ID: 1092658488

View in Genome Browser
Species Human (GRCh38)
Location 12:10713469-10713491
Sequence GGTTTTAAACAAAGTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092658486_1092658488 3 Left 1092658486 12:10713443-10713465 CCACTGTGATTTTAAAAACAGAT 0: 1
1: 0
2: 3
3: 54
4: 450
Right 1092658488 12:10713469-10713491 GGTTTTAAACAAAGTGAGCAAGG 0: 1
1: 0
2: 3
3: 11
4: 240
1092658485_1092658488 4 Left 1092658485 12:10713442-10713464 CCCACTGTGATTTTAAAAACAGA 0: 1
1: 0
2: 3
3: 58
4: 562
Right 1092658488 12:10713469-10713491 GGTTTTAAACAAAGTGAGCAAGG 0: 1
1: 0
2: 3
3: 11
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092658488 Original CRISPR GGTTTTAAACAAAGTGAGCA AGG Intronic
901557940 1:10046391-10046413 AGTTTAAAACAAAGTTATCAGGG + Intronic
903024126 1:20415080-20415102 GATTTTAAAGAAAATGATCAAGG + Intergenic
903328123 1:22582953-22582975 GATTTTAAACACAGTCAGGAAGG - Intronic
903662393 1:24986160-24986182 GGTTGAAATCAAAGTAAGCATGG - Intergenic
904329127 1:29746463-29746485 GATTTCTAACAAAGTGAGGAGGG + Intergenic
906669492 1:47644166-47644188 GGTTTTAAACAAACTGGAAAGGG - Intergenic
907123591 1:52029856-52029878 GCTTGTAAACCAAATGAGCAGGG + Intronic
907507263 1:54928842-54928864 GGTTTTAAAGAAGGTGAGCGTGG + Intergenic
908384208 1:63625629-63625651 GGTATTAAAGAAAATGAGAAAGG - Intronic
909174545 1:72339333-72339355 TGTTTTAAAAAAAGGAAGCAAGG + Intergenic
910150574 1:84138150-84138172 GGAAATACACAAAGTGAGCATGG + Intronic
910401250 1:86840303-86840325 TTTTTTAAAAAAAATGAGCATGG + Intergenic
912118080 1:106432594-106432616 AGTTTTAAGCAGAGTGAGTAAGG + Intergenic
912132266 1:106618177-106618199 GATTTTAAATAAGGTGATCAGGG + Intergenic
912755768 1:112323859-112323881 AGTTTTTAACATAGTGACCACGG - Intergenic
912781926 1:112558802-112558824 TGTTTTAAAAAAAATGGGCAAGG - Intronic
916116767 1:161491445-161491467 GTTTTTAAATTAATTGAGCAAGG - Intergenic
916116810 1:161491932-161491954 TGTTTTAAATTAATTGAGCAAGG + Intergenic
916437321 1:164789185-164789207 GGTTTTAAATAAAATAAGAAAGG - Intronic
916462371 1:165039792-165039814 GATTTTCAACAAAGTTACCAAGG + Intergenic
917771217 1:178280950-178280972 GGTTTAAAAGCAAGTAAGCAAGG - Intronic
918344135 1:183591350-183591372 GGATTACAAAAAAGTGAGCAAGG - Intronic
918638189 1:186805117-186805139 GGTTTAAAAAAAAGTGAATATGG - Intergenic
919700650 1:200628075-200628097 CCTTTAAAACAAAGGGAGCATGG - Intronic
919754708 1:201059414-201059436 GAGCTAAAACAAAGTGAGCAGGG - Intronic
921365570 1:214370437-214370459 GGTTTTAAACAAGGCGGGAAGGG + Intronic
923300786 1:232638761-232638783 GGTTTTAAAGCAAGGGAGGAAGG - Intergenic
1063221187 10:3969762-3969784 GGATTTCAACAAAGTTATCACGG + Intergenic
1063579763 10:7295330-7295352 GGTTTTGGACACAGTGGGCATGG - Intronic
1065039218 10:21673706-21673728 GGAAATAAACAAAGTAAGCATGG + Exonic
1065518092 10:26544685-26544707 GGATTTAGACACAGTGAACAGGG + Intronic
1067095863 10:43299351-43299373 GTTTTTAAATTAATTGAGCAAGG + Intergenic
1069220021 10:65871544-65871566 GGAAATAAACAAAATGAGCATGG - Intergenic
1070909825 10:80108279-80108301 GTTTTTAAATTAATTGAGCAAGG - Intergenic
1073795151 10:106979200-106979222 GGTTTTAAACAAAGAGAACTGGG + Intronic
1074513829 10:114146033-114146055 GGATTTAAAAAAAGTGGGAAAGG - Intronic
1074875014 10:117606921-117606943 GGGTTTAAACAATGTCACCAGGG + Intergenic
1077897512 11:6464694-6464716 GTTTTTAAAAAGAGTAAGCACGG + Intronic
1078068301 11:8092271-8092293 ATCTTTAAAAAAAGTGAGCAGGG + Intronic
1079270872 11:18984541-18984563 GTTTTTAAATTAATTGAGCAAGG - Intergenic
1079543446 11:21603995-21604017 GGTTGTATCCAAACTGAGCATGG + Intergenic
1082651152 11:55795564-55795586 GGTTTTAAGGAATCTGAGCATGG + Exonic
1083877784 11:65533475-65533497 GGTTTTAAAAACAGTGGTCAGGG + Intronic
1085891837 11:80588735-80588757 AGTTTCAATCTAAGTGAGCAAGG - Intergenic
1087530762 11:99378741-99378763 GGTTTAAAAAAAAGTGAGAAAGG + Intronic
1087952615 11:104241975-104241997 TGTTTCAAATAAAATGAGCATGG - Intergenic
1088589072 11:111386990-111387012 GAGTTTAAACAATGTGACCAAGG - Intronic
1089379504 11:118017589-118017611 AGTTTTAAATAAAGTGGTCAAGG + Intergenic
1092658488 12:10713469-10713491 GGTTTTAAACAAAGTGAGCAAGG + Intronic
1092976078 12:13746139-13746161 CCTTTTAAACAGAGTGATCAGGG + Intronic
1093101309 12:15032927-15032949 AGGTTTAAGCAAAGTGAGAAGGG - Intergenic
1094857392 12:34414773-34414795 GGTTTTATAGAAACTGAGAAGGG - Intergenic
1096603980 12:52751968-52751990 GGTTCTGAAGAAGGTGAGCAGGG - Intergenic
1097551052 12:61070051-61070073 AGTATTAAATAAAGTGAGCTTGG - Intergenic
1098214265 12:68199301-68199323 GGTTTAGAGAAAAGTGAGCAGGG + Intergenic
1098955722 12:76687643-76687665 GGTGTTAAACATAAAGAGCAGGG + Intergenic
1099638564 12:85251450-85251472 GGTTTTAAACATGGTGAGTGTGG + Intronic
1100166350 12:91922248-91922270 AGTCTTGAACAGAGTGAGCATGG - Intergenic
1100917013 12:99435643-99435665 GTTTTTCAGCAAAGTGAGAATGG - Intronic
1102114523 12:110392554-110392576 GTTTTTCAATAAAATGAGCAAGG + Intronic
1102549146 12:113678547-113678569 GCTTTTAACCTGAGTGAGCAGGG + Intergenic
1102884968 12:116514624-116514646 GGATTTAAACACAGTGTGCTAGG - Intergenic
1104547582 12:129726201-129726223 GGATTTAAGCACAGTCAGCAAGG - Intronic
1106026844 13:25963505-25963527 GATTTTGAACAAATTCAGCAAGG - Intronic
1106400677 13:29427126-29427148 GTTTTAAAACAAAGTGTGCCAGG - Intronic
1107183759 13:37493379-37493401 GGATTTAAACCAAGGCAGCACGG - Intergenic
1108963922 13:56272571-56272593 GTTTTTAAATTAATTGAGCAAGG - Intergenic
1111304423 13:86388479-86388501 GGTTATGAACAAAGGGAGAAAGG + Intergenic
1111664749 13:91253173-91253195 TGTTTTAAAAAAATTGTGCAGGG + Intergenic
1112427233 13:99313629-99313651 GGTTTCAGACAAAGGGAGGAAGG + Intronic
1113169064 13:107478037-107478059 AGTTTTAAACGCAGAGAGCAGGG - Intronic
1114276598 14:21151991-21152013 GATTTTCAACAAAGTTACCAAGG - Intergenic
1114903035 14:27089523-27089545 GGTTTTAAACAAAGATTGAAGGG + Intergenic
1115758213 14:36551016-36551038 GTTATTAAACTAAGAGAGCAGGG - Intergenic
1117210002 14:53486736-53486758 CCCTTTAAACAAATTGAGCAGGG + Intergenic
1118831028 14:69432810-69432832 GATCTTCAACAAAGTGACCATGG - Intronic
1119571240 14:75675333-75675355 GGGTTTAAACAAAAATAGCATGG - Intronic
1120144510 14:80965002-80965024 TGTTTTAAAGAAAGTGTCCAGGG + Intronic
1121034491 14:90689129-90689151 GATTTTAAACAAAAGGATCAAGG + Intronic
1122658190 14:103276643-103276665 GGTTTTCAACAATGTGACTAAGG - Intergenic
1125184491 15:36914911-36914933 TGTTATAAACAACGTGAGCCAGG + Intronic
1125499920 15:40233252-40233274 GGTTTTCAAGTAAGTGAACAGGG - Intergenic
1126690477 15:51285391-51285413 GTTTTTAAATTAATTGAGCAAGG - Intronic
1127466254 15:59247659-59247681 GCTTTTAAGCAGAGTGAGCTGGG + Intronic
1127768667 15:62212501-62212523 GTTTTTAAATTAATTGAGCAAGG + Intergenic
1129088659 15:73124671-73124693 TGTTTTAAACAGAGTGTTCAAGG - Intronic
1129321579 15:74777937-74777959 GGTTTTGGACAAAATGAGCTTGG - Intergenic
1129807924 15:78480295-78480317 GATTTTAAAAAATGTGAACAAGG - Intronic
1130818019 15:87461236-87461258 GTTTATAAAGATAGTGAGCAAGG + Intergenic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1132353448 15:101154720-101154742 AGTTTTAAAGAAAATGAGAAGGG - Intergenic
1133084645 16:3352649-3352671 GGTATTAGACAAAGTGAACAGGG - Intergenic
1137306677 16:47207497-47207519 GGTTTTCAAAAAAGTGATTAGGG + Intronic
1137908040 16:52345777-52345799 GATTTTAAACAAAGATAGAAAGG + Intergenic
1138643744 16:58407343-58407365 AGTTTTTAACAAAGTGTGCTGGG - Intergenic
1138930564 16:61650529-61650551 GTTATTTAACAAATTGAGCATGG + Exonic
1139068307 16:63346842-63346864 GGTTTAAAACAACATGAGCCAGG - Intergenic
1140662028 16:77197440-77197462 AATTTTAAACCAAGTGATCAGGG + Intronic
1140679328 16:77368739-77368761 GTTTTTAAAAAAAATCAGCAAGG + Intronic
1141121795 16:81364526-81364548 AGTTTTAAATAAAGTTAGCCGGG + Intronic
1142626784 17:1197345-1197367 GGTTTGAAAAAAATTGGGCAGGG + Intronic
1146127858 17:30243075-30243097 GTTTTTCAACAAAGGAAGCATGG + Intergenic
1146558240 17:33846091-33846113 GGATATAAACAAAATGAACAAGG + Intronic
1150456421 17:65310146-65310168 GGTTTGGGACAAAATGAGCATGG - Intergenic
1153923100 18:9808600-9808622 GGATTCAAACAAAGAGAGAAGGG - Intronic
1153925183 18:9829209-9829231 GGTTATCACCAAAGTCAGCAGGG - Intronic
1157783584 18:50461986-50462008 GCTTTTAAACAAAGTAAGTGTGG - Intergenic
1158270538 18:55709633-55709655 GATTTTCAACAAAGTTACCAAGG - Intergenic
1158987436 18:62832901-62832923 GGTTTCATACCACGTGAGCATGG + Intronic
1159557028 18:69956188-69956210 GGTATGTAACCAAGTGAGCATGG - Intronic
1160250241 18:77197194-77197216 GGTTTTAAAGAAGGTGGGGAAGG + Intergenic
1165771020 19:38380399-38380421 TTTTTGGAACAAAGTGAGCAGGG + Intronic
1165808331 19:38595746-38595768 GGTTTTAAGAACTGTGAGCAAGG + Intronic
925832510 2:7910183-7910205 GTTTTTATACATTGTGAGCAGGG - Intergenic
927542841 2:23927666-23927688 GTTTTTAAACAAAGCGAGGCAGG + Intronic
927807354 2:26159820-26159842 AATTTTAAAGAAAGTGAGCCAGG + Intergenic
929220892 2:39463916-39463938 GGTTTTAAAAGACATGAGCAGGG - Intergenic
930217889 2:48715609-48715631 TTTGTTAAACAAAATGAGCATGG + Intronic
930754869 2:54963988-54964010 GCTGTTAAACAAGGTGAGCTTGG + Exonic
930850014 2:55950582-55950604 GGATTAAGACAAAGAGAGCAGGG + Intergenic
930919859 2:56739416-56739438 GGTTTTGAAGAAAGAGAGAAGGG - Intergenic
931298588 2:60954912-60954934 AGTGAAAAACAAAGTGAGCAAGG - Intronic
932187694 2:69713029-69713051 GGTGTTGTATAAAGTGAGCAAGG - Intronic
935291943 2:101618457-101618479 GGTTTTAAACCAACAGAGCCTGG + Intergenic
937689014 2:124733039-124733061 TGTGTTAAATAAAGTGAACAGGG - Intronic
939120090 2:138105869-138105891 GGGTTGAAGCAAATTGAGCAGGG - Intergenic
939609574 2:144294034-144294056 GGTTTTGGAGAAAGTAAGCAAGG - Intronic
939942867 2:148372003-148372025 TGTTTTAAACAAGTTGAGAATGG - Intronic
940538073 2:154971822-154971844 GGTTGTAAAAAAATTAAGCAAGG + Intergenic
941123208 2:161555399-161555421 TATTTTAAAGACAGTGAGCAAGG - Intronic
941415652 2:165217688-165217710 GCTCTTACAAAAAGTGAGCATGG + Intergenic
943267029 2:185745028-185745050 GGTTTGGATCAAAGTGAGAAAGG + Intronic
943348947 2:186774443-186774465 AGTTATAACCAAAGAGAGCAGGG + Intergenic
945978822 2:216292192-216292214 GGTTGTAAATAAAGTGTGAAGGG - Intronic
946344376 2:219096606-219096628 AATTTTAAATAAAGTGATCAGGG + Intronic
946489483 2:220133825-220133847 GGTCTTATACAAAGTGAGGTGGG - Intergenic
947347673 2:229209984-229210006 GGTTTGAAAAAAAGTGATTATGG - Intronic
947600318 2:231443990-231444012 GATTTAATACAAGGTGAGCAGGG - Intergenic
1169536565 20:6549642-6549664 ACTTTTAAACAAAGATAGCAAGG + Intergenic
1173215126 20:41074191-41074213 TTTTTTAAACAAAGTAAGGAAGG + Intronic
1174674445 20:52340081-52340103 GGTTGTAAGCAAAGTGAGGATGG + Intergenic
1175240459 20:57544020-57544042 GTTTTTAAACATGGTAAGCATGG - Intergenic
1177279148 21:18956584-18956606 GGTGTAAAACAATGTGAGGAAGG - Intergenic
1181728272 22:24826701-24826723 TGTTTTAGACAAGGTGATCAGGG + Intronic
1182387038 22:29952761-29952783 GGTTTTAGAAAATTTGAGCAGGG + Intronic
1182915073 22:34021936-34021958 GCTTTTAAAAAGAGAGAGCAAGG - Intergenic
1184707894 22:46227719-46227741 GGTTTTAAACAGCGTGAGGCAGG - Intronic
949355918 3:3180035-3180057 GTTTTTAAACGAAGGGGGCAGGG + Intergenic
950888595 3:16382795-16382817 GGCTTGAAATAAAGTGAGCTTGG - Intronic
951391229 3:22106598-22106620 GGTATTAAACCAAGGGGGCAGGG - Intronic
951406036 3:22298297-22298319 CATTTAAAACAAAGTGAGGATGG + Intronic
953956697 3:47236894-47236916 AGTTTTAAATAAAATAAGCATGG - Intronic
954322500 3:49841690-49841712 GGGTTCAAACAAAGGCAGCATGG + Intronic
955796602 3:62643956-62643978 GGTTGTAAAAAAAGGGAGGAAGG + Intronic
956936336 3:74106093-74106115 GGTTTTAAAACAACTGAGAATGG - Intergenic
957257851 3:77861886-77861908 GGTTTTAAAAATAGTTAGCAAGG - Intergenic
957347088 3:78975550-78975572 GGTTTTAAAAAAAGGGAGAGGGG + Intronic
958581545 3:96031955-96031977 GTATTTAGACACAGTGAGCATGG - Intergenic
959130126 3:102344654-102344676 GGAACTAAACAAAGTAAGCAAGG + Intronic
961725210 3:128923699-128923721 GTTTTTAAATTAATTGAGCAAGG - Intronic
967365009 3:188676575-188676597 CGTTTTAAACAAATTGTGCCAGG + Intronic
968331913 3:197878089-197878111 GTCTTTAAACAAAGAGAGTATGG + Intronic
971060964 4:22969084-22969106 TGTTTAAAATAAAGTGGGCAAGG + Intergenic
971389942 4:26176339-26176361 GGTTTTAAACTCAGTGAGTCTGG - Intronic
972389928 4:38604930-38604952 TGTTTTAAACAAATTGAAGAGGG - Intergenic
972424727 4:38921609-38921631 GGCTCTAAAGACAGTGAGCAGGG + Intronic
973690796 4:53428792-53428814 GGTTAAAAACAAAGTAAGAAAGG - Intronic
973726910 4:53786168-53786190 GTTTTTAAACAAACTAAACAGGG - Intronic
973808945 4:54551613-54551635 GTTTTTTAACAAATTCAGCAAGG - Intergenic
975809698 4:78154386-78154408 GGTTTTAAACAAATAGACCAAGG - Intronic
977365805 4:96067044-96067066 GGTTTTGAAAAAAATGAGAAGGG + Intergenic
977372282 4:96154058-96154080 GATTTTAAAATAAGTAAGCAGGG + Intergenic
977861586 4:101967472-101967494 AGATTTAAACAAATTGAGAAAGG + Intronic
978165384 4:105601108-105601130 GGTTTTAATCAGAGTGAGAGGGG - Intronic
978306503 4:107334249-107334271 GTTTTTAAATTAATTGAGCAAGG - Intergenic
978371442 4:108033358-108033380 CTTTTTAAAAAAAGTTAGCAGGG + Intronic
979767550 4:124480486-124480508 GGTTTTAAAATAACTGTGCAGGG + Intergenic
980034726 4:127870848-127870870 GTTTTTAAATAGAATGAGCAGGG + Intergenic
982416245 4:155135748-155135770 TTTTTTAAACAAAGTGAGGGAGG - Intergenic
982758591 4:159253273-159253295 GGTTTTAATAAAAGAGAGTAAGG - Intronic
982850952 4:160315838-160315860 GCTTATAAACAAAGTGGCCATGG - Intergenic
983017786 4:162636522-162636544 AATTTTAAAAAAAGTGACCATGG - Intergenic
987758211 5:22124422-22124444 GGTTTTGAAAAAAATAAGCAAGG - Intronic
988547967 5:32175256-32175278 TTTTTTAAAAAAAGTGATCATGG + Intergenic
991255740 5:64612176-64612198 GGTTTTAAACAATGTGGTCGTGG - Exonic
993051558 5:82932189-82932211 CATTTTGAAAAAAGTGAGCATGG + Intergenic
993221855 5:85109468-85109490 GCTTATGAACAAAGTGACCATGG + Intergenic
997713390 5:136024680-136024702 GGTCTTCCACAAAGTGAGCTGGG + Intergenic
999654060 5:153795495-153795517 GTTTTGAAACTCAGTGAGCAAGG + Intronic
1000833830 5:166132495-166132517 GGTTTTTAATAAAGAGGGCATGG + Intergenic
1001949075 5:175803577-175803599 GGATAGAAACCAAGTGAGCAAGG + Intronic
1006860249 6:37167538-37167560 GGCTTTAAACTAAGTTAGCCTGG - Intergenic
1007027378 6:38590204-38590226 TGTTTAAAACAATGTGATCAAGG + Intronic
1007028833 6:38607671-38607693 GTTATTATACAAAGTGAGCCTGG - Intronic
1007646233 6:43383459-43383481 GCTTGTGAACAAAGTGACCATGG - Intergenic
1008590430 6:52988470-52988492 TGTTGTTAACAAAGTGAGAAGGG + Intronic
1008744424 6:54652118-54652140 GGTTTTAAAAAAATTGGGCCAGG + Intergenic
1011526559 6:88271759-88271781 GGTTATAAACAAGGAGAGGAGGG + Intergenic
1011968935 6:93197450-93197472 GGTTTTAAGCAATTTGATCATGG - Intergenic
1013587727 6:111594539-111594561 GGCTTTAAAAAAAGTGATGAGGG + Intronic
1016051115 6:139531331-139531353 TGATTTAAACAAAATGGGCAGGG - Intergenic
1016703820 6:147083542-147083564 GTTTTTAAAATAATTGAGCATGG - Intergenic
1017609852 6:156173975-156173997 GCTTTGAAACAAAGAGATCACGG + Intergenic
1017982818 6:159417134-159417156 CTTTTCAAACAAAGTGAGCAGGG - Intergenic
1020909608 7:14112047-14112069 TGGTTGAAACAAAGTGAGCAAGG - Intergenic
1021303465 7:19001843-19001865 ATTTTTAAATAAGGTGAGCAGGG + Intronic
1021918513 7:25459663-25459685 AGTTTTAAATAAGGTGATCAAGG - Intergenic
1023388727 7:39686703-39686725 GGCTTTACACAAAGTCATCATGG + Exonic
1024247862 7:47483987-47484009 CGTTTTTAAGAAAGTGAGCTGGG + Intronic
1028399542 7:90409713-90409735 GGTGTTAAGCAAAGTGAATAAGG - Intronic
1029919732 7:104250420-104250442 GATTTTAAAGAAACTGAGCTGGG - Intergenic
1030707219 7:112706052-112706074 GGTTTTAAAAAAAGTGTATAAGG - Intergenic
1031916012 7:127563831-127563853 GGGATTAAACCAGGTGAGCATGG - Intergenic
1032444127 7:131966079-131966101 GTTTTTATACATAGTGAGAATGG - Intergenic
1032495855 7:132361695-132361717 GGCTTTAATCAAAGTGTTCAAGG - Intronic
1032528518 7:132600008-132600030 GGATTTATTCCAAGTGAGCAAGG - Intronic
1034225763 7:149479971-149479993 GTTTTTAAAAAAAGTTAGCCAGG + Intronic
1034298800 7:149997043-149997065 GGTTTTAACCAAAGTGAGCTGGG - Intergenic
1034807217 7:154099738-154099760 GGTTTTAACCAAAGTGAGCTGGG + Intronic
1036972469 8:13370143-13370165 GCCTTTAGACAAAGTGATCAAGG - Intronic
1038148786 8:24923494-24923516 GGTGTTGAACACAGTTAGCATGG - Intergenic
1038542327 8:28400394-28400416 GGGTTTAAACAAAGTTGGTAGGG + Intronic
1041851020 8:62393377-62393399 GGTTTTCAACAAAGATACCAAGG - Intronic
1043284192 8:78509237-78509259 GGTATAAAAAGAAGTGAGCAGGG - Intergenic
1046244819 8:111545397-111545419 GGTTGAAAACAAAGTTAGAAGGG - Intergenic
1047691150 8:127355974-127355996 GGTTTTGTACAGAGTGAGCATGG - Intergenic
1050881683 9:10708119-10708141 GGTTTTATAAATAGAGAGCATGG + Intergenic
1053285885 9:36849275-36849297 CCTTTTAAACACAGTGATCAGGG - Intronic
1053408750 9:37901151-37901173 TTTTTTAAACTAGGTGAGCATGG - Intronic
1055147237 9:72950810-72950832 GGTTACAAACCAAGTAAGCAAGG - Intronic
1058982894 9:110186637-110186659 GGGTTTCAAGAGAGTGAGCAGGG + Intergenic
1059847963 9:118302652-118302674 GGCTTTAAACAAAGTGAGGAAGG + Intergenic
1060147682 9:121266836-121266858 GGTGTTGAACAAAGAGAGAATGG + Intronic
1061830456 9:133289894-133289916 AGGTTTAAACAAAGTGAAAAGGG - Intergenic
1186635163 X:11395960-11395982 TGTTTTTAAAAAAGAGAGCATGG + Intronic
1186658021 X:11636961-11636983 TATTTTAAACAAATTGATCATGG - Intronic
1186893346 X:13981925-13981947 GGTTTTAAAGAAACTGAGAACGG + Intergenic
1187523018 X:20030010-20030032 GGCTTTCAGCAATGTGAGCAGGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188686882 X:33080314-33080336 GGGTTTAAGCAAAGTGAAAAGGG - Intronic
1189125146 X:38437844-38437866 GTTTTTATACAATGGGAGCATGG + Intronic
1189368552 X:40409302-40409324 GTTTTTAAACCCAGTGATCATGG - Intergenic
1191918427 X:66227095-66227117 GGTTTCATACAAAGTATGCAGGG + Intronic
1194517588 X:94875666-94875688 GGTTTGAAAGAACGTGAGCCAGG - Intergenic
1194521178 X:94920255-94920277 GCTCATAAACAAAGTGACCATGG + Intergenic
1194607673 X:96001663-96001685 GGAATTAAACAAATTTAGCATGG + Intergenic
1194875979 X:99188032-99188054 GCCTTTAATCAAAGTGTGCATGG + Intergenic
1195087380 X:101425141-101425163 GGTTTAAAAGAAAGTTAGGAGGG + Intronic
1195370820 X:104170500-104170522 GGTTTTCAATAAATTTAGCAGGG + Intronic
1195717547 X:107831518-107831540 GGCTATACACAAAGTGATCAAGG - Intronic
1197306856 X:124853250-124853272 GATTTTAAATAATGTGATCATGG + Intronic
1197988891 X:132295927-132295949 GCTCATAAACAAAGTGACCATGG - Intergenic
1198175490 X:134150443-134150465 GGTTTTATCCTGAGTGAGCAGGG - Intergenic
1200206696 X:154321468-154321490 GGATTGAAACAAGGTGTGCAAGG + Intronic
1201310523 Y:12594932-12594954 GGTTTTTAAGAAACAGAGCATGG + Intergenic