ID: 1092674070

View in Genome Browser
Species Human (GRCh38)
Location 12:10897005-10897027
Sequence CATTGTGACCTCAGAGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092674070_1092674076 16 Left 1092674070 12:10897005-10897027 CCAACTACTCTGAGGTCACAATG 0: 1
1: 0
2: 3
3: 22
4: 158
Right 1092674076 12:10897044-10897066 GAGGCCATGTGCAGGCCCTCTGG 0: 1
1: 0
2: 7
3: 41
4: 321
1092674070_1092674075 8 Left 1092674070 12:10897005-10897027 CCAACTACTCTGAGGTCACAATG 0: 1
1: 0
2: 3
3: 22
4: 158
Right 1092674075 12:10897036-10897058 CACATGCAGAGGCCATGTGCAGG 0: 1
1: 2
2: 12
3: 87
4: 385
1092674070_1092674071 -3 Left 1092674070 12:10897005-10897027 CCAACTACTCTGAGGTCACAATG 0: 1
1: 0
2: 3
3: 22
4: 158
Right 1092674071 12:10897025-10897047 ATGTCCAAACCCACATGCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092674070 Original CRISPR CATTGTGACCTCAGAGTAGT TGG (reversed) Intronic
903270027 1:22182322-22182344 GATTGTGAGCTCAGAGGAGGCGG - Intergenic
904287156 1:29460196-29460218 CCTTGGGACCTGGGAGTAGTTGG - Intergenic
905485626 1:38293753-38293775 CATGGTGGCCTCAGGGTAGCTGG + Intergenic
906148198 1:43572403-43572425 AGTTGTGACCTCAGGGTCGTGGG + Intronic
907267483 1:53271706-53271728 CCTCGTGACCTCAGAGTTGAAGG + Intronic
908845966 1:68324497-68324519 CATAGTGGCCTCGGGGTAGTTGG + Intergenic
908938464 1:69403806-69403828 CATGGTGCTCTCAGAGTAATTGG - Intergenic
909093007 1:71250905-71250927 GATTGTGACATAAAAGTAGTAGG + Intergenic
909210977 1:72822952-72822974 CACAGTGAACTCAGAATAGTGGG + Intergenic
910361979 1:86422130-86422152 CACTGTGTCTTCAGAGTAGAAGG - Intergenic
910924525 1:92384694-92384716 TATAGTGTCCTCAGAGTAGCAGG - Intronic
912456060 1:109798170-109798192 CATGGTGGCCTCAAAGGAGTTGG + Intergenic
917659170 1:177161253-177161275 CCTTGTGACATGACAGTAGTGGG - Intronic
918897155 1:190362675-190362697 CATAGTGTTCTCACAGTAGTGGG + Intronic
919011928 1:191975811-191975833 CCTAGTGACCTGAGAGTAGTTGG + Intergenic
919231250 1:194777690-194777712 CACTGATAGCTCAGAGTAGTAGG - Intergenic
1063347443 10:5325153-5325175 CATTGTGACAGCAGAGAAGGTGG + Intergenic
1064650322 10:17502563-17502585 CCTGGTGGCCTCAGAGTAATTGG - Intergenic
1074558618 10:114515189-114515211 AATTGTGAGCTCAGGGTAGCTGG - Intronic
1074960694 10:118442677-118442699 AATGGTGACCTCAAAGTAGAGGG + Intergenic
1075273342 10:121072115-121072137 CATTGTGACCTAGGGGTAGCAGG - Intergenic
1076395450 10:130135281-130135303 CATTGTAACCTCAGAACAGAAGG - Intergenic
1078284746 11:9940730-9940752 CATTGTGAACTCAGAAAATTTGG + Intronic
1079476900 11:20840602-20840624 CAAGGTGGCCTCAGGGTAGTTGG + Intronic
1080158685 11:29144708-29144730 GATTTTGACCTCAGAAGAGTTGG + Intergenic
1081563905 11:44244352-44244374 CACTCTGATGTCAGAGTAGTAGG + Exonic
1082896833 11:58200770-58200792 CATGGTGACTTTAGGGTAGTGGG + Intergenic
