATATTCCTAGGGG + Intronic
1043735153 8:83731514-83731536 CACCTGCTCCTTGCTCCTGCTGG + Intergenic
1044609209 8:94075701-94075723 CACCTTCTCTCACTTCCAACTGG + Intergenic
1046394506 8:113624933-113624955 GACCGTCTCCCAGGTCCTACAGG - Intergenic
1047432988 8:124808777-124808799 CACCTTCTTTGTCTTCCTACTGG + Intergenic
1047524795 8:125623599-125623621 CCCTTTCTCCTTCTTCCTACTGG + Intergenic
1049514301 8:143045305-143045327 GACCTTGTCCCTGGTCCTGCTGG - Intronic
1051607002 9:18926347-18926369 CACCTTCTGTCTGAGCCTACTGG - Intergenic
1055424533 9:76180616-76180638 CACCTTCTCCCTCCTCCTTCAGG + Intronic
1055647213 9:78372613-78372635 CACTTTCTCCCTGTTCCTTGGGG + Intergenic
1056288300 9:85113982-85114004 CACCTCCTCCCAGTTCCTCAAGG + Intergenic
1059196972 9:112379792-112379814 CACCTTTTCCCTGTCTCTAGGGG - Intergenic
1060993464 9:127862150-127862172 GACCTTCTCCCTGTGCCCAGGGG - Intergenic
1185870622 X:3662176-3662198 CACCTTCTACCTGGTCTTACAGG - Intronic
1187015510 X:15323838-15323860 TACCTTCTCCATGTTCCACCTGG + Intronic
1188641418 X:32510243-32510265 TACCTTTTCCCTGATGCTACAGG + Intronic
1189689340 X:43599571-43599593 CCTCTACACCCTGTTCCTACAGG - Intergenic
1192184377 X:68936726-68936748 CTCCTTCTCCCTGTGCCTGGTGG + Intergenic
1195731683 X:107974687-107974709 CACCATCTCCCTGTGACTGCAGG - Intergenic
1197548421 X:127856798-127856820 CACCTTCTCTTTGTCCTTACAGG + Intergenic
1197717587 X:129720446-129720468 CACCCTCTCCCTTTCCCCACCGG - Intergenic
1199206026 X:145149053-145149075 CACTGTCTCCCTTTTCCTAGGGG - Intergenic
1199765160 X:150936033-150936055 CACTTTCTCTCTGTCCCGACTGG + Intergenic
1200791754 Y:7305371-7305393 CACCTTCTACCTTCTACTACAGG - Intergenic
1201231638 Y:11870623-11870645 CACCTTCTCTCTATTCTTTCTGG + Intergenic