ID: 1092669179

View in Genome Browser
Species Human (GRCh38)
Location 12:10843073-10843095
Sequence ATACCAGGTGGTGCTTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092669179 Original CRISPR ATACCAGGTGGTGCTTGTGG AGG (reversed) Intronic
902737015 1:18407958-18407980 ATGCCAGGTGCTGCCTGGGGAGG + Intergenic
903860746 1:26363055-26363077 GCACCAGGTGGTGCTTCTGCAGG + Exonic
908837588 1:68243539-68243561 ACAACATGTGGTGCTTGGGGTGG - Intergenic
912553478 1:110499346-110499368 ATGTCAGGTGGTGGTGGTGGGGG + Intergenic
912799821 1:112713913-112713935 ATTCCTAGTGGTGCTTCTGGGGG + Intronic
914678738 1:149923906-149923928 ATTCCAGGTGGTGGTCGGGGCGG + Exonic
915936107 1:160091210-160091232 AGGCCAGATGGTGTTTGTGGTGG + Intergenic
918854198 1:189729728-189729750 ATTCCAGGTGGTGCTATTTGGGG - Intergenic
919571857 1:199259011-199259033 AGCCCAAGTGCTGCTTGTGGGGG + Intergenic
922046670 1:221951827-221951849 ATACAAGGTTGTGCTGCTGGAGG + Intergenic
922462650 1:225825103-225825125 ACACCTGGTAGTGCTGGTGGGGG + Intronic
923148905 1:231216882-231216904 CTACCAGGTGGAGCTGGAGGTGG - Exonic
923238708 1:232059946-232059968 ATGCCAGGTGATGCTTTGGGAGG + Intergenic
924840399 1:247704803-247704825 ATAGTAGGTGCTGCTTTTGGAGG + Intergenic
1064138780 10:12772729-12772751 ATACCAGGTTGTCCTGGAGGAGG + Intronic
1064571814 10:16701677-16701699 AAATCAGGTGCTGCTTGTGTTGG - Intronic
1065092373 10:22247711-22247733 ATACCAAGTGATTCTCGTGGTGG - Intergenic
1065444873 10:25787958-25787980 GTACCAGGTGGTGCTTATGATGG + Intergenic
1065910977 10:30305211-30305233 ATACCTGGTGGTGGCAGTGGTGG - Intergenic
1068013742 10:51487518-51487540 TCACCAGGTGGGGCTTCTGGGGG - Intronic
1070929894 10:80253537-80253559 ATACCAAGTAGTACATGTGGAGG - Intergenic
1073748873 10:106501199-106501221 ATACCATGTGGGGATTGAGGTGG - Intergenic
1074963594 10:118469600-118469622 ATACCCTATGGTGTTTGTGGTGG - Intergenic
1076720417 10:132389951-132389973 ATGCCAGGTTCTGCATGTGGAGG + Intergenic
1077570996 11:3338665-3338687 AAACCAAATGGTGCATGTGGAGG + Intergenic
1078992529 11:16664465-16664487 ATCTCAGCTGGTGCCTGTGGAGG + Intronic
1081431875 11:42985276-42985298 ATATTAGTTGTTGCTTGTGGTGG + Intergenic
1083340970 11:61958139-61958161 CTCCCAGGTGGTGACTGTGGCGG + Exonic
1083363928 11:62130013-62130035 GTGCCAGCTGGTGCCTGTGGTGG + Exonic
1086500149 11:87444496-87444518 ATACCATGTGGTCCTTGTCCTGG - Intergenic
1088315162 11:108499152-108499174 AGACCCGGTGGTGATTGTTGTGG + Intergenic
1088459266 11:110065321-110065343 CTCCCAGGAGGTGGTTGTGGGGG - Intergenic
1088848987 11:113690215-113690237 ATGCCAGGTGTGGCCTGTGGTGG - Exonic
