ID: 1092656973

View in Genome Browser
Species Human (GRCh38)
Location 12:10696162-10696184
Sequence TTGAAGAAGTTGCAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 349}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092656973_1092656980 9 Left 1092656973 12:10696162-10696184 CCTTCCTCTTGCAACTTCTTCAA 0: 1
1: 0
2: 0
3: 32
4: 349
Right 1092656980 12:10696194-10696216 CCCCTGTGCACGCATGTCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092656973 Original CRISPR TTGAAGAAGTTGCAAGAGGA AGG (reversed) Intergenic
901082667 1:6592466-6592488 TAGAAGAAGTGGGAAGAAGAAGG - Exonic
902586384 1:17440951-17440973 TTCAAGAAGTTGCCTGAAGAAGG - Intergenic
902829472 1:19001584-19001606 TTTAAGAAGTTGAAAAATGAGGG - Intergenic
905115020 1:35631141-35631163 ATGAACAAGTAGCAACAGGAGGG + Intronic
905668363 1:39775737-39775759 TGGAACAAGCTGGAAGAGGAAGG + Intronic
906013553 1:42552622-42552644 TTGAGGTAATTGCAGGAGGAAGG + Intronic
906869676 1:49464381-49464403 GTGAAGAAGTTACAAGATGAGGG + Intronic
907226790 1:52955214-52955236 TTGAAGAACTAGCAAGAGAGAGG + Intronic
907530413 1:55090019-55090041 TTGATGAAGATGCAGAAGGAAGG - Intronic
909718302 1:78736814-78736836 TTGAGGGAGTTGCAGAAGGAGGG - Intergenic
910838360 1:91537964-91537986 ATGATGAAGTTGCAATAAGAAGG + Intergenic
911215285 1:95186391-95186413 TAGATGAAGTGGCAAGAGAACGG + Intronic
912113417 1:106372493-106372515 TTCAAGCAGATGCAAGAGGTGGG + Intergenic
912488217 1:110046171-110046193 TTACTGTAGTTGCAAGAGGAAGG + Intronic
912731693 1:112112621-112112643 TTGGAGAAGATGCAAGTGGCTGG - Intergenic
913382938 1:118230209-118230231 TTGAAGTAGTAGCAAAAGGCTGG + Intergenic
916268333 1:162914912-162914934 TAGAAGATGTTGGAGGAGGATGG + Intergenic
916508452 1:165449533-165449555 TTGAATAAGTGGAAAGAGCATGG + Intergenic
916620201 1:166488792-166488814 GTGGGGAAGTTGGAAGAGGATGG - Intergenic
916624480 1:166540234-166540256 CTGTAGAAGGTGCAAGAGAAAGG + Intergenic
917672785 1:177288987-177289009 TTGAAGAAGAGGCAAGGGAAGGG + Intergenic
918011310 1:180589402-180589424 GTGAAGAAATTCCAAGAGGCAGG + Intergenic
918281855 1:183014469-183014491 TTGAACAAATTGGAAAAGGAGGG - Intergenic
918527417 1:185480038-185480060 TTGAAGTTGTTCCAAGAGAAAGG + Intergenic
919219332 1:194606390-194606412 TTCAACCAGTTGCAAGAGAATGG - Intergenic
920642371 1:207764903-207764925 TTCAAGAAAGTGCAAGAGGAGGG + Intronic
920955546 1:210617383-210617405 TTGATGAAGTAGAGAGAGGAAGG + Intronic
921405205 1:214771566-214771588 ATGTAGAAGTTGCAGGAGAATGG - Intergenic
921781141 1:219165988-219166010 TTGAAGAAGTAAATAGAGGAGGG + Intergenic
923046878 1:230362149-230362171 CTGCTGAAGTTGCAAGAGCATGG - Intronic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923755707 1:236789338-236789360 TTAAAGAAGTTACTAGAAGAAGG - Intergenic
924310123 1:242732188-242732210 TTGAAGCAGTTGTATGATGATGG - Intergenic
924499813 1:244626724-244626746 GTGAAGAAGCTGCAGAAGGAAGG - Intronic
1068636436 10:59353129-59353151 CTGAAGAAGATGGAAGAGGGCGG + Intronic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1068869243 10:61925989-61926011 TGGAAAAGGTTGGAAGAGGAGGG + Intronic
1069269352 10:66505649-66505671 TTCAAGATGTTACAATAGGAAGG - Intronic
1070824528 10:79383030-79383052 AAGAAGAAGGTGCAAGAGAATGG + Exonic
