ID: 1092666768

View in Genome Browser
Species Human (GRCh38)
Location 12:10809376-10809398
Sequence CTGCCTTTATGGCCCTCATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092666768 Original CRISPR CTGCCTTTATGGCCCTCATG TGG Exonic
900156029 1:1203602-1203624 CTCCCTTGCTGGCCCTGATGGGG - Exonic
901108642 1:6777564-6777586 CTGCCTTTGTGGAGCTCATGTGG - Intergenic
901324672 1:8359339-8359361 CTGCCTTTGTGGCCCCCTCGTGG - Intronic
903670489 1:25032614-25032636 CAGCGTTTATGGCTCTCATTAGG + Intergenic
906156152 1:43615224-43615246 CTGCCTATAGGGCCCCCCTGGGG + Intronic
906937662 1:50228163-50228185 CTGCCTTCATGGCCACCTTGAGG - Intergenic
907380153 1:54080524-54080546 CTGCCCTTTTGGCCCTCCTTGGG + Intronic
907710477 1:56876105-56876127 CTGCCTTGATGGCTCTGATGAGG + Exonic
908163879 1:61438333-61438355 CTGCCTTTTCAGCCCTCAGGAGG + Intronic
912925908 1:113912813-113912835 CTACCTCTATGTCCTTCATGAGG + Exonic
916029403 1:160863041-160863063 CTGGCTGTTTGGCCCCCATGGGG - Intergenic
919954141 1:202395613-202395635 CTGGCTTTTTGGCCATAATGTGG + Intronic
920244479 1:204577351-204577373 CTGCCTTCTTGTGCCTCATGGGG + Intergenic
920248753 1:204608086-204608108 CTGCCTTTACGGCACCCACGAGG - Intergenic
921761673 1:218922451-218922473 CTGGCTTGATGGCCCTCACTTGG - Intergenic
1063424481 10:5940692-5940714 CTGCTTTCATGGCCTTCATAAGG + Intronic
1067658468 10:48215632-48215654 CTGCCTTTGGGGGCCACATGGGG + Intronic
1070831151 10:79418789-79418811 CTGGTTTTAAGGCCCTCAAGAGG - Intronic
1073989139 10:109243293-109243315 TTGTCTTTATGGCACTCATCTGG - Intergenic
1075042099 10:119116216-119116238 CTGCATTTATAGCTCACATGTGG - Intronic
1075540615 10:123310472-123310494 CTCACTTTTTGGCCCTCATTGGG + Intergenic
1075952611 10:126494895-126494917 CTGCCCTTCAGGCCCTCATAGGG + Intronic
1077310420 11:1886469-1886491 CTGCCTCCATGCTCCTCATGGGG - Intronic
1082098103 11:48147746-48147768 CTGCCTTAGGGGTCCTCATGCGG + Intronic
1085054600 11:73396188-73396210 CTGCCTTCAAGGCCCCCATGGGG + Exonic
1087740285 11:101879580-101879602 CTGTCTTTAAGTCCCTCAGGAGG - Intergenic
1088231708 11:107679649-107679671 CTGCCTTTATGGTCCTCCAGAGG + Intergenic
1092666768 12:10809376-10809398 CTGCCTTTATGGCCCTCATGTGG + Exonic
1098546703 12:71719343-71719365 CTGGCTTGAAGTCCCTCATGAGG - Intergenic
1099188198 12:79538808-79538830 CTGCCTTTAATGCCTGCATGAGG - Intergenic
1103503076 12:121420141-121420163 CTGGCTTTCTGGTCATCATGGGG + Intronic
1104392766 12:128404983-128405005 CTGCCTATCTGGCCTCCATGTGG - Intronic
1105546939 13:21357552-21357574 TTGCCTTGATGGCTCTCAAGCGG - Intergenic
1105796560 13:23859943-23859965 CTGCCCTTCAGGCACTCATGAGG - Intronic
1109048843 13:57451022-57451044 CTTCCTTTATGACCCTCAGAAGG - Intergenic
1112681148 13:101766264-101766286 CTGCCTCCATGGACATCATGAGG - Intronic
1114225438 14:20733607-20733629 ATGTGTTTATGGCTCTCATGGGG + Intronic
1115182665 14:30647569-30647591 CTGCTTTCATTGCCCTCATATGG + Intronic
1117072710 14:52070136-52070158 TTGCTTTTAAGGACCTCATGGGG - Intergenic
1121570772 14:94945093-94945115 CTGTCTTGATGGCCCTCCTGGGG + Intergenic
1126330102 15:47522685-47522707 CTGCCTTTGTGGCCTTTGTGTGG + Intronic
1128664184 15:69526291-69526313 CTGGCTTGAGGTCCCTCATGAGG - Intergenic
1130705646 15:86230617-86230639 CTGACTCCATGGCCCTCATCTGG - Intronic
1134214697 16:12308017-12308039 CTGCCTTCATGGTGCTCATATGG + Intronic
1134506262 16:14809957-14809979 GAGCCTTTATGGCCCTCATAAGG + Intronic
1134574290 16:15318807-15318829 GAGCCTTTATGGCCCTCATAAGG - Intergenic
1134728130 16:16437491-16437513 GAGCCTTTATGGCCTTCATAAGG + Intergenic
1134939308 16:18274335-18274357 GAGCCTTTATGGCCTTCATAAGG - Intergenic
1139940244 16:70600378-70600400 CTGCCTTTATGGAAATCATAGGG - Intronic
1140067270 16:71622181-71622203 CTGCCTTTTTATCCCACATGTGG + Intergenic
1140147070 16:72321323-72321345 CTGTCTTTATGTCCCTTATTTGG - Intergenic
1142178928 16:88657823-88657845 CTGCCTCTGTGCCCCTCCTGAGG - Intronic
1143224968 17:5293531-5293553 GTGCCTATAGGGCCCTCAGGAGG - Intronic
1147846238 17:43405945-43405967 CTGCCATCTTTGCCCTCATGAGG + Intergenic
1148914206 17:50960831-50960853 CTGGCTATCTGGGCCTCATGAGG + Intergenic
1149335745 17:55633935-55633957 CTGCATTAATGGCTTTCATGAGG + Intergenic
1154372296 18:13775122-13775144 AAGCCTTTATGGCTTTCATGTGG - Intergenic
1156162946 18:34382212-34382234 GTGTCTTTATGTCCTTCATGAGG - Intergenic
1157136429 18:45061333-45061355 CTGTCTTTATGTCCCTCAAAGGG - Intronic
1157230573 18:45911958-45911980 CTGCCTGTGTGACCGTCATGGGG - Intronic
1159914632 18:74177440-74177462 CTGCCTTTATGGTTTTCAGGAGG - Intergenic
1163653668 19:18533093-18533115 CTGCCTGTGTGGCCGTCATGAGG + Intronic
1165900348 19:39166769-39166791 CGGCCTCTGTGGCCCCCATGAGG + Intronic
925385554 2:3459502-3459524 CTGGCTTTGTGGCCTTCTTGGGG - Intronic
928634228 2:33226782-33226804 TTGCCTTCATGGCCCTCAGTTGG + Intronic
928733027 2:34254903-34254925 CTTTCTTTATAGCTCTCATGGGG + Intergenic
929990312 2:46781058-46781080 CTGGCTTTCTGCCCCTCGTGGGG - Intergenic
931668461 2:64626527-64626549 CTCCCTTTATCACCCTCAGGTGG - Intergenic
932732670 2:74232102-74232124 CTGCCCTGATGGCCCTCCTGCGG - Intronic
934851799 2:97706717-97706739 CTGCCTTTCTGGCCCTTGGGAGG + Intergenic
938223868 2:129598279-129598301 CTGCCTTCAGGTTCCTCATGTGG - Intergenic
938288994 2:130139753-130139775 CGGCCTGCATGGCCCTCACGGGG + Intronic
938467536 2:131533185-131533207 CGGCCTGCATGGCCCTCACGGGG - Intronic
944103954 2:196059434-196059456 CTGCCTTTTTTGCCCTCCTTTGG + Intronic
944149645 2:196544305-196544327 CTGCCTTTCAGGGGCTCATGAGG - Intronic
946002416 2:216493565-216493587 CTCCCTTTGTGGGCCTCAAGCGG + Intergenic
949080962 2:242099353-242099375 GTGCCTGTAGGGCCCCCATGCGG + Intergenic
1172879411 20:38189382-38189404 CTGCCTTCAGATCCCTCATGAGG + Intergenic
1178639620 21:34335551-34335573 CTCCCCTGATGGCCCTAATGAGG - Intergenic
1178671553 21:34595762-34595784 CTGCCTGGATGGCTCTGATGGGG + Intronic
1179367391 21:40771169-40771191 GTGGCTTTCTGTCCCTCATGTGG - Intronic
1183975029 22:41507053-41507075 CTGCCATTTTGGCTCTGATGAGG + Intronic
1184468989 22:44684901-44684923 CTCCCTTTACTGCCCTCTTGTGG + Intronic
1185056407 22:48580885-48580907 TTGTTTTTATGGCCCTGATGAGG + Intronic
951473842 3:23083505-23083527 CTGCCTCAAGGTCCCTCATGAGG - Intergenic
951896849 3:27617738-27617760 CTGGCTGTGTGGCCCTCATCTGG - Intergenic
951999937 3:28773470-28773492 CTGCCCTTATGCCCCTGATTTGG + Intergenic
953162055 3:40430063-40430085 CTGCCTTTAAAGAGCTCATGTGG - Intergenic
954891092 3:53929214-53929236 TTTCCTTTCTGACCCTCATGTGG + Intergenic
956500448 3:69877746-69877768 CTGTCTTTAAGGAGCTCATGAGG + Intronic
961683970 3:128617135-128617157 CTTTCTCTGTGGCCCTCATGTGG - Intergenic
961997032 3:131256948-131256970 CTGCCTGGATGGACTTCATGTGG + Intronic
963417726 3:145019375-145019397 CTGACTTTATGGGTCTTATGGGG + Intergenic
964480016 3:157130629-157130651 CTGGCTTTCTGGGTCTCATGTGG + Intergenic
965783807 3:172315603-172315625 CTGCCTTTCTGCTCCTAATGGGG - Intronic
967490352 3:190083601-190083623 CTGCCTTTATGCCTGTGATGGGG - Intronic
969505619 4:7585412-7585434 CTGCCTCTGGGGCCCTCAGGAGG + Intronic
970128803 4:12843921-12843943 CTTCCTTCATGGCCCTCAGAAGG - Intergenic
970595374 4:17595433-17595455 CTGCAAATATGGACCTCATGAGG + Exonic
972367302 4:38388188-38388210 TTTCCTTCATGGCCTTCATGTGG - Intergenic
975415859 4:74103577-74103599 CTGACTTTATGACCCTCCAGTGG - Intergenic
983192149 4:164766124-164766146 CTGCTGTTATTGCCCTCACGGGG - Intergenic
983651471 4:170040596-170040618 TTGCGTTTATGGACCTCATAGGG - Intergenic
984289233 4:177772125-177772147 CTGCATTTATGCCTCTAATGTGG + Intronic
986200208 5:5572593-5572615 CTGCCTTTCTTGCCCAAATGTGG + Intergenic
987412141 5:17625414-17625436 TTGGTTTTATGTCCCTCATGGGG - Intergenic
988500220 5:31777530-31777552 CTGCCCTTATGGCCCCCACGCGG + Intronic
988903826 5:35763933-35763955 CTGCCTTTAGGCCCTGCATGTGG - Intronic
993087126 5:83376989-83377011 CTGGCTAAATGGCCCTCCTGAGG + Intergenic
1002067012 5:176656921-176656943 CTGCCTTGATGTCACTCACGAGG - Exonic
1004426256 6:15509308-15509330 CTGTGTTTATTGCCCTAATGGGG + Intronic
1005438203 6:25837391-25837413 CAGCCATTGTGGCCCTGATGGGG + Intronic
1005670094 6:28097001-28097023 CTGACTTGATGGTCCTCATATGG - Intergenic
1006786947 6:36674600-36674622 CTGCAAATATGGACCTCATGAGG + Intergenic
1007190092 6:40007432-40007454 TTCCCTTTATTGCTCTCATGGGG - Intergenic
1007747656 6:44052940-44052962 CTGCCTCTTTGGCAATCATGAGG - Intergenic
1008270833 6:49487295-49487317 TAGCCTTTATGGACCACATGTGG + Intronic
1010190248 6:73187953-73187975 CTGCCTTTTTTGCCCTAATGGGG - Intronic
1013896249 6:115091981-115092003 CTGCCTTCATGGACCTTATTGGG - Intergenic
1019493282 7:1324892-1324914 CTGCCTTCTTTGGCCTCATGTGG + Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1023031737 7:36095616-36095638 CTGCCTTTCTGGCCCCCATTAGG - Intergenic
1024036125 7:45509063-45509085 CAGCCTCAATGGCCCACATGGGG - Intergenic
1027869110 7:83684058-83684080 TTGTTTTTATGGCCCCCATGGGG + Intergenic
1031919972 7:127593329-127593351 CAGCTTTTATGGCCCTTAGGAGG - Intronic
1033285711 7:140039053-140039075 CGCCCCTTATGGTCCTCATGGGG - Intronic
1036613861 8:10373570-10373592 CTGCCTTTGTGGGCCCCATGGGG + Intronic
1038484884 8:27927579-27927601 CTGCCTATAAGTCCCTCAAGAGG + Intronic
1039961379 8:42250497-42250519 CTGCCTTTATAATCCTAATGAGG - Intergenic
1040300130 8:46183652-46183674 CTGCCTCTATGTCCCTCTGGTGG + Intergenic
1040869015 8:52080800-52080822 CTGCCTTCAAGGTGCTCATGTGG + Intergenic
1045601907 8:103726666-103726688 CTTCCTTTATGTCCCTCAATAGG + Intronic
1046058996 8:109113924-109113946 CTGCATATATAGCCCTCTTGAGG + Intronic
1056937625 9:90928749-90928771 CAGACTTTATGGGCCTCATAGGG - Intergenic
1057386421 9:94609405-94609427 ATGCATTTATGGACCTGATGGGG - Intronic
1057477383 9:95414262-95414284 CTTCTTTTATGGCCCTCCTTGGG + Intergenic
1057855227 9:98596381-98596403 CTGCCTTTATTTCCCCCATTGGG - Intronic
1060665567 9:125430276-125430298 CTACCTTCAGGGCCCTCTTGAGG + Intergenic
1062367999 9:136221071-136221093 GTGCCTGTGTGCCCCTCATGAGG - Intronic
1062368008 9:136221118-136221140 GTGCCTGTGTGCCCCTCATGAGG - Intronic
1062368033 9:136221212-136221234 GTGCCTGTGTGCCCCTCATGAGG - Intronic
1062528779 9:136990484-136990506 CTGCCCTCATGGACCTCCTGGGG + Intergenic
1062708405 9:137957831-137957853 CTGGCTTTGTGACCCCCATGTGG + Intronic
1186163775 X:6805391-6805413 CTGCCCTTAGGACCCTCAAGCGG - Intergenic
1186529491 X:10280827-10280849 TTGCCTTTTTGCCACTCATGAGG - Intergenic
1189246450 X:39567076-39567098 CTTCCCTCATGGCCCTCAAGAGG + Intergenic
1189601731 X:42633971-42633993 CTGCCTTTATGGCCAAGAAGGGG - Intergenic
1191180273 X:57554817-57554839 CTGCCTTTCTCGGCCTCCTGAGG + Intergenic
1198837191 X:140817424-140817446 CTGCCTTTCTGCCGCACATGGGG - Intergenic
1199222872 X:145337739-145337761 CTGCCTGTCTGGCCCCCATGTGG - Intergenic
1200038988 X:153352416-153352438 CTCATTTTATGGCCCGCATGTGG - Exonic
1202580487 Y:26375717-26375739 CTGGCTTTTTGGCCATAATGTGG - Intergenic