1083978189 11:66141674-66141696 CATTGTAACCTCAGACTTCTGGG + Intronic
1085198922 11:74689698-74689720 CATGGTGGCCTCATAGTGGTTGG + Intergenic
1086960937 11:92979760-92979782 TATTTTGACCTCAGAGGAATGGG - Intronic
1088118595 11:106340883-106340905 CATAGTAACCTCAAAGTTGTTGG + Intergenic
1088596660 11:111446080-111446102 CCTTAAGACCTCAGAGCAGTAGG + Intronic
1090208320 11:124897836-124897858 CACTGTGAGCTCAGAGCAGCAGG - Exonic
1090269821 11:125378311-125378333 CCTTGTGTCCTCTGAGCAGTGGG + Intronic
1092674070 12:10897005-10897027 CATTGTGACCTCAGAGTAGTTGG - Intronic
1092854696 12:12662128-12662150 CATGGAGACCACAAAGTAGTTGG + Exonic
1093056801 12:14564128-14564150 CATTGCAGCCTCAGAGTAGATGG - Intronic
1093532629 12:20185703-20185725 CTTTGTAAACTCAGTGTAGTTGG + Intergenic
1097484661 12:60180592-60180614 TATAGTGACCTCAGGGTAGTTGG + Intergenic
1098266800 12:68730035-68730057 CATTGTAACCTCAGACTCCTGGG + Intronic
1101180927 12:102217458-102217480 CATGGTGACCTCCCAGGAGTGGG - Intergenic
1105707429 13:22976972-22976994 CATTCTGACCCCACAGCAGTGGG + Intergenic
1108045328 13:46378573-46378595 CATTGTGACATCAGAGTCAGTGG + Intronic
1110122575 13:71901782-71901804 CATTGTGTAGTCAGAGTATTTGG + Intergenic
1111923574 13:94438967-94438989 CAAAGAGACCTCAGAGTAATGGG + Intronic
1112405701 13:99118353-99118375 CAGGGTGATCTCAGGGTAGTTGG + Intergenic
1114839981 14:26252076-26252098 CATTTTTACCTTAGAGTAGCTGG - Intergenic
1116858755 14:49977089-49977111 CATGGTGATCTCAGGGTAGTTGG + Intergenic
1117716180 14:58583876-58583898 CATGGTGATCTAAGAGTACTTGG - Intergenic
1119477297 14:74938389-74938411 CATGGTGACCTCAGGGTAGTTGG + Intergenic
1121169390 14:91840833-91840855 CATTGTTACCTTAGTTTAGTGGG - Intronic
1121422777 14:93827122-93827144 CATTGTGTCCTCAGAGTGACTGG - Intergenic
1121469333 14:94139721-94139743 CAATGGGACCTCAGAATAATAGG - Intergenic
1124424640 15:29553706-29553728 CACTGTGGTCTCAGGGTAGTTGG - Intronic
1126343250 15:47666898-47666920 CATGGTGGCCTCAGGGTAGTTGG - Intronic
1127742119 15:61920207-61920229 AATTGTAATCTCAGAGTAATGGG - Exonic
1127880399 15:63152201-63152223 CATTGTGACCTCAAACTCCTGGG - Exonic
1129929316 15:79396524-79396546 CATGGTAATCTCAGGGTAGTTGG + Intronic
1130327498 15:82892721-82892743 CCTTGTGACATCATAGAAGTAGG + Exonic
1132624180 16:882419-882441 CTTGGTGGCCTCAGAGTAGAGGG - Intronic
1138845412 16:60559102-60559124 CTTTCTGACCTCAGAGTTGTTGG + Intergenic
1139879958 16:70174439-70174461 CATTATGAGCTCTGAGGAGTGGG + Intronic
1140372556 16:74421088-74421110 CATTATGAGCTCTGAGGAGTGGG - Intronic
1140901389 16:79371208-79371230 CATAGTGGTCTCAGGGTAGTTGG + Intergenic
1146731100 17:35194370-35194392 CATTGTGACCTCATTGGAGTGGG + Exonic
1147800697 17:43084629-43084651 AATTGTGAACTCAGTGTAGCAGG - Intronic
1148287057 17:46403441-46403463 CATTCTCAGCTCAGAGTAGCTGG - Intergenic