1090398553 11:126434509-126434531 ATCCCACGTGGAGCTTGTTGAGG + Intronic
1092145450 12:6211474-6211496 ATGCCAGGTGGTGCCTGGAGTGG - Intronic
1092669179 12:10843073-10843095 ATACCAGGTGGTGCTTGTGGAGG - Intronic
1093852583 12:24058867-24058889 ATTCCAGCTGCTGCTTCTGGTGG + Intergenic
1096761480 12:53845499-53845521 ATTCCAGGTAGTGGGTGTGGGGG - Intergenic
1098971703 12:76863884-76863906 ATCCCAGGAGGTGCTTTTGGGGG - Intronic
1101431073 12:104627820-104627842 TTAGCAGGTGGTGGGTGTGGTGG + Intronic
1101989869 12:109476192-109476214 TTACCAGGTGTTGCTGCTGGTGG + Intronic
1104282750 12:127392704-127392726 ATACCAGGTGGAGCTGGTGTAGG - Intergenic
1104860391 12:131920434-131920456 GGACCAGGTGCTGCTTCTGGAGG - Intronic
1105899436 13:24742780-24742802 ATACAAGGTGGTGCATCTGGAGG + Intergenic
1106254921 13:28013557-28013579 ATACCAGGTGGTGGTGTTGATGG + Intronic
1107715961 13:43199645-43199667 TTACCTGGTGGTGGTGGTGGGGG + Intergenic
1111842516 13:93467929-93467951 ATGCCAGGTGACACTTGTGGTGG + Intronic
1112329362 13:98465042-98465064 TGACCAGGTGCTGCTTGCGGTGG - Intronic
1118571578 14:67200059-67200081 ATTCCAGGTGGTGGTTGGGGTGG - Intronic
1119996286 14:79257339-79257361 ATTCCTGGTGGTGGTGGTGGTGG + Intronic
1120475287 14:84979064-84979086 ATTCCAGGAGGTGCTGGGGGAGG - Intergenic
1120912058 14:89676288-89676310 ATCCTAGGTGGTGGTGGTGGTGG - Intergenic
1126760020 15:51961347-51961369 ATACCAGGTGGTGGTGGTGGTGG + Intronic
1127972584 15:63973165-63973187 ATACCAGGTGTGGCTCCTGGAGG + Intronic
1130884150 15:88079150-88079172 GAACTAGGTGGTACTTGTGGAGG + Intronic
1131995710 15:98131034-98131056 ATACCAGGTGGTGAGTGCTGGGG - Intergenic
1132231981 15:100191150-100191172 ATCCAAGGTGGTGTTTGAGGAGG - Intronic
1133147773 16:3802862-3802884 ATTCTAGGTGGAGGTTGTGGAGG - Intronic
1133285512 16:4688832-4688854 AGGCCAGGTGGGGCTGGTGGTGG - Exonic
1135427221 16:22348704-22348726 AAACCAGGTGGTTCATTTGGTGG - Intronic
1135960162 16:26988383-26988405 ATACCAGGTGGTGGGGGCGGAGG + Intergenic
1138678899 16:58671195-58671217 CTACCAGGGGGTGCCAGTGGAGG - Exonic
1139949695 16:70663029-70663051 AAACCAGGGGCTGCTTGGGGGGG - Exonic
1142491286 17:281446-281468 AGAGCATGTGGTGTTTGTGGGGG - Intronic
1143741506 17:8957573-8957595 ATTCCAGGTGCTGCATTTGGAGG - Intronic
1144119802 17:12140863-12140885 ATACCAGGGAGTGTTTGTTGAGG - Intronic
1146677365 17:34782681-34782703 AGACCAGGTGGTGGTTCTGGGGG - Intergenic
1147153987 17:38533975-38533997 TTTCCAGGTGGTGGTGGTGGTGG - Intronic
1149653977 17:58300515-58300537 AGACCAGGTGGTACTTTAGGTGG - Intergenic
1150455733 17:65305134-65305156 ATGCCATGTGGCGCTTCTGGAGG + Intergenic
1151183085 17:72343696-72343718 ATCCCAGGAGGAGCATGTGGGGG - Intergenic
1151631429 17:75313779-75313801 AGCCCAGGTGGGGTTTGTGGGGG - Intergenic
1152025139 17:77804081-77804103 AAACAGGGTGTTGCTTGTGGTGG - Intergenic
1156367715 18:36445280-36445302 ATATGAGCTGCTGCTTGTGGTGG + Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1157753300 18:50196439-50196461 TTACCAGGTGATGCTGATGGTGG - Intergenic
1158143311 18:54280529-54280551 ATACCAGGTGATGATGGTGGTGG + Intronic
1158295708 18:55994791-55994813 ATACCACCTGGTGCATTTGGTGG - Intergenic
1162021415 19:7870074-7870096 AGAACAGGTGGGGCCTGTGGAGG + Exonic
1162021451 19:7870203-7870225 AGAGCAGGTGGGGCCTGTGGAGG + Exonic
1162021642 19:7870785-7870807 AGAGCAGGTGGGGCCTGTGGAGG + Exonic
1162402104 19:10452871-10452893 ATGTCAGGTGGTGCTGGGGGTGG - Intronic
1162956650 19:14102549-14102571 AAACCAGGTGCTGCTTTTGAGGG + Intronic
1163245278 19:16089779-16089801 ATAGCAGGTGGTGGCTGAGGTGG - Intronic
1165810692 19:38610013-38610035 ATACCAGTTGATGCTGGCGGAGG + Exonic
1167781164 19:51600200-51600222 ATATCAGGGGGTACTAGTGGCGG + Intergenic
926080747 2:9984243-9984265 ACACCCAGTGCTGCTTGTGGTGG + Intronic
926120781 2:10240258-10240280 GTACTAGGTGGTTCTCGTGGGGG - Intergenic
927152164 2:20202512-20202534 ATGCCAGGTGCTGGCTGTGGTGG + Exonic
927782642 2:25951950-25951972 AGACCACGTGGTGCATGTGAGGG + Intronic
927804631 2:26135815-26135837 ATACCATGAGGTGGTTGGGGAGG - Exonic
928082962 2:28326479-28326501 AGGCCAGGTGGTGGGTGTGGGGG - Intronic
929901780 2:46010699-46010721 ATTCAAGGTTGTGCTTGTGAAGG + Intronic
933653736 2:84870509-84870531 ACTCCAGGTGGCGCTTGAGGCGG + Exonic
936419178 2:112347149-112347171 AGACCAGATGGTGGTGGTGGTGG - Intergenic
936915565 2:117636291-117636313 ATATCACATGGTGGTTGTGGTGG - Intergenic
941354704 2:164475794-164475816 ATACCACTTGGTGCTTTTGAAGG - Intergenic
942066715 2:172278591-172278613 ATGTCAGGTGGTGCGTGTGTAGG - Intergenic
944754191 2:202742875-202742897 CTCCCAAGAGGTGCTTGTGGGGG - Intronic
945055844 2:205868380-205868402 ATCCCGGGTGGTGGTTGTGGGGG - Intergenic
1169420746 20:5457266-5457288 ACACCAGGTGGGGCCTGTTGGGG - Intergenic
1171060784 20:21957127-21957149 ATCCTAGGTGGTGGCTGTGGAGG + Intergenic
1172134140 20:32675851-32675873 ATGCCAGGTGCTGCTTCTGGAGG - Intergenic
1173565058 20:44032558-44032580 GTGCCAGGTGGTGGTGGTGGTGG + Intronic
1173859205 20:46271098-46271120 ATAGCAGCTGCTGTTTGTGGAGG + Intronic
1174065347 20:47860682-47860704 GTCCCAGGTGGTGTTGGTGGTGG - Intergenic
1176917342 21:14642594-14642616 AAATCAGGTGGTGGTTGTGAGGG - Intronic
1177936470 21:27352480-27352502 ATAGCAGGTTGTGGTTGTGAGGG - Intergenic
1178445621 21:32638954-32638976 CTTCGAGGTGGTGGTTGTGGTGG + Exonic
1178974188 21:37207853-37207875 ATACCAGCTGCTCGTTGTGGAGG - Intergenic
1179724656 21:43335420-43335442 AGACCAGGTGGTGCTTCTGGGGG + Intergenic
1180874425 22:19168628-19168650 ATACCAGATGGAGCTGGAGGTGG - Intergenic
1182097896 22:27638326-27638348 ATGCTAGGTGGTACTTGGGGTGG - Intergenic
1182757337 22:32690639-32690661 ATATCAGGAGGTGGTAGTGGTGG + Intronic
1182902090 22:33907030-33907052 ATACCAAGGGGTGCTTGTTCTGG - Intronic
1185315259 22:50176333-50176355 ACACCAGGTGGGGCTGGTTGGGG - Intronic
950331357 3:12158655-12158677 ACAGCAGGGGGTGGTTGTGGGGG - Intronic
950485727 3:13273153-13273175 AAGACAGGTGGTGCATGTGGAGG + Intergenic
953932693 3:47013571-47013593 ATCCCAGGTGCTGCTTGGAGAGG - Intergenic
956071288 3:65454826-65454848 ATACGTGGTGGTGATGGTGGTGG - Intronic
956436953 3:69243481-69243503 ATGCCAGGTTGTGCTGGTGTTGG + Intronic
957125553 3:76155558-76155580 ATAACAGGGGCTGCTTTTGGAGG + Intronic
961663535 3:128482888-128482910 GCACCAGGTGGTGAGTGTGGGGG + Intronic
962462715 3:135629294-135629316 AAACCAGGTTGTGGCTGTGGTGG - Intergenic
962742607 3:138372922-138372944 ATACAAGCTGGTGGTGGTGGGGG + Exonic
965063072 3:163806418-163806440 ATACCAGGTGCTACTTCTAGAGG + Intergenic
966240612 3:177751904-177751926 GTTCCAGGTGGTGTTTCTGGAGG - Intergenic
966680063 3:182632390-182632412 ATGAGAGGTGGTGCTGGTGGTGG + Intergenic
968024287 3:195426236-195426258 ATAGCAGGTGGTGGTGGTTGTGG - Intronic
968230037 3:197000093-197000115 CTCCCAGGTGGTGCCTGTGCTGG - Intronic
969350396 4:6594918-6594940 GAATCAGGTGGTGCATGTGGTGG - Intronic
977069432 4:92365472-92365494 AGACTGGGTGGTGCTGGTGGTGG + Intronic
978374041 4:108056766-108056788 ATAGGAGGTGGAGGTTGTGGTGG - Intronic
978461395 4:108957347-108957369 ACACCATGTGGTGGTGGTGGTGG - Intronic
979766198 4:124467083-124467105 ATACCAGGTGGTCATTGTAAAGG - Intergenic
979950907 4:126892405-126892427 ATACCAGGGGGTACATGTGCAGG + Intergenic
985303446 4:188513691-188513713 ATAGCAGGTGGTGAGTGTGAGGG - Intergenic
985965565 5:3336767-3336789 ACCCCAGGAGGTGCATGTGGTGG + Intergenic
986418130 5:7548981-7549003 ATTACAGGTGGTGTTTTTGGAGG + Intronic
992190175 5:74284411-74284433 CTCCCAGGTGATGCTTGTGCTGG + Intergenic
992777909 5:80104464-80104486 TTACCAGGTGGTGGCTGTGCTGG + Intergenic
1000045837 5:157521465-157521487 ATCCCAAGTGGCGGTTGTGGTGG - Intronic
1002908360 6:1469168-1469190 ATGCCAGGTGTTACCTGTGGTGG - Intergenic
1003202026 6:3970038-3970060 ATTCCTGGTGGTGGTGGTGGTGG + Intergenic
1006837230 6:37006288-37006310 ATAAAATGTGGTGGTTGTGGGGG + Intronic
1013422506 6:109979142-109979164 CTCCCAGGTGGTGGTAGTGGCGG + Exonic
1014104291 6:117545631-117545653 ATTGGAGGTGCTGCTTGTGGGGG + Intronic
1016774298 6:147887812-147887834 ATACCAAGTGCTGGCTGTGGAGG - Intergenic
1017478448 6:154824360-154824382 TTACCAGGTGGTGGTTGTGAAGG - Exonic
1019020224 6:168911833-168911855 ATACCAGAACATGCTTGTGGTGG - Intergenic
1025651487 7:63473515-63473537 ATAGCATGTGCTGCGTGTGGTGG - Intergenic
1027230952 7:76272125-76272147 GCACCAGGTTGTGCTGGTGGGGG - Intronic
1027826918 7:83126712-83126734 ATACCTGTTGGTGATTTTGGGGG - Intronic
1029308458 7:99639442-99639464 AAACTAGGTGGTCCCTGTGGAGG + Intergenic
1031968927 7:128049529-128049551 ATGACAGGTGGTGCTTGGGGAGG - Intronic
1035911020 8:3566468-3566490 ACACCAGGAGGGGCTGGTGGAGG - Intronic
1041193508 8:55377091-55377113 TTTCCAGGTGGTGGTGGTGGCGG - Intronic
1043916994 8:85934310-85934332 ATACCAGGTGGGGATTATTGGGG + Intergenic
1044344757 8:91092263-91092285 AGACCAGGTGGAGATGGTGGTGG - Intergenic
1050380195 9:5020417-5020439 TTAGCAGGTGCTGTTTGTGGTGG + Intronic
1052102841 9:24471416-24471438 ATACCTGGTGGTGGTGGTGGTGG - Intergenic
1052980062 9:34441578-34441600 AGACCAGGTGATACCTGTGGGGG + Intronic
1053016609 9:34665620-34665642 ATACGAGGTGGCGCTGGAGGCGG - Exonic
1054823512 9:69547828-69547850 ACCCCAGGTGGTGGTTGTGTTGG - Intronic
1055010891 9:71563818-71563840 AGACTAGGTGGTGGTTGTGATGG + Intergenic
1055774825 9:79755889-79755911 ATCCCAGGTGATGCTTCTGGTGG - Intergenic
1057715486 9:97491881-97491903 GTACCAGGTAGTGCTTCTGGAGG + Intronic
1058437481 9:104976285-104976307 ATACTAGATGTTGCTAGTGGAGG - Intergenic
1060759987 9:126238859-126238881 GGACCAGGTGGTGGTGGTGGAGG + Intergenic
1060965616 9:127710897-127710919 ATCCCAGCTGGTGATTATGGAGG + Intronic
1062452202 9:136620481-136620503 ATAGCAGGCGCTGGTTGTGGGGG - Intergenic
1185536349 X:864464-864486 ATACCATGCGGTGCTTTTGCAGG + Intergenic
1185540838 X:902138-902160 AGACCTGGTGGAGCTTCTGGTGG + Intergenic
1186300867 X:8198372-8198394 AAACCAGGTGTTGCTTGAGGTGG - Intergenic
1186438163 X:9561157-9561179 TTAAAAGGTGGTGGTTGTGGGGG - Intronic
1192482439 X:71497358-71497380 ATACCAGGTGCTACTTCTTGAGG - Intronic
1193883766 X:86960164-86960186 GTACATGGTTGTGCTTGTGGTGG + Intergenic
1197361147 X:125504932-125504954 ATACCAGGTAATACTTGTTGTGG - Intergenic
1200152204 X:153956748-153956770 GTTCCAGGTGGTGCTTAAGGGGG - Exonic
1200342453 X:155411784-155411806 TTACCAGGTGGTGGGTGTGGTGG + Intergenic