ID: 1092658351

View in Genome Browser
Species Human (GRCh38)
Location 12:10711886-10711908
Sequence CTGTGATTATTTTGACTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092658351_1092658352 24 Left 1092658351 12:10711886-10711908 CCTGGGAGTCAAAATAATCACAG 0: 1
1: 0
2: 0
3: 12
4: 223
Right 1092658352 12:10711933-10711955 CTTCAAAGAGAACATGATGTAGG 0: 1
1: 0
2: 2
3: 16
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092658351 Original CRISPR CTGTGATTATTTTGACTCCC AGG (reversed) Intronic
901625658 1:10623501-10623523 CTGTAATTACTGTGGCTCCCGGG + Intronic
902573792 1:17363831-17363853 TTGTGAATATTGTGGCTCCCTGG + Exonic
905587942 1:39136302-39136324 CTGTGATTTTTCTGCCTTCCAGG + Intronic
906560091 1:46750002-46750024 CTGTGCTGATTTTAACTGCCTGG + Intergenic
908105262 1:60834843-60834865 CTGGGATTAGTTTGCCACCCAGG + Intergenic
908523117 1:64964076-64964098 CTGTGATTATTGTGGCTCAGTGG - Intronic
909608407 1:77529643-77529665 CTGTGCTTAGCCTGACTCCCTGG + Intronic
910527409 1:88196873-88196895 CTGTGATTTTTTTAATACCCAGG - Intergenic
911518886 1:98904650-98904672 CTGTGCTTATTCTCACTCCAAGG - Intronic
914749480 1:150524348-150524370 CTGAGATTTTTTTGAGTCTCTGG - Intergenic
917067339 1:171111214-171111236 CTTTGATTATCATTACTCCCGGG - Intronic
919188403 1:194184161-194184183 CTCTGATTAATATGACTGCCAGG - Intergenic
919401547 1:197124444-197124466 CTTTGATTTTTTTAACTTCCTGG - Intronic
920317940 1:205092619-205092641 TTTTGATTATTTTGTTTCCCAGG + Intronic
921720228 1:218463204-218463226 CTGTGATTTTTTTGACTCAAGGG + Intergenic
923712578 1:236398828-236398850 CTGTGATTATTTGGCCACCGTGG + Intronic
1064918261 10:20486631-20486653 TTGTGATTATTTTTAATCCAGGG - Intergenic
1066345659 10:34583088-34583110 CTGTTATTATTGTGAGTACCTGG + Intronic
1068968194 10:62934492-62934514 CTGTGAGTATGTGGACTTCCTGG + Intergenic
1073572647 10:104593538-104593560 CTGTGGTGATTGTGACTCCAGGG - Intergenic
1075353378 10:121746360-121746382 CTGTAATTAATTCTACTCCCAGG - Intronic
1075827857 10:125375379-125375401 CTGGGGTGATTTTGCCTCCCGGG + Intergenic
1076092542 10:127700328-127700350 CTGAGTTTCATTTGACTCCCAGG + Intergenic
1079086037 11:17445644-17445666 CTGGGATTGTATTAACTCCCAGG + Intronic
1080344913 11:31313691-31313713 CTGTGGTTATTTTTACTCATTGG + Intronic
1081407816 11:42718016-42718038 CAATGATTATTTTGTCACCCAGG - Intergenic
1081891198 11:46543554-46543576 ATGTGATTATTTTGAATCTGAGG - Intronic
1082828685 11:57599300-57599322 CTGAAACAATTTTGACTCCCAGG - Intronic
1085944611 11:81252851-81252873 CTGTGTTTATTCTGACACTCTGG - Intergenic
1086589587 11:88496256-88496278 CTGAGATAGTTTTGAATCCCAGG + Intergenic
1088908281 11:114171117-114171139 CTGTGATTCTCTTTGCTCCCGGG - Intronic
1089512250 11:119006946-119006968 CTGTGATTATAAGGCCTCCCCGG + Intronic
1091853674 12:3721826-3721848 CTGTGTTTATGTTAACCCCCAGG + Intronic
1092658351 12:10711886-10711908 CTGTGATTATTTTGACTCCCAGG - Intronic
1093223014 12:16446599-16446621 CTGTGTTAATTGAGACTCCCAGG + Intronic
1093915474 12:24797634-24797656 CTAAGATTAATTTGTCTCCCTGG - Intergenic
1098801262 12:74961184-74961206 CTGTGACTACTTTGACTAACAGG - Intergenic
1099073871 12:78081217-78081239 GGTTGATTATTTTGACTACCAGG + Intronic
1100961242 12:99965044-99965066 ATGTGAATATATTCACTCCCTGG + Intronic
1100982666 12:100173751-100173773 CTATGATTATTTTGTCTCATTGG - Intergenic
1101631778 12:106502093-106502115 CAGGGATGATTTTGCCTCCCAGG + Intronic
1102095249 12:110234976-110234998 CTTTGATTATTTTTACTTCCTGG - Intergenic
1103148841 12:118619319-118619341 CTGTCATTCGCTTGACTCCCTGG + Intergenic
1103299359 12:119916291-119916313 CCGTGATTATTCTGACGTCCAGG + Intergenic
1103685383 12:122728387-122728409 CTGTCATCATTGTGACTTCCTGG - Exonic
1103960323 12:124605415-124605437 CTGTGAATCCTTTGACCCCCGGG + Intergenic
1104844509 12:131840178-131840200 CTGAGATAGTTTTGACTCCGGGG - Intronic
1107650555 13:42540780-42540802 CTGGGGTAATTTTGCCTCCCGGG - Intergenic
1107748568 13:43539850-43539872 TTGAGATTATTTTAACTTCCAGG + Intronic
1108614452 13:52117863-52117885 TTGAGATTATTGTGACTCTCTGG - Intronic
1111404426 13:87783991-87784013 CTGTGATCATTTTGAGCCTCTGG + Intergenic
1111634868 13:90891285-90891307 CTGTGATTTTATTAGCTCCCAGG + Intergenic
1113243684 13:108369530-108369552 CTGTCATTTTTTTTATTCCCAGG + Intergenic
1114972174 14:28046187-28046209 CTGTGATTGTTTTGACCCTCAGG + Intergenic
1118051306 14:62031532-62031554 CTGTGATTCTTCTCACTTCCAGG - Intronic
1120309147 14:82808011-82808033 CTAAGATGATTTTGCCTCCCAGG - Intergenic
1122955225 14:105067273-105067295 CTGTCAGTGTTTGGACTCCCAGG - Intergenic
1124900871 15:33821248-33821270 CTGTGATTTTTTTTCCCCCCAGG + Exonic
1126270715 15:46814034-46814056 CTTGGAGTGTTTTGACTCCCAGG - Intergenic
1128789429 15:70422360-70422382 CTGGAATAATTTTGACTCTCGGG - Intergenic
1130572827 15:85063752-85063774 CTGTGATTGTTATTACTCACTGG + Intronic
1131365085 15:91832220-91832242 CTGTAAGTCTCTTGACTCCCTGG - Intergenic
1132376501 15:101331708-101331730 CCATGATTATTATGACTCCCAGG + Intronic
1133165776 16:3946353-3946375 CCGTGACTATTATGACTCCTTGG - Intergenic
1133313690 16:4868594-4868616 CTGTGACTGTTTTAAGTCCCAGG + Intronic
1134362369 16:13543559-13543581 CTGTGATTTTGTTACCTCCCAGG + Intergenic
1137633508 16:49965637-49965659 TTGTGATCATTTTGAATCACAGG - Intergenic
1138395584 16:56701926-56701948 CTGGTATTATTTTGCTTCCCAGG - Intronic
1138978458 16:62237599-62237621 CTATGTTTATTTTGACTTCTTGG - Intergenic
1138983821 16:62302606-62302628 CTGTGATTATTTGTACTTCCAGG + Intergenic
1143410579 17:6706086-6706108 TTATGATTATATTGACTCCATGG + Intronic
1146385550 17:32369273-32369295 CTGCGCTTATTTTTATTCCCAGG + Exonic
1146587906 17:34098530-34098552 CTGTGAGTAACTTGTCTCCCAGG - Intronic
1147448262 17:40488102-40488124 CTGGGATGATTGTGATTCCCAGG + Intronic
1149000342 17:51750986-51751008 CTGAGAATCTTTTGACTCCAGGG - Intronic
1149865249 17:60147998-60148020 CTGTCACTATTTAGACTACCTGG - Intergenic
1155634708 18:27939240-27939262 CAGTTATTTTTATGACTCCCAGG - Intergenic
1156480971 18:37436155-37436177 CTGTGGTTAATTTTTCTCCCTGG - Intronic
1158815340 18:61088505-61088527 CTGTGGTTACCTTGACTCACAGG + Intergenic
1159228798 18:65577282-65577304 CTAGGGCTATTTTGACTCCCTGG - Intergenic
1160088816 18:75806755-75806777 CTATGATTATTTTGTTTCCTTGG - Intergenic
1160327937 18:77967897-77967919 CTGTGATTCTGTGGACTCACTGG - Intergenic
1160387771 18:78506894-78506916 CTATGATTATTTTCACACACAGG + Intergenic
1164694857 19:30235817-30235839 CTTTAATTATTTTGCTTCCCCGG + Intronic
1164908395 19:31985870-31985892 ATGGGATTAATGTGACTCCCTGG - Intergenic
1164928226 19:32148484-32148506 CTATGATTGTTTTGTCTTCCTGG - Intergenic
1167014424 19:46831275-46831297 CTGTGCTGATTTTTACTCTCTGG - Intergenic
1167159637 19:47758745-47758767 CTGTGCTGATTTTTACTCTCTGG + Intergenic
1168704670 19:58463018-58463040 CTTTGATATTTTTGTCTCCCAGG - Intergenic
928040148 2:27867151-27867173 CTGTGTTTATTTTGACTGAGTGG + Intronic
928112766 2:28523968-28523990 GTGTGATTTGTTTGTCTCCCTGG + Intronic
928530616 2:32187130-32187152 TTGTCATTTTTTTGCCTCCCAGG + Intronic
931541939 2:63339094-63339116 CTTTGGTTATATTGACTCCTAGG + Intronic
932163079 2:69480754-69480776 CTGGGCTTATTTTGAAGCCCAGG - Intronic
932654094 2:73593268-73593290 TTGTGATTATTGTGAATCCGTGG + Intronic
932739857 2:74283098-74283120 CAGTGACTGTTTTGACTTCCAGG - Intronic
933112016 2:78414320-78414342 CATTGATTATTTTTAATCCCAGG - Intergenic
933871337 2:86568262-86568284 CAGTGATTTTTATGATTCCCGGG - Intronic
935425602 2:102915707-102915729 CTCTGAATATTTTTACTTCCTGG + Intergenic
936055287 2:109257848-109257870 CTGTGTTTACTGTGACTCACTGG - Intronic
937191238 2:120101333-120101355 CTTTAATTATTTAGACTTCCAGG + Intronic
938304175 2:130239739-130239761 CTGTCATCCTATTGACTCCCTGG - Intergenic
939350872 2:141036286-141036308 ATGTGATAATTTAGAATCCCTGG + Intronic
941248084 2:163125534-163125556 CTTTTATTATTTTTACCCCCAGG - Intergenic
941251818 2:163174683-163174705 CTTTGAATATTTTAACTCTCAGG - Intergenic
941604879 2:167584640-167584662 CTGTGATACTTTTGACTGACTGG + Intergenic
942004146 2:171680843-171680865 CTGGGCTTAATTTGGCTCCCAGG + Intergenic
942057112 2:172194773-172194795 CTGTCATTATTTTACCTCCCTGG - Intergenic
945150300 2:206783825-206783847 CAGGGATGATTTTGCCTCCCAGG + Intronic
947130429 2:226917477-226917499 CTGGGATTATTTTGAAGCCAAGG + Intronic
1171755441 20:29103881-29103903 TGGTGACTATTTTGCCTCCCAGG + Intergenic
1171787240 20:29479003-29479025 TGGTGACTATTTTGCCTCCCAGG - Intergenic
1171860716 20:30400384-30400406 TGGTGACTATTTTGCCTCCCAGG + Intergenic
1172109643 20:32537369-32537391 GTGTGACTGTTTTGTCTCCCAGG - Intronic
1172557748 20:35857186-35857208 TTGTGATTATTTTAAATCCCTGG + Intronic
1173105972 20:40134141-40134163 CCGTGACTAATTTGTCTCCCTGG + Intergenic
1176274803 20:64258551-64258573 ATGTGATTATTTTCATTCCTGGG + Intronic
1177376568 21:20278204-20278226 CTGTGGTTGTTGTCACTCCCAGG - Intergenic
1178819579 21:35962937-35962959 CTGGGATGATTTTAACCCCCAGG - Intronic
1180412478 22:12627761-12627783 TGGTGACTATTTTGCCTCCCAGG + Intergenic
1181735352 22:24877206-24877228 CTGGGATTATTTTGCCTTCTAGG - Intronic
1183792504 22:40084275-40084297 GTGTGATTATTTTAGCTCACTGG - Intronic
949115733 3:320048-320070 CTGTAATTATTTTGCAACCCAGG + Intronic
949341876 3:3038996-3039018 CTGTGATTCATTTACCTCCCAGG - Exonic
952609966 3:35196837-35196859 TTCTGACTATTCTGACTCCCAGG + Intergenic
954110561 3:48430571-48430593 CTGTGACGTTTTTGCCTCCCAGG - Intergenic
954171271 3:48804512-48804534 CAGTGATTATAATCACTCCCTGG - Intronic
954431729 3:50474266-50474288 CATTGATCATTTTCACTCCCAGG - Intronic
956458242 3:69444957-69444979 CTGTAATTTTTTAGACTCCTGGG + Intronic
957173859 3:76778304-76778326 CTGTGATGAATTTTACTCCTTGG + Intronic
958648024 3:96898468-96898490 GAATGATAATTTTGACTCCCAGG - Intronic
959186546 3:103053509-103053531 CTGTGATAAGTGTGAATCCCAGG + Intergenic
959491599 3:106996211-106996233 CTGTCATTTTTTTGACTACATGG + Intergenic
960141999 3:114159810-114159832 CTGTGATGTTTTTGTCACCCTGG - Exonic
963049074 3:141126604-141126626 CTGTTGTTATTTGGTCTCCCTGG - Intronic
964681163 3:159341106-159341128 CTGGCATGATTTTGAGTCCCTGG + Intronic
964962038 3:162438806-162438828 CTCTGACTATTTTTCCTCCCTGG + Intergenic
966284160 3:178273611-178273633 TTGGGATTATTTTGAATCCTTGG + Intergenic
966572618 3:181462688-181462710 TTGAGATTATTTTTACTCCATGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969243901 4:5919899-5919921 CTTTGAGTATTTTCAATCCCTGG - Intronic
970239006 4:13988721-13988743 CAGTGATTATTTTGAGCCTCGGG - Intergenic
972094969 4:35337190-35337212 CTGTTATTAATTGGACTCTCTGG - Intergenic
973637428 4:52873211-52873233 CTGTTACAATTTAGACTCCCTGG + Exonic
974270395 4:59643893-59643915 CTGTGTTTAGTTTTTCTCCCTGG - Intergenic
975032612 4:69640139-69640161 CTGTGATTCTTTGGAGTTCCAGG - Intronic
975122894 4:70748479-70748501 CTGTCCTTAGTTTAACTCCCTGG - Intronic
977957128 4:103041789-103041811 CTCAGATTAATTTGACTCCAAGG - Intronic
978190645 4:105907047-105907069 TTGAGGTTACTTTGACTCCCCGG - Intronic
979783699 4:124688582-124688604 TTCTGAGTATTCTGACTCCCTGG - Intronic
980581980 4:134766900-134766922 GTGTGATAATTTTTACTCCTTGG - Intergenic
982604323 4:157495316-157495338 CTGTTAGTATGTTGACTCCTAGG - Intergenic
983038441 4:162896009-162896031 CTTTGAGTGTTTTGTCTCCCAGG - Intergenic
984995133 4:185423344-185423366 CTCTCATTGTCTTGACTCCCTGG - Intronic
985334497 4:188877336-188877358 CTGTGATTATGTTGAGTACTTGG + Intergenic
985439527 4:189970439-189970461 TAGTGACTATTTTGCCTCCCAGG + Intergenic
986670177 5:10136506-10136528 CGGTTACTATTTTTACTCCCCGG + Intergenic
986970147 5:13324461-13324483 ATGTGATTTGTTTGACTCACTGG - Intergenic
987946678 5:24618763-24618785 CTTTGTTTAATTTGACTTCCTGG + Intronic
987946680 5:24618787-24618809 CTTTGTTTAATTTGACTTCCTGG + Intronic
988336212 5:29911952-29911974 CTGAGATTATTTTATCACCCAGG - Intergenic
988403992 5:30800739-30800761 CTGTGATTATTTGGACCAACAGG + Intergenic
988409783 5:30872275-30872297 CTGTCCTTATTTTGAATCACTGG + Intergenic
988454881 5:31378568-31378590 CCGTTATTCTTTTGACTCTCAGG + Intergenic
989556740 5:42805474-42805496 CTTTGTTTTTTTTGACTCTCCGG - Intronic
990610406 5:57451143-57451165 TTTTGATTATTTTGAATCCATGG - Intergenic
992037918 5:72799224-72799246 CTATGATTATTTTTATTCCTTGG - Intergenic
994219454 5:97178892-97178914 CTGTGATTATTTTGACTAATAGG + Intronic
994976904 5:106819405-106819427 CTGTGATAACAATGACTCCCTGG - Intergenic
995947733 5:117670068-117670090 CAGTGAATATTATGTCTCCCAGG - Intergenic
996340719 5:122435998-122436020 CTGTGATTTCTTTGACTCAAGGG + Intronic
996580425 5:125026295-125026317 CTGTTATTATTCTGATTTCCAGG + Intergenic
1000416466 5:160989248-160989270 TTGTGATTTTTTTGACTTACAGG + Intergenic
1000617614 5:163446287-163446309 CAGTGATAATTTTTACTCTCTGG + Intergenic
1005400201 6:25424104-25424126 CTGTGATTAGTTGAAGTCCCAGG - Intronic
1005802558 6:29441664-29441686 CAGTGATTATTTAGTCACCCAGG + Intronic
1006708328 6:36042390-36042412 CTCTGTTCATTTTGACTCCTCGG + Intronic
1007122535 6:39395167-39395189 GTGTGATTATTTTGATTACTTGG - Intronic
1008362855 6:50642454-50642476 CTGTGATTTCTTTGCCTCCCTGG - Intergenic
1009860935 6:69331161-69331183 CAGAGATGATTTTGACCCCCCGG - Intronic
1010843479 6:80676775-80676797 CTGTGATCAGTTAAACTCCCTGG + Intergenic
1011240026 6:85261651-85261673 CTGTGCTCCTTTTGACTCCGTGG + Intergenic
1014879589 6:126706625-126706647 ATGAGATTATTTGTACTCCCTGG - Intergenic
1017669804 6:156759392-156759414 GTGTAATTATTTTGACTCTTTGG + Intergenic
1018368385 6:163145536-163145558 CTGGGATGATTTTCCCTCCCAGG + Intronic
1021336513 7:19409386-19409408 CACAGATTATTTTGTCTCCCAGG + Intergenic
1022961133 7:35427859-35427881 CTGTGATTTCTTTGACTCATTGG - Intergenic
1022963922 7:35455455-35455477 CTGTGATTCTTCTAAGTCCCAGG + Intergenic
1023607060 7:41940733-41940755 CTGTGATTATTTTTCCTGCACGG + Intergenic
1024593621 7:50913403-50913425 TTGAGATTATTTTGTCTTCCTGG - Intergenic
1027434412 7:78149489-78149511 CAGTGATTAATTTGGCACCCAGG + Intronic
1028722320 7:94047804-94047826 CTGAGATGAGTTTGAATCCCAGG - Intergenic
1029917995 7:104231618-104231640 CAGTTGTTATTTTGACTCCAAGG - Intergenic
1030837435 7:114307170-114307192 CTCTGATTAATTTGACTGACAGG + Intronic
1031634600 7:124086622-124086644 CTGTTATCATTTTAACTCCATGG - Intergenic
1032537746 7:132678534-132678556 CGGTGATTATTTTGGTGCCCTGG - Intronic
1034308776 7:150069161-150069183 CTGTGATTTTTTTTAGTCACAGG + Intergenic
1034798077 7:154031481-154031503 CTGTGATTTTTTTTAGTCACAGG - Intronic
1044941148 8:97345175-97345197 CTGAGATTATTGTGGCTCCAAGG + Intergenic
1045395565 8:101757530-101757552 CTGTCATTCTTTTTATTCCCAGG + Intronic
1048527126 8:135213420-135213442 CTGTGTTTATTGTTGCTCCCTGG + Intergenic
1050210108 9:3244494-3244516 CAGTGTTTATTTGGTCTCCCTGG + Intronic
1053102712 9:35384462-35384484 CTGTGGTTCTTTTAACTCCAGGG + Intronic
1053614176 9:39745910-39745932 CTGGCATAATTTTGTCTCCCAGG + Intergenic
1053747897 9:41219533-41219555 TGGTGACTATTTTGCCTCCCAGG + Intergenic
1053872205 9:42503849-42503871 CTGGCATAATTTTGTCTCCCAGG + Intergenic
1054239341 9:62596483-62596505 CTGGCATAATTTTGTCTCCCAGG - Intergenic
1054261094 9:62865534-62865556 CTGGCATAATTTTGTCTCCCAGG + Intergenic
1054479389 9:65645838-65645860 TGGTGACTATTTTGCCTCCCAGG - Intergenic
1054553472 9:66631010-66631032 CTGGCATAATTTTGTCTCCCAGG - Intergenic
1054838501 9:69707518-69707540 ATGTGATTATTTTTGCTCCAAGG + Intergenic
1056943409 9:90974422-90974444 CTGTGTTTACCTTGCCTCCCTGG - Intergenic
1057087155 9:92221878-92221900 CTGTGATAATTTTGACTTTTGGG + Intronic
1057401873 9:94730429-94730451 CAGTGATTATTTCCACTTCCAGG + Intronic
1059966475 9:119619443-119619465 TACAGATTATTTTGACTCCCAGG + Intergenic
1060103802 9:120861318-120861340 CTGGGATGACTTTGGCTCCCTGG - Intronic
1060209738 9:121702258-121702280 CTGGGATTTTTTTGGCTCCCTGG + Intronic
1062117027 9:134814958-134814980 CTGGGATCATTCTGACTCACTGG + Intronic
1062672264 9:137718067-137718089 CTGTGATGATTTTCACACACAGG + Intronic
1202784031 9_KI270718v1_random:30304-30326 TGGTGACTATTTTGCCTCCCAGG + Intergenic
1202803046 9_KI270720v1_random:19277-19299 TGGTGACTATTTTGCCTCCCAGG - Intergenic
1203447841 Un_GL000219v1:76490-76512 TGGTGACTATTTTGCCTCCCAGG - Intergenic
1185451967 X:286743-286765 TTGATATTATTTTAACTCCCAGG + Intronic
1186454189 X:9698350-9698372 CTGTGAGTATGTTGAGTCCTGGG - Intronic
1186924217 X:14314392-14314414 CTGGGGTTATTTTGACCCCCAGG + Intergenic
1193484017 X:82063638-82063660 CTGTGATTCTTTCTACTCCTAGG - Intergenic
1194102907 X:89729018-89729040 CTGTGAAAATTTTAACTCTCAGG + Intergenic
1195327950 X:103773407-103773429 ATGTGATTATTTTGGCTTCCAGG + Intergenic
1195946323 X:110216517-110216539 CTGTGATTATTTGGACTGGGAGG - Exonic
1196653151 X:118189181-118189203 CAGTGACTGTTTTGACTCCGTGG + Intergenic
1198243023 X:134802945-134802967 CTGAGATAATTTTAAGTCCCTGG - Intronic
1199907668 X:152250845-152250867 CTATTATTATTTTGACCCTCAGG - Intronic
1200455589 Y:3387040-3387062 CTGTGAAAATTTTAACTCTCAGG + Intergenic
1200983245 Y:9281171-9281193 CTGTCATCATTTTGGCTACCTGG - Intergenic
1202366400 Y:24168630-24168652 GGGTGACTTTTTTGACTCCCGGG + Intergenic
1202504382 Y:25501493-25501515 GGGTGACTTTTTTGACTCCCGGG - Intergenic