1071815156 10:89225016-89225038 CTGAAGAAATGGCAAGGGGAGGG - Intronic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1077825269 11:5801127-5801149 GTGAAGAAGTTGAAAAAGGCTGG - Intronic
1077905566 11:6530252-6530274 GGGTAGAAGTGGCAAGAGGAGGG - Intronic
1078636272 11:13053350-13053372 ATGAAGACTTTGCAGGAGGAAGG + Intergenic
1078777874 11:14410368-14410390 TTCAAGAAATAGCAAGATGATGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1082151355 11:48744005-48744027 TTGCAGATGCTACAAGAGGAAGG + Intergenic
1082168985 11:48978996-48979018 TTGGAGAGGCTGCAAAAGGAGGG - Intergenic
1082181038 11:49119974-49119996 TTGAACAAATGGGAAGAGGAAGG + Intergenic
1083090655 11:60196316-60196338 TTGAAGAGATTCAAAGAGGAAGG + Intergenic
1085121440 11:73969971-73969993 TTCAAGAAGGTGCCAGGGGAGGG + Exonic
1085129551 11:74026394-74026416 CTGAGGAGGTTGGAAGAGGATGG + Intronic
1086335020 11:85791928-85791950 TTACAAAAGTTGCAAGAGAAAGG + Intronic
1086684451 11:89714899-89714921 TTGAACAAATGGGAAGAGGAAGG - Intronic
1086759641 11:90611974-90611996 TTGAGGGAATTGCAAGATGAAGG + Intergenic
1086794279 11:91081196-91081218 TTTAAGAAGTTGCAAAGGGTAGG - Intergenic
1087050044 11:93877543-93877565 CAGCAGAAGTTGCAAGAGAAAGG + Intergenic
1087240293 11:95767510-95767532 TTCAATAAGTTGCAAGCAGAGGG - Intergenic
1087326283 11:96727484-96727506 GGGAAGAAGTTTCCAGAGGAAGG - Intergenic
1088636372 11:111824832-111824854 TTTATTAAGTTGCATGAGGAAGG + Intronic
1088809938 11:113385449-113385471 TGGGAGAAGTTGTAAGTGGAGGG - Intergenic
1089075777 11:115737331-115737353 TTGAAAAAGATGTCAGAGGAAGG + Intergenic
1090622240 11:128570783-128570805 CTGAAGAAGTTGCCAGAAAAGGG - Intronic
1092083982 12:5740698-5740720 TTGAAGGAGTGGGCAGAGGAAGG + Intronic
1092656973 12:10696162-10696184 TTGAAGAAGTTGCAAGAGGAAGG - Intergenic
1093359995 12:18212866-18212888 TTCAAAAAATTGGAAGAGGAGGG + Intronic
1093392258 12:18636972-18636994 TTGAAGAAGTAACCATAGGATGG + Intronic
1093425149 12:19020289-19020311 GTGAAGAAGGAGCGAGAGGAAGG - Intergenic
1094170831 12:27489981-27490003 TGGAATAATATGCAAGAGGAAGG + Intronic
1094524821 12:31224651-31224673 TTGAAGATGTGGGAAGAGCAGGG + Intergenic
1094586527 12:31782221-31782243 TGGAAGAAGATGCAAGTGGCTGG + Intergenic
1095243362 12:39887620-39887642 TAGAAGAAGCTGTAAGAAGAAGG - Intronic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1096221385 12:49830265-49830287 TTCAGGAAGTTGCCAGGGGAGGG - Intergenic
1099313315 12:81054610-81054632 TTGAAGAAGGTAGGAGAGGAAGG - Intronic
1099370801 12:81827426-81827448 TTGTAAAACTTGCAAGAGGCTGG - Intergenic
1099720609 12:86357114-86357136 TTGAAAAAGCTTCCAGAGGAAGG + Intronic
1100112796 12:91265800-91265822 TTGAAGAATTTTGAAGAAGAGGG + Intergenic
1100902810 12:99262083-99262105 TTGAAGAAGGTGTTGGAGGAGGG - Intronic
1101629432 12:106478578-106478600 TTGATGAAGCTGTAAGAGAAGGG - Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102468821 12:113147632-113147654 ATGTAGAAGTTGCCAGAGGCTGG + Intergenic
1103102099 12:118186673-118186695 TTGAAGAATTAGGAAAAGGAAGG - Intronic
1104107381 12:125675858-125675880 TTTGAGAAGGTGCAGGAGGATGG + Intergenic
1104200944 12:126588375-126588397 TGGAAGAACTTGCAAGACAAGGG - Intergenic
1104226859 12:126843475-126843497 TTGAACAAGTTAAAGGAGGAAGG - Intergenic
1104270379 12:127278030-127278052 TTGATGACGTGGCAGGAGGAGGG + Intergenic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106234286 13:27848601-27848623 TAGAAGGAGATGGAAGAGGATGG + Intergenic
1108190994 13:47938898-47938920 TGAAAGAAGTTGCAAAATGATGG - Intronic
1109731640 13:66420463-66420485 TTGATGAAGCTTCCAGAGGAAGG + Intronic
1110348487 13:74477442-74477464 TTGAAGAATTTGCAAGAGATAGG - Intergenic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1110954249 13:81534246-81534268 TTGTAGATGTTGTAAGATGAGGG - Intergenic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112829410 13:103429989-103430011 TTGTAAAACTTGCAAGAGGTTGG + Intergenic
1113070037 13:106411428-106411450 ATGAAGAGGCTGCAAGAGGGTGG - Intergenic
1113283337 13:108815483-108815505 TTGAAGATGGTGGAAGGGGAGGG + Intronic
1113361329 13:109634433-109634455 TTTAAGAAGTTGTTAGAGGGAGG - Intergenic
1113396983 13:109956901-109956923 TTGATGAAGCTGCTAGAGGCTGG + Intergenic
1113453516 13:110430657-110430679 TTGAAGAAGTGGCATCTGGAAGG - Intronic
1113519453 13:110929295-110929317 TAGAGGATGTGGCAAGAGGAAGG + Intergenic
1114767907 14:25395290-25395312 ATCAAAAAGGTGCAAGAGGAAGG - Intergenic
1116253432 14:42517483-42517505 AGGCAGAAGGTGCAAGAGGAAGG + Intergenic
1116964194 14:50997765-50997787 TTGAAGAAGCTGAAAAATGAAGG - Intronic
1117266679 14:54095540-54095562 TTAAAGAAGCTGAAAGAAGATGG - Intergenic
1118798417 14:69166801-69166823 TGGAAGAATTTGGAAGGGGAGGG + Intergenic
1119958443 14:78826338-78826360 TTGCAGCAGTTGCTAGAGGGAGG + Intronic
1121615646 14:95311809-95311831 ATGAAGAAGGTGGCAGAGGATGG - Intronic
1123408457 15:20038932-20038954 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123517781 15:21045573-21045595 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1128611189 15:69074705-69074727 TTGAAGCATTAGCAAGAGGGTGG - Intergenic
1128941371 15:71790486-71790508 ATGAAGAACAGGCAAGAGGAAGG + Intergenic
1129947166 15:79549307-79549329 TTGAAGCATTGGCAAGAGCATGG - Intergenic
1130032209 15:80326513-80326535 TCTTACAAGTTGCAAGAGGATGG - Intergenic
1132908125 16:2294354-2294376 TAGAAGAAGTCACAAGAGAAAGG + Intronic
1134264608 16:12682415-12682437 CTGTAGAATATGCAAGAGGAGGG + Intronic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137917234 16:52445411-52445433 GTGGAGGAGTTGCAAGGGGAAGG + Intronic
1137917484 16:52448596-52448618 TTGAAGGGGTTTCAAGATGAAGG - Intronic
1139092101 16:63660612-63660634 TAGAAGAATTTCAAAGAGGAGGG + Intergenic
1141143689 16:81514339-81514361 TTCCAGAAGTGGCATGAGGAGGG + Intronic
1142682941 17:1561301-1561323 TGGAAGGAGTTGCAGGATGACGG - Intronic
1142755753 17:2015490-2015512 TTGGAGAGGTGGCAAGAGGAGGG + Intronic
1143131719 17:4682685-4682707 TTGAAGAAGTGAGAAGAGGGAGG - Intronic
1143993124 17:10983975-10983997 CTGTAGAAGTTGGAAGAAGAGGG - Intergenic
1146123961 17:30217699-30217721 TGGAAGAAGATGCTTGAGGAAGG - Intronic
1146564493 17:33900731-33900753 TTGAAGAAGTTGGAGGTGGGAGG + Intronic
1147177047 17:38662438-38662460 TTGAGGAACTTGGATGAGGAAGG - Intergenic
1147559291 17:41499159-41499181 ATGAAGATGGTGCCAGAGGAAGG + Intergenic
1148017715 17:44534086-44534108 CTGGAGAAGTTGGAATAGGATGG - Intergenic
1148671736 17:49415529-49415551 TTGGAAAAGTTGCAAGAATAGGG + Intronic
1149754526 17:59176054-59176076 ATGTAAAAGTTGCAAGATGAGGG + Intronic
1150003839 17:61457579-61457601 TGGAAGAAGTTCCACGAGGCGGG + Exonic
1151398423 17:73840259-73840281 CTGAAGAGGTTGCATGAGGAAGG + Intergenic
1152055158 17:78018884-78018906 TTTAAGCAGTTACAAGAGGGGGG + Intronic
