ID: 1092656389

View in Genome Browser
Species Human (GRCh38)
Location 12:10689319-10689341
Sequence ATTGGATCTTGGGGTAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092656389_1092656394 -4 Left 1092656389 12:10689319-10689341 CCTCTGCTACCCCAAGATCCAAT No data
Right 1092656394 12:10689338-10689360 CAATTACTCCTACTGCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092656389 Original CRISPR ATTGGATCTTGGGGTAGCAG AGG (reversed) Intergenic
No off target data available for this crispr