ID: 1092663207

View in Genome Browser
Species Human (GRCh38)
Location 12:10763033-10763055
Sequence ATATCTGAAGGGCAGTCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092663202_1092663207 15 Left 1092663202 12:10762995-10763017 CCAGAGCTTTTGTTTGGGAAAAT No data
Right 1092663207 12:10763033-10763055 ATATCTGAAGGGCAGTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092663207 Original CRISPR ATATCTGAAGGGCAGTCTTA GGG Intergenic
No off target data available for this crispr