1153186097 18:2488037-2488059 TTGAAGAAATTGCAATAGTCAGG + Intergenic
1154477250 18:14774351-14774373 TTTAAAAAGGTGAAAGAGGAGGG - Intronic
1156754699 18:40508253-40508275 TTGAAAAAATTGGTAGAGGATGG - Intergenic
1157238013 18:45982174-45982196 TTGAAGAAGTAGTGATAGGATGG + Intergenic
1158762903 18:60411403-60411425 TTCAAGAAGTTTCGAGAGGCAGG + Intergenic
1158853464 18:61518398-61518420 GTGAAGAAGCTTCAAGAGGAAGG + Intronic
1159086336 18:63795903-63795925 TTGAAAAATTTGCAGCAGGAAGG + Intronic
1161955216 19:7490171-7490193 TTGGAGAAGTGACAAGACGAAGG - Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164342007 19:24412053-24412075 TTGTAGAATCTGCAAGAGGATGG + Intergenic
1166661215 19:44648395-44648417 TTGCTCAAGTTCCAAGAGGAAGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
924989703 2:302123-302145 GTGAAGAAGCTGCATAAGGAAGG + Intergenic
925484176 2:4309913-4309935 TTGGAGTAGTTTCAGGAGGAAGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926023824 2:9521198-9521220 GTGAAGATGTTGCTAGAGGTAGG - Exonic
926985270 2:18615913-18615935 TAGATGAAGTTGCAAGGGTAGGG + Intergenic
928000664 2:27520472-27520494 GTGAAGAAGTAGGAAGGGGAGGG + Intronic
928199242 2:29236675-29236697 TAGGAGAGGATGCAAGAGGATGG - Intronic
928236128 2:29542444-29542466 CTGAAGAAGTTTCCTGAGGATGG - Intronic
928785543 2:34881207-34881229 TTAAAGAAGGAGCAAAAGGAAGG - Intergenic
930477429 2:51901225-51901247 ATGAAGAATTTACAAGAGAAAGG + Intergenic
931117572 2:59181256-59181278 TGGAAGAAGTTGGAAAAGCAAGG + Intergenic
935054028 2:99549959-99549981 TTGATAAAGTTGCACCAGGACGG - Intronic
935885267 2:107611735-107611757 TTAAAGAAGTTACAAGAGAAAGG + Intergenic
936983663 2:118287879-118287901 TTGCAGAAATTGCAAGAGCTGGG + Intergenic
937207918 2:120248507-120248529 TTGGAGAGATTGCAGGAGGAAGG - Intronic
938225097 2:129608954-129608976 GTGAAGACATTGCAACAGGATGG + Intergenic
938600903 2:132838066-132838088 GTGAATAAGTTGAAAGAGGAGGG - Intronic
938698761 2:133857976-133857998 TTGAAGAACTTGGAAAAGGTGGG - Intergenic
939886791 2:147689916-147689938 ATGATGAAGATGCATGAGGAAGG - Intergenic
940265870 2:151836748-151836770 TTTAAAAAGTTGAAAGAAGATGG + Exonic
940817583 2:158312814-158312836 GTGAAGAGGATGAAAGAGGATGG + Intronic
941784286 2:169480585-169480607 TTTAAGAAGATGAAAGAGAAAGG + Intronic
941947763 2:171118958-171118980 TAGAAGAAGTAGACAGAGGAAGG - Intronic
942073369 2:172335239-172335261 GTGAAGAAGGTGCAAGAGCCTGG - Intergenic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942530199 2:176901827-176901849 CTGAAGAAATTGCATGAGGCTGG - Intergenic
942714948 2:178881573-178881595 GTGAAGAGGTCGCAAGTGGAAGG + Intronic
943430351 2:187792387-187792409 TAGGGGAAGTTTCAAGAGGAGGG + Intergenic
943672608 2:190679755-190679777 TGGAAGAACTTGCAGGAGAAAGG - Intronic
946123001 2:217532823-217532845 TTCAATAAGTGGAAAGAGGAGGG - Intronic
946699336 2:222395900-222395922 ATGAAGAGGTAGCAAGAGGGTGG - Intergenic
947225765 2:227839046-227839068 GGGAAGAAGTTTCCAGAGGAAGG - Intergenic
948447832 2:238046736-238046758 TTGAAGGAGTCCCAAGAGGGAGG - Intronic
1169396964 20:5241102-5241124 GGGAAGAAGCTGCCAGAGGAAGG - Intergenic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1170348119 20:15409685-15409707 TTAAACAAGTTCCTAGAGGAGGG + Intronic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171576971 20:26339867-26339889 TTGTAGAATCTGCAAGTGGATGG + Intergenic
1172450718 20:35020734-35020756 TTGAAGTAGTTCCAAGACGGAGG - Intronic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1172671331 20:36636119-36636141 TTAAAGTGGTTGCAAGAGGCCGG + Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1173428737 20:42967115-42967137 TTTAAGTAGCTACAAGAGGAAGG - Intronic
1173936353 20:46869359-46869381 TTGAATTACTTGCAAGGGGAGGG + Intergenic
1177505699 21:22015155-22015177 ATGAAGAACTTGAAAGAGGCAGG - Intergenic
1178145920 21:29739868-29739890 TGGAAGAAGTTCAAAGAGAAAGG - Intronic
1178888664 21:36502016-36502038 TTGTAGAGGTTGGAAGAGGCAGG + Intronic
1179303699 21:40135909-40135931 TTCTAGGAGTTGCAAGAAGAGGG + Intronic
1180626208 22:17195103-17195125 GTGAAGAAGTGACAAGATGAAGG - Intronic
1180981334 22:19879508-19879530 TGGAAGAAGCTGGAAGAGGATGG + Intronic
1182277824 22:29201578-29201600 TAGGAGAAATTGCCAGAGGAGGG + Intergenic
1182858156 22:33536065-33536087 CTGCAGATGTTGCAAGAGGATGG - Intronic
1183109656 22:35639713-35639735 TTGAAGAACTTCTAAGAGGTGGG + Intergenic
1184905249 22:47479312-47479334 TTTCAGAAAATGCAAGAGGAAGG - Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184949929 22:47834051-47834073 TTGGAAAAGTGGCAAGAGGAAGG + Intergenic
949593855 3:5523325-5523347 TTGGAGGAGTTTCAAGAGGATGG + Intergenic
949610782 3:5701383-5701405 TGTAAGAAAATGCAAGAGGAGGG - Intergenic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
951005449 3:17610481-17610503 TTGAAAAAGTGGGAAGAGGCTGG - Intronic
951541185 3:23783493-23783515 TTTAGGTATTTGCAAGAGGAAGG + Intergenic
951741774 3:25932266-25932288 GGGAAGAAGCTTCAAGAGGAAGG + Intergenic
951870972 3:27362141-27362163 TTGAAGAAGGTCCAGAAGGATGG + Intronic
953759913 3:45678569-45678591 TAGAAGAAGCTGCAAAAGAAAGG + Exonic
957656952 3:83092602-83092624 GTGAAGAAGTAGCAAGAAGGTGG + Intergenic
957656956 3:83092631-83092653 GTGAAGAAGTAGCAAGAGGGTGG + Intergenic
959196284 3:103187281-103187303 TGGAAGAAATTGGAAGAGCAGGG + Intergenic
960040633 3:113146907-113146929 TTAAAGAAGTGGCAAGACAAAGG - Intergenic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
961766495 3:129215646-129215668 TTGAAAAAGTTAAAATAGGACGG + Intergenic
962713447 3:138107001-138107023 TTGGAGAAGATGCAAGGGGAAGG + Intronic
963005488 3:140723105-140723127 GTGAAGAAGTTGGGAGAGGAAGG - Intergenic
963926358 3:150955536-150955558 TTTTAGAAGTTGAAAGAGGCAGG + Intronic
967068019 3:185937906-185937928 TTAAGGAAGGTGCAAGAGGTTGG - Exonic
970006655 4:11417402-11417424 TAGATGAAATTGTAAGAGGATGG - Intronic
970275638 4:14397357-14397379 TCCAAGAAGGTGTAAGAGGAAGG + Intergenic
970939620 4:21616133-21616155 ATGATGAAGATGCAAGAGGAAGG - Intronic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971683672 4:29735788-29735810 TTGATGAAGTTCCAAGATGTAGG + Intergenic
972874216 4:43338454-43338476 ATGAAGAAAATGCAATAGGATGG - Intergenic
973693632 4:53467498-53467520 TTCAACAAGTTGAGAGAGGAAGG + Intronic
973732310 4:53834111-53834133 GGGAAGAAGTTTCCAGAGGAAGG + Intronic
974889425 4:67862134-67862156 TTGAAAAAATTGCATGAGGGTGG + Intronic
975229368 4:71913219-71913241 TAGAATAAGATGCAATAGGAAGG - Intergenic
975272515 4:72452559-72452581 TTGAAGCAGTTTCAAAAGAAGGG - Intronic
975364904 4:73518192-73518214 AGGACGAAGTTGCCAGAGGAAGG - Intergenic
976159338 4:82182131-82182153 TTAAAGAAGTTAGAGGAGGAGGG + Intergenic
977378524 4:96239056-96239078 TATAAGAGGTTGCAAGAGGAAGG - Intergenic
978870231 4:113566923-113566945 TTGTAGTAGTTGAAGGAGGAGGG - Intronic
979283141 4:118889999-118890021 TTGAAGAACATGCAAGAGCATGG + Intronic
980157973 4:129129727-129129749 CTGAAGGAATTGCAAGGGGATGG + Intergenic
980699951 4:136412524-136412546 TTTAAGAAGCTGAAAGTGGAAGG + Intergenic
982349256 4:154396942-154396964 TTGAAGAAGTTATATCAGGAAGG - Intronic
983261572 4:165462463-165462485 TTGAAAAAGTTGCACTAAGAAGG - Intronic
984054188 4:174905811-174905833 TTTAAAAAATTTCAAGAGGAAGG - Intronic
987435780 5:17892554-17892576 TTCAAGAATGTACAAGAGGATGG + Intergenic
987613718 5:20244521-20244543 TTGAGAAATTTGGAAGAGGAGGG - Intronic
987877211 5:23693161-23693183 ATGAAGAATTTTCAAGAGGGTGG + Intergenic
989564189 5:42885138-42885160 CTGAAGAATTTTCAAGGGGAAGG - Intronic
989835777 5:45988472-45988494 TTGTAGAATCTGCAAAAGGATGG + Intergenic
990994171 5:61714597-61714619 TGCAAGTAGTTGGAAGAGGAAGG - Intronic
991000840 5:61781282-61781304 ATGAAGAGGGAGCAAGAGGATGG + Intergenic
991043005 5:62194796-62194818 GTGAAGAAGCCACAAGAGGAAGG - Intergenic
991920564 5:71652708-71652730 ATTAAGAAGTTTGAAGAGGAAGG + Exonic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
995496436 5:112749430-112749452 TTGAAGGATTTGGAGGAGGAGGG + Intronic
996753495 5:126912836-126912858 TTGAACAAGTTGAAAGTGAAAGG - Intronic
997287918 5:132696865-132696887 TTAAAGTAAATGCAAGAGGATGG + Intronic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
998082227 5:139286141-139286163 TTCTAGCAGTGGCAAGAGGATGG - Intronic
998084643 5:139309178-139309200 CTGAAAAAGTTGAAAGAGAAAGG - Intronic
998606665 5:143642445-143642467 TTAAAGCAGTGGCAATAGGAAGG - Intergenic
998749191 5:145298494-145298516 TTGTAGCAGTTTTAAGAGGAGGG + Intergenic
998856681 5:146400870-146400892 TTGAAGAAGTTCCAAAAGAAGGG + Intergenic
999927647 5:156396657-156396679 TTGAAGCTGTTTCAAGAGGCAGG + Intronic
1000553515 5:162695750-162695772 TTCAAAAAGTTGAGAGAGGAAGG - Intergenic
1001209653 5:169798198-169798220 CCGAGGAAGTTGCAGGAGGAAGG - Intronic
1001223064 5:169919585-169919607 TTGAAGAAGTGGTAAGTGTATGG + Intronic
1001319677 5:170670294-170670316 TGGATGAAGTTGAAAGATGAAGG + Intronic
1003056766 6:2828043-2828065 AAGAAGAATTAGCAAGAGGATGG - Intergenic
1003208951 6:4041923-4041945 TTGAAAAAGTTGCACTGGGAAGG + Intronic
1003323521 6:5074176-5074198 TTGTAGAATTTGCAAAAGTAAGG - Intergenic
1003681571 6:8262586-8262608 TACAAGAAGTTGCAAGGGTATGG + Intergenic
1003935118 6:10968243-10968265 CTGAAGAAACTGCTAGAGGAGGG + Intronic
1004783177 6:18935537-18935559 TTGAGGTAGCTGCAAGAGGCTGG - Intergenic
1004949442 6:20652103-20652125 TTGGAGTAGTTTCAGGAGGATGG + Intronic
1005333906 6:24774759-24774781 TTAAGGAAGTTCCAAGAGCAGGG + Intergenic
1005692924 6:28324298-28324320 ATGTAGAGGTTGCAAGTGGAAGG + Intergenic
1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG + Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008828319 6:55726785-55726807 TGGCAGAAGGTGAAAGAGGAAGG + Intergenic
1008900442 6:56608586-56608608 TTGAAGAAGCTGTCAGAGAAGGG - Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1011360414 6:86518326-86518348 TAAAATAAGTTGGAAGAGGAAGG + Intergenic
1011430583 6:87282186-87282208 TTGAAGATGTTTAAATAGGAAGG - Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011946895 6:92916136-92916158 TTTAAGAACTTGCAGGAAGAGGG - Intergenic
1012091238 6:94900638-94900660 TTGGTGAAGTTGCAAGAAAATGG - Intergenic
1012116414 6:95304034-95304056 TTGAAGGAGTTGATAGAAGATGG - Intergenic
1012218731 6:96621787-96621809 TTTAAGAAATTGATAGAGGATGG - Intergenic
1012736775 6:102957564-102957586 TTAAAGAAGTAGGAAAAGGACGG - Intergenic
1013087562 6:106869409-106869431 GTGAAGAAGTGACAAGACGAAGG + Intergenic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1017498200 6:154999971-154999993 TTTAAGGAGTTACAAGAGGTTGG - Intronic
1018151359 6:160942830-160942852 ATGAAGAAATAGCAAGAGAATGG - Intergenic
1018603276 6:165569662-165569684 TTGAAGTAGATTTAAGAGGAGGG - Intronic
1020044813 7:5032909-5032931 ATGCAGAAGTTGGAAGATGAGGG + Intronic
1020290211 7:6717247-6717269 GTGCAGAAGTTGGAAGATGAGGG + Intergenic
1020655956 7:10928221-10928243 TGTAAGAAAATGCAAGAGGAAGG + Intergenic
1020792217 7:12641248-12641270 GAGAAGAAGTTGCAGGTGGAGGG - Intronic
1021282636 7:18739624-18739646 GGGAAGAAGCTTCAAGAGGAAGG - Intronic
1022084792 7:27056467-27056489 TTTAAGAAGCTGCATGGGGATGG - Intergenic
1023174386 7:37421678-37421700 TGGATGAAGTTGCAAAAGGAAGG + Intronic
1023338705 7:39196811-39196833 TTGAAGCAGTTTCAAGTGCAGGG + Intronic
1023825523 7:44006302-44006324 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1023872938 7:44272428-44272450 GTGATGAAGATGCAAGAGGGCGG + Intronic
1024092586 7:45957154-45957176 TTTAAAAAGTAGTAAGAGGAAGG - Intergenic
1026089073 7:67285074-67285096 ATGCAGAAGTTGGAAGATGAGGG - Intergenic
1026725178 7:72865276-72865298 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1026747313 7:73023484-73023506 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1026750963 7:73051627-73051649 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1026754612 7:73079737-73079759 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1026758264 7:73107771-73107793 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1027033416 7:74908069-74908091 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1027089141 7:75285715-75285737 ATGCAGAAGTTGGAAGACGAGGG - Intergenic
1027092784 7:75313643-75313665 ATGCAGAAGTTGGAAGACGAGGG - Intergenic
1027096427 7:75341610-75341632 ATGCAGAAGTTGGAAGACGAGGG - Intergenic
1027118661 7:75500392-75500414 ATGCAGAAGTTGGAAGATGAGGG - Intergenic
1027273135 7:76535067-76535089 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1027322918 7:77026077-77026099 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1027326582 7:77054147-77054169 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1028793909 7:94882881-94882903 GTAAGGAAGATGCAAGAGGAGGG + Intergenic
1029397535 7:100318567-100318589 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1029718826 7:102349620-102349642 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1029753789 7:102559637-102559659 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1029771738 7:102658724-102658746 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1030855298 7:114548421-114548443 TTGCAGAAGTTGCTAGATGTTGG - Intronic
1030860934 7:114627547-114627569 GTGAAGAAATAGGAAGAGGATGG - Intronic
1031077182 7:117224232-117224254 CCTAAGAATTTGCAAGAGGAAGG - Intronic
1032354875 7:131201483-131201505 GTGAAGAATTTCCAAGAAGAAGG + Intronic
1032357182 7:131221815-131221837 TTTAAAAAGTGGCAAGAGGCCGG - Intronic
1036100728 8:5781098-5781120 TTGAAGAAATCGAAAGAGAATGG - Intergenic
1039400916 8:37268578-37268600 TTTAGGGACTTGCAAGAGGATGG + Intergenic
1040659288 8:49550903-49550925 TTGCAGAAAATGGAAGAGGATGG - Intronic
1040683873 8:49847053-49847075 TTCAAGAAGCTGAAATAGGAAGG - Intergenic
1044113176 8:88302263-88302285 TGGAAGAAGTTGCCAGAGGGAGG + Intronic
1044461017 8:92443937-92443959 ATGGAGAAGTTTCAAAAGGACGG + Intergenic
1044681113 8:94778533-94778555 TTGAAGAAAGTGGAAGCGGAGGG - Intronic
1045409638 8:101904167-101904189 TGGAAGAAGACACAAGAGGAGGG + Intronic
1047174029 8:122523494-122523516 CTGAAGAAGTTGCAAGCGGGAGG - Intergenic
1048422690 8:134292932-134292954 GTAAAGAAGTTGCAATAGTAAGG - Intergenic
1050993394 9:12181748-12181770 TGGCAGAAGTTGAAAGTGGAAGG + Intergenic
1052264902 9:26560892-26560914 TTTAAGTTGTTGCAAGTGGAAGG - Intergenic
1055189326 9:73498180-73498202 TGGAAGAAGATGCAAGACAAAGG + Intergenic
1056139502 9:83662064-83662086 TTGGATAAGTTTCAAGAGGTGGG - Intronic
1056206259 9:84322307-84322329 TTCAAGATGTTCCAAGATGAAGG - Intronic
1058654367 9:107206457-107206479 TTGAAAAAGGTGGAACAGGATGG + Intergenic
1059739746 9:117138193-117138215 TGGAAGAAGTTAAAAAAGGAGGG + Intronic
1061155993 9:128861937-128861959 TAGAAGAAGTAGCAAGATGTTGG - Intronic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1203417718 Un_KI270364v1:1653-1675 TTGTAGAATCTGCAAGAGGATGG - Intergenic
1188756118 X:33965823-33965845 ATGAAGAAGTTGCATTGGGAGGG - Intergenic
1189359772 X:40340875-40340897 TGGAATAACTTACAAGAGGAGGG + Intergenic
1190114585 X:47618412-47618434 TTGAAGAAGTAGCTGGAGAACGG + Intronic
1190690498 X:52909471-52909493 CTGAAAATGTTGCTAGAGGATGG - Intergenic
1190695485 X:52946321-52946343 CTGAAAATGTTGCTAGAGGATGG + Intronic
1192101788 X:68272004-68272026 TGGAGGACGTTGCAGGAGGAAGG - Intronic
1192205506 X:69093444-69093466 ATGAAGAAGTTGCAGGATGTGGG + Intergenic
1192447448 X:71221672-71221694 TGGCAGAAGTGGCAAGAGGTGGG + Intronic
1193596634 X:83453820-83453842 TTGAAAAATTTGCATGAGGAAGG + Intergenic
1193929662 X:87536750-87536772 ATGAAGAAGGTGCAAGTGGGGGG + Intronic
1194951322 X:100130034-100130056 TGGAAGAAGTTTCATGAGGAAGG + Intergenic
1196552125 X:117041251-117041273 TTAAAGAAGTAGTGAGAGGAAGG - Intergenic
1197917202 X:131548916-131548938 GTGAAGAAGTGGCAGAAGGAAGG - Intergenic
1197982316 X:132229720-132229742 TTGAAGGTATTGCATGAGGAGGG - Intergenic
1198443015 X:136683209-136683231 TTGAAAAAATGGCAAGATGAAGG + Intronic
1198536794 X:137594567-137594589 TTGGAGGAGTTTCATGAGGAAGG + Intergenic
1199333660 X:146591979-146592001 TAGAATAAATTCCAAGAGGAAGG + Intergenic
1199541511 X:148963009-148963031 TTGGGGATGTTGCAGGAGGAAGG + Intronic
1199550602 X:149057133-149057155 TTGAGGAAGTTCCAAGAAAAAGG + Intergenic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1200093888 X:153648281-153648303 CTGCAGAAGCTGCGAGAGGAAGG + Exonic
1202243159 Y:22790820-22790842 TTGATGAAGTAGCAAAAGGCTGG + Intergenic
1202364003 Y:24142406-24142428 GAGAAGAAGTTGGAAGATGAAGG + Intergenic
1202396146 Y:24424570-24424592 TTGATGAAGTAGCAAAAGGCTGG + Intergenic
1202474639 Y:25245522-25245544 TTGATGAAGTAGCAAAAGGCTGG - Intergenic
1202506777 Y:25527716-25527738 GAGAAGAAGTTGGAAGATGAAGG - Intergenic