1148309226 17:46621031-46621053 CATTCTCAGCTCAGAGTAGCTGG - Intronic
1149943891 17:60900022-60900044 TATGGTGACCTCATAGGAGTAGG + Intronic
1152128303 17:78460633-78460655 CATTCTGACCTGAGCGTTGTGGG - Intronic
1154115402 18:11609511-11609533 CACTGTGACCTCATTGGAGTTGG - Intergenic
1154472067 18:14713394-14713416 CATGATGAAGTCAGAGTAGTTGG + Intergenic
1156189034 18:34697326-34697348 CACAGTGACCTCACAGGAGTTGG - Intronic
1157367567 18:47079744-47079766 CATTGTGTCCTCATGGTAGTAGG + Intronic
1157888744 18:51394320-51394342 CATGGTGTCCTCAGGGTGGTAGG + Intergenic
1158223856 18:55180250-55180272 CATGGTGGCCTCTGAGCAGTTGG - Intergenic
1160383902 18:78482424-78482446 CATAGTGTCCCCAGAGAAGTGGG + Intergenic
1162826698 19:13256844-13256866 CATTCTGACATCAGTGGAGTGGG - Intronic
926998250 2:18763017-18763039 CACTGTGACCAAAGATTAGTTGG - Intergenic
927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG + Intergenic
927611586 2:24546856-24546878 CATTGTGGTGTCAGAGTAGTTGG + Intronic
930740325 2:54825823-54825845 CATGGTCCTCTCAGAGTAGTTGG - Intronic
935315563 2:101830281-101830303 CATTGTGACTTCATTGTAGTAGG + Intronic
935339111 2:102044038-102044060 CATGGGAGCCTCAGAGTAGTTGG - Intergenic
936404927 2:112194447-112194469 CCAGGTGGCCTCAGAGTAGTTGG + Intergenic
939264806 2:139857512-139857534 CATTGTAACCTCAAATTACTGGG - Intergenic
940334003 2:152505651-152505673 CATTGTGACTTCAGAGTCACAGG + Intronic
942611757 2:177749285-177749307 CATTGTAACCTCAGACTGTTGGG + Intronic
944752956 2:202730266-202730288 CATTGTAACCTCAGAGTCTGAGG + Intronic
944829801 2:203522211-203522233 CATTGTCACATCAGAGTAGATGG + Intronic
945081707 2:206092424-206092446 CATTGAGACCTCTGAATAATAGG + Intergenic
945311788 2:208322295-208322317 CACTGTGACCTCAAAGTCCTGGG - Intronic
946434740 2:219644058-219644080 CCTTGAGGCCTCAGAGCAGTAGG + Intergenic
947908417 2:233784508-233784530 AAATGTGACCTCAGAGTTGGAGG + Intronic
947990380 2:234482991-234483013 CAGTGTAACCTCAGAGCAGGTGG - Intergenic
948517873 2:238516744-238516766 AATTGTGGCCTCAAGGTAGTTGG - Intergenic
948608973 2:239155018-239155040 AGCTGTGACCTCAGAGGAGTGGG - Intronic
948678678 2:239615388-239615410 CATGGTGGCCTCACAGTAGTCGG - Intergenic
1169080480 20:2795367-2795389 CACAGTGACCTCAAAGCAGTTGG + Exonic
1169744153 20:8926732-8926754 CATAGTGGCCTCAGGGTAGTTGG - Intronic
1173471690 20:43328461-43328483 GATTGTTACCTCTGGGTAGTGGG + Intergenic
1173689086 20:44945528-44945550 CGTGGTGGCCTCAGAGTAGTTGG - Intronic
1175533713 20:59692468-59692490 CTCTGTGACCTCAGAGGAGGAGG + Intronic
1177252491 21:18612485-18612507 CACTGTGACCTCCGACTACTGGG - Intergenic
1178678142 21:34648208-34648230 CATTACGCCCTCAGAGAAGTGGG + Intergenic
1181010263 22:20036218-20036240 AATTGTGACCCCACAGTACTCGG + Intronic
1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG + Intronic
1182948306 22:34346156-34346178 TATTGTGACCACAGACTTGTAGG - Intergenic
1183113022 22:35666662-35666684 GATTGTGACATCAGAATAGAGGG + Exonic
1184606614 22:45578064-45578086 CATTGTGAACTGGGAGGAGTGGG + Intronic
949342435 3:3044527-3044549 TATGGTGACCTCAGAGTAGTCGG + Intronic
951578807 3:24140530-24140552 CCTGGTGGTCTCAGAGTAGTTGG + Intronic
955000126 3:54919936-54919958 CGTTGTGAGGTCAGAGGAGTGGG + Intronic
956182045 3:66526658-66526680 CATGGTATCCTCAGGGTAGTGGG - Intergenic
956221187 3:66905177-66905199 AATTGTTTCCCCAGAGTAGTGGG - Intergenic
956711593 3:72042856-72042878 TACTGTGACTTCAGGGTAGTGGG - Intergenic
956711863 3:72046069-72046091 TACTGTGACTTCAGGGTAGTGGG - Intergenic
957405165 3:79766668-79766690 CATTGTGTTCTCAGAGCTGTGGG + Intronic
961318216 3:126055029-126055051 CATCGTGAGCTCAGATTAGGAGG + Intronic
961667924 3:128505148-128505170 CATGGTGGCCTCAGGGCAGTTGG - Intergenic
961756322 3:129129132-129129154 CACTGTCACCTCAGAGCCGTTGG + Intronic
964034244 3:152176866-152176888 CATTAATACCTGAGAGTAGTTGG - Intergenic
964374695 3:156037732-156037754 CAATGTTACCTGAGAGTATTAGG - Intronic
964556544 3:157945787-157945809 CATTGTGGCTTCAGAGGAGCAGG + Intergenic
965163108 3:165160582-165160604 CATTGTGATTTTAGAGAAGTAGG + Intergenic
969346222 4:6571820-6571842 CATGGTGGCCTCAGGGTAGTTGG + Intergenic
980498675 4:133619188-133619210 CTTGGTGACCTCAGAAGAGTTGG - Intergenic
982295229 4:153821450-153821472 CATATTGACCTCAGAGTGGAAGG + Intergenic
982543148 4:156700467-156700489 GTTTGTGGCCTCAGAGTAGTAGG - Intergenic
984704189 4:182835680-182835702 CCTAGTGACCTAAGAGTGGTGGG + Intergenic
985971981 5:3385419-3385441 CTTTGTGACCCCAGAGAAGAGGG - Intergenic
990815852 5:59784085-59784107 CTTTGTGAGCTCAGACAAGTTGG - Intronic
992780521 5:80123169-80123191 CATTGTAACCTCAAAATCGTGGG + Intronic
994081499 5:95712499-95712521 CATAGAGGCCTCAGGGTAGTTGG - Intergenic
994178876 5:96742202-96742224 CATTGTGCCTTCAGAGAAGAAGG + Intronic
995378381 5:111503698-111503720 TTTTGTGACCTCAGAGTACAGGG + Intronic
995447269 5:112259236-112259258 CAATTTGAACTCAGAGTACTGGG - Exonic
999981938 5:156966239-156966261 TATGGTGGTCTCAGAGTAGTTGG + Intergenic
1002589545 5:180280143-180280165 CATTATGATATCAGAGTAGTAGG - Intronic
1004286225 6:14323079-14323101 CAATGTGAACACAGAGCAGTGGG + Intergenic
1006697860 6:35946761-35946783 CACTGTGACCTCAAACTACTGGG + Intronic
1011293682 6:85804940-85804962 CACTGTGAACTGAGAGAAGTAGG - Intergenic
1013978871 6:116106306-116106328 CAATGTGACCCCAGAGGATTGGG + Exonic
1015111163 6:129593383-129593405 CATTGTAACCTCAAAGTTGCAGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017386194 6:153886761-153886783 AATTGTGACATCAGAATAGAAGG - Intergenic
1021806854 7:24366098-24366120 CAGGGTGAACTCAGAGAAGTAGG - