ID: 1092668620

View in Genome Browser
Species Human (GRCh38)
Location 12:10836422-10836444
Sequence ATAACTAATCCCCAAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092668617_1092668620 24 Left 1092668617 12:10836375-10836397 CCAATATATGCATATGACCCAAT 0: 1
1: 0
2: 1
3: 13
4: 196
Right 1092668620 12:10836422-10836444 ATAACTAATCCCCAAGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 136
1092668618_1092668620 7 Left 1092668618 12:10836392-10836414 CCCAATATATACATTTTCTCAAG 0: 1
1: 0
2: 3
3: 63
4: 472
Right 1092668620 12:10836422-10836444 ATAACTAATCCCCAAGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 136
1092668619_1092668620 6 Left 1092668619 12:10836393-10836415 CCAATATATACATTTTCTCAAGT 0: 1
1: 2
2: 2
3: 48
4: 446
Right 1092668620 12:10836422-10836444 ATAACTAATCCCCAAGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092668620 Original CRISPR ATAACTAATCCCCAAGAGAG AGG Intronic
904047596 1:27617911-27617933 AGAAAGAATCCCCAAGGGAGAGG - Intronic
907266565 1:53265229-53265251 GGAACTAATCACCCAGAGAGAGG - Intronic
907366326 1:53963673-53963695 ATAACAGATCCCCAAGACATAGG - Intronic
907909186 1:58812254-58812276 AAAACCAATCCCAAAGAGGGGGG - Intergenic
910623675 1:89284202-89284224 AATATTAATCCCCAAGACAGTGG + Intergenic
913525386 1:119686913-119686935 ATAAATAATCACCCAGAGAGTGG - Intronic
915926105 1:160020833-160020855 AAAACTAACCCCCAAGGTAGTGG + Intergenic
1068129747 10:52882809-52882831 ATAACTAGTCCTCAAGTAAGAGG - Intergenic
1069323821 10:67206207-67206229 ATAACTATTCCTCAAGTAAGAGG - Intronic
1073711211 10:106044722-106044744 ATCACTAATCCTCAAGGAAGAGG - Intergenic
1074915567 10:117951641-117951663 AGAACTAAAACCCAAGAGAATGG + Intergenic
1076329853 10:129656271-129656293 ACAACTGGTTCCCAAGAGAGGGG - Intronic
1078094651 11:8289401-8289423 TTAACCAAGCCCCAGGAGAGAGG + Intergenic
1078264196 11:9741107-9741129 ATAACTGCTCCCCAAAACAGGGG - Intronic
1078540223 11:12207123-12207145 ATATCAAATCCCACAGAGAGAGG - Intronic
1080025075 11:27604806-27604828 ATTATTAATCCCAAAGTGAGTGG + Intergenic
1082229470 11:49745495-49745517 AATACTAATCACCAAGACAGTGG - Intergenic
1083660254 11:64248772-64248794 CTACCTAATCCGCAAGAGCGAGG - Intergenic
1084397686 11:68924300-68924322 ATTCCTAAACCCCAAAAGAGTGG - Intronic
1086562721 11:88186982-88187004 AGTATTAATCCCCAAGACAGTGG + Intergenic
1086620609 11:88883627-88883649 AATACTAATCACCAAGACAGTGG + Intronic
1086826799 11:91508183-91508205 AAGACTAATCCCCAAGACAATGG - Intergenic
1086968877 11:93058796-93058818 AAAACCAATCCCGAAGAGAATGG - Intergenic
1092668620 12:10836422-10836444 ATAACTAATCCCCAAGAGAGAGG + Intronic
1092981545 12:13799680-13799702 ATAACAAATCAGCAGGAGAGAGG + Intronic
1093124431 12:15311466-15311488 AAAACTATTCCCCAAAATAGAGG - Intronic
1094710040 12:32952825-32952847 ATAACTACTCCCCAAGGAACAGG - Intergenic
1095246503 12:39929587-39929609 AGAACTCAGCCACAAGAGAGAGG + Intronic
1099181123 12:79473524-79473546 ATTACTAATACCCAGGGGAGAGG + Intergenic
1106948423 13:34854901-34854923 ATAACAAACCCCTAAAAGAGGGG - Intergenic
1108031525 13:46235516-46235538 AAAACAAACCCCAAAGAGAGGGG + Intronic
1111252356 13:85619330-85619352 ATAACTAGTCCTCAAGAAAGAGG + Intergenic
1113087718 13:106585551-106585573 AATACTAATCCCCAAGACAATGG + Intergenic
1114376411 14:22151425-22151447 ATAACTAGTCCGCAAGAAAGAGG - Intergenic
1115131422 14:30056653-30056675 CTACCTAATTCCCAAGAAAGGGG - Intronic
1116101686 14:40446140-40446162 ATAACTAATCAGAAAGAGACTGG + Intergenic
1116277962 14:42861030-42861052 ATAACTAGTCCTCAAGTCAGAGG + Intergenic
1116589102 14:46748339-46748361 GTAACTAATCCTCAAGTAAGAGG + Intergenic
1117449360 14:55836208-55836230 ACTACTAATCCCCAGGATAGGGG - Intergenic
1119101017 14:71880361-71880383 AAAATTAATCCCCAAGACAATGG + Intergenic
1124198890 15:27659318-27659340 ATATATAAACCCCATGAGAGAGG - Intergenic
1125387811 15:39156846-39156868 ATAAATCATCACCCAGAGAGAGG + Intergenic
1127042180 15:54989184-54989206 ATAACTAGTCCTCAAGTAAGAGG - Intergenic
1132792263 16:1698173-1698195 AGAACTAATCGAGAAGAGAGGGG + Intronic
1133946337 16:10351837-10351859 ATAACTTGTCCCCAAGTAAGAGG + Intronic
1136079102 16:27839936-27839958 GTCACTGATCCCCAGGAGAGGGG - Intronic
1139163497 16:64538967-64538989 ATAACTAATCCCTAAGATTTAGG - Intergenic
1143542763 17:7579496-7579518 AAAACTAATGACTAAGAGAGAGG + Exonic
1148567317 17:48641384-48641406 ATACCCATTCCCCAAGAGAAGGG - Intergenic
1150992439 17:70275306-70275328 ATAAATATTCCCAAAGAGATTGG - Intergenic
1153802713 18:8685280-8685302 ATAAATGATCCCCTTGAGAGGGG + Intergenic
1155901157 18:31392665-31392687 ATAATTAATTGCCAAGGGAGTGG + Intronic
1156705581 18:39877564-39877586 ATAAATAATAGCCCAGAGAGAGG - Intergenic
1159236805 18:65685361-65685383 AAAACTAATCACCAAAAGAAAGG + Intergenic
1164432114 19:28197642-28197664 ATTCCTCATCCCCAGGAGAGTGG - Intergenic
1167777771 19:51572127-51572149 ACAAATAATCCCCAACATAGGGG - Intronic
925483485 2:4302758-4302780 AGACCTGATCCCCAGGAGAGAGG + Intergenic
926346865 2:11954976-11954998 TTAAGTAAGACCCAAGAGAGGGG + Intergenic
926379842 2:12275983-12276005 ATAATTAATCCACAGAAGAGGGG - Intergenic
926947390 2:18203259-18203281 AATACTAATCCACAAGACAGTGG + Intronic
928260494 2:29762400-29762422 ATAACTAATCCATTACAGAGGGG + Intronic
929963163 2:46511514-46511536 ATCACTAATCCCCAGGTGCGGGG + Intronic
930528629 2:52563336-52563358 ATCGCTAATCCCCGAGACAGTGG - Intergenic
930767471 2:55098764-55098786 ATAAATAATTCGCAAGAAAGGGG - Intronic
930837847 2:55813908-55813930 AAAATTTATCCCCAAGAGAATGG + Intergenic
936283569 2:111163249-111163271 ATGACTAATCCACACGAGACCGG - Intronic
936959188 2:118055829-118055851 ATAAGTTATCACAAAGAGAGAGG + Intergenic
937748366 2:125443314-125443336 GTAAATTATCCCCAAGAGTGTGG + Intergenic
938842007 2:135173178-135173200 ATAACTAATACCCAAGCGGTTGG + Intronic
939272552 2:139959651-139959673 AATACTAATCCCCAAGACTGTGG + Intergenic
941765374 2:169290954-169290976 ATAAATGTTCCCCAAGAGAATGG - Exonic
943132569 2:183872703-183872725 ATAACTAGTCCTCAAGTAAGAGG - Intergenic
943417734 2:187630167-187630189 AAGACTAATCCCCAAGATAATGG + Intergenic
944091880 2:195920876-195920898 ATAACTAATCCCACAAAAAGTGG + Intronic
946142703 2:217705205-217705227 ATAACTAATGCCACAGAGCGTGG - Intronic
1172607210 20:36222072-36222094 ATAAGAAACCCCCAAGAGAGGGG + Intronic
1174281283 20:49441346-49441368 ATATCTAATCTGGAAGAGAGGGG + Intronic
1174584125 20:51594266-51594288 ATAACTCATCCACAAAAGGGGGG + Intergenic
1175057317 20:56210242-56210264 GTACCTAAACCCCAAAAGAGAGG + Intergenic
1177182705 21:17760166-17760188 ATAACTAGTCTTCAAGTGAGAGG - Intergenic
1177973085 21:27814652-27814674 AAAAATATTCCCCAAGACAGGGG + Intergenic
1178672844 21:34607051-34607073 ATAATTAATGCCAAAGAGAGAGG - Intronic
951955737 3:28251293-28251315 ATGACTAGTTCCCAAGAGACTGG - Intronic
956537770 3:70297213-70297235 ATAACTAATTACCAAGAGCTAGG - Intergenic
957463677 3:80557116-80557138 TTAACTAACCCCTAAGATAGTGG - Intergenic
957841750 3:85679863-85679885 TTGACTAATACCCAATAGAGAGG - Intronic
959137446 3:102441766-102441788 ATAACTAGTCCTCAAGTAAGAGG + Intronic
959156758 3:102675841-102675863 AAATATAATCTCCAAGAGAGTGG - Intergenic
960357419 3:116670644-116670666 ATAATTAATGCCAAAGAGGGGGG + Intronic
962380462 3:134894330-134894352 AAAACTGAGGCCCAAGAGAGGGG - Intronic
964854560 3:161132455-161132477 AAAAATTATCCCCAAAAGAGAGG + Intronic
972869755 4:43283019-43283041 ATAGCTAAACACAAAGAGAGAGG - Intergenic
974854968 4:67450303-67450325 ATTAATATCCCCCAAGAGAGTGG - Intergenic
975221755 4:71820634-71820656 ATAACTAGTCCTCAAGTAAGAGG + Intergenic
977539158 4:98294716-98294738 ATCTGTGATCCCCAAGAGAGTGG - Intronic
980818283 4:137977737-137977759 ATAACTAATGGCCATGACAGAGG + Intergenic
981240246 4:142467854-142467876 CTCACTTATCACCAAGAGAGTGG - Intronic
982604041 4:157491207-157491229 AAGACTAGTCCCCAAGTGAGGGG - Intergenic
983082445 4:163403252-163403274 ATAACTATTCCTCAAGCAAGAGG - Intergenic
983826263 4:172265326-172265348 ATAACTATTCCAAAAGAGAAGGG + Intronic
985076543 4:186221324-186221346 AAAACTAAGCCCAAAGACAGAGG - Intronic
986509514 5:8489406-8489428 ATAACTAGTCCTCAAGAAAGAGG - Intergenic
986960392 5:13203231-13203253 ATTGCTAATCCCCAAGACAATGG - Intergenic
992225102 5:74612610-74612632 AGCACTAATTCCCAAGAAAGAGG + Intergenic
995100764 5:108301730-108301752 ATAACTATCCACCAAGAGACAGG + Intronic
995142130 5:108747094-108747116 ATAACTAGTCCTCAAGTAAGAGG + Intergenic
995426186 5:112026186-112026208 AGAACTAATCCCCAAAACATAGG + Intergenic
995458647 5:112378966-112378988 ATAACTAATTCACAGGAGAGTGG - Intronic
996182318 5:120434222-120434244 ATAACCATTCCCCACTAGAGTGG - Intergenic
996874484 5:128226099-128226121 GTAACTAATCCCCAAGCCTGTGG - Intergenic
997955847 5:138278005-138278027 CTCACTTATCCCCAAGAGAATGG - Intergenic
999806929 5:155090151-155090173 AAAATTAATACCCAAGAGAGGGG + Intergenic
1000180843 5:158809480-158809502 ATTTCTTATCCCCAAGATAGAGG + Intronic
1004029562 6:11853008-11853030 ACATATACTCCCCAAGAGAGTGG - Intergenic
1005395617 6:25378873-25378895 TTTTTTAATCCCCAAGAGAGTGG - Intronic
1006998300 6:38283914-38283936 ATTACTCATCCCCATGAAAGGGG + Intronic
1007668764 6:43534232-43534254 AGAACTAAACCCCAAGACACAGG + Intronic
1011390763 6:86850300-86850322 ATAACTGATCTCCAAGAGCTTGG - Intergenic
1012738470 6:102981674-102981696 ATAACTAATCCCCATGTAAGGGG + Intergenic
1018004880 6:159612583-159612605 ATAAATATTCCCCAAGACACAGG - Intergenic
1024556683 7:50609664-50609686 GAAACTCATCCCCAAGAGGGAGG - Intronic
1026723817 7:72855359-72855381 AAAACAAATCCCAAAGAAAGTGG - Intergenic
1031485585 7:122319481-122319503 ATAAGTAATCCCCAGGTGTGGGG - Intronic
1031567382 7:123317681-123317703 ATACCTAGTCCCCATGATAGGGG - Intergenic
1034385331 7:150736412-150736434 ATAACTAATCCTCAAGTAAGAGG - Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1039116815 8:34100540-34100562 ATAAATAATCCCCAAGAAGGAGG - Intergenic
1042145222 8:65721346-65721368 ATTACTACTCCCCAACATAGGGG - Intronic
1043965855 8:86474119-86474141 ATAAATAATCGCCATAAGAGTGG - Exonic
1045732311 8:105256240-105256262 AATACTAATCCCCAAGACAATGG - Intronic
1047549285 8:125852103-125852125 ATAAGAAAACACCAAGAGAGAGG - Intergenic
1047742484 8:127818001-127818023 AGAACTGATGCCCAGGAGAGGGG + Intergenic
1048850406 8:138640000-138640022 ATAACTAGTCCTCAAGTGAGAGG - Intronic
1050758369 9:9035671-9035693 ATAACTAGTCCTCAAGTAAGAGG - Intronic
1051503179 9:17800425-17800447 ATAACTAGTCCCCAAAAGCTGGG - Intergenic
1053026975 9:34738260-34738282 ATAAATCACCCCCAAGTGAGTGG - Intergenic
1056682573 9:88732074-88732096 AAAACTACTCTCCAAGGGAGAGG + Intergenic
1057604032 9:96485808-96485830 ATAACTAATACCCCACAGAGAGG - Intronic
1061752966 9:132793320-132793342 AAATCTAATCCCCAAGACAATGG - Intronic
1186230576 X:7449421-7449443 ATAACTAGTCCTCAAGTAAGAGG - Intergenic
1188609516 X:32078852-32078874 ATAACAATTTCCCAGGAGAGAGG - Intronic
1188705140 X:33318940-33318962 AAAGCTAATCCCCAAGAGGTTGG + Intronic
1189434332 X:40978050-40978072 ATAAATACTCTCAAAGAGAGAGG + Intergenic
1192039037 X:67597687-67597709 ATAACTATTTTCCAAGGGAGTGG + Intronic
1192667612 X:73104104-73104126 ATAAGGAGTCCCAAAGAGAGAGG - Intergenic
1193422058 X:81294196-81294218 ATTATTAATCCCCAAGAAAATGG + Intronic
1195362045 X:104092128-104092150 ACAACTAATCATCAGGAGAGTGG - Intergenic
1197595589 X:128460082-128460104 ATAGCAAATCCCCAGGAGAAGGG + Intergenic
1202175288 Y:22093420-22093442 ATCACTGAGACCCAAGAGAGTGG + Intronic
1202216074 Y:22492963-22492985 ATCACTGAGACCCAAGAGAGTGG - Intronic