ID: 1092663202

View in Genome Browser
Species Human (GRCh38)
Location 12:10762995-10763017
Sequence ATTTTCCCAAACAAAAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092663202_1092663204 4 Left 1092663202 12:10762995-10763017 CCAGAGCTTTTGTTTGGGAAAAT No data
Right 1092663204 12:10763022-10763044 CTCTCTCCTTTATATCTGAAGGG No data
1092663202_1092663206 14 Left 1092663202 12:10762995-10763017 CCAGAGCTTTTGTTTGGGAAAAT No data
Right 1092663206 12:10763032-10763054 TATATCTGAAGGGCAGTCTTAGG No data
1092663202_1092663208 16 Left 1092663202 12:10762995-10763017 CCAGAGCTTTTGTTTGGGAAAAT No data
Right 1092663208 12:10763034-10763056 TATCTGAAGGGCAGTCTTAGGGG No data
1092663202_1092663207 15 Left 1092663202 12:10762995-10763017 CCAGAGCTTTTGTTTGGGAAAAT No data
Right 1092663207 12:10763033-10763055 ATATCTGAAGGGCAGTCTTAGGG No data
1092663202_1092663210 30 Left 1092663202 12:10762995-10763017 CCAGAGCTTTTGTTTGGGAAAAT No data
Right 1092663210 12:10763048-10763070 TCTTAGGGGGTTAGTATCCTTGG No data
1092663202_1092663203 3 Left 1092663202 12:10762995-10763017 CCAGAGCTTTTGTTTGGGAAAAT No data
Right 1092663203 12:10763021-10763043 TCTCTCTCCTTTATATCTGAAGG No data
1092663202_1092663209 17 Left 1092663202 12:10762995-10763017 CCAGAGCTTTTGTTTGGGAAAAT No data
Right 1092663209 12:10763035-10763057 ATCTGAAGGGCAGTCTTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092663202 Original CRISPR ATTTTCCCAAACAAAAGCTC TGG (reversed) Intergenic
No off target data available for this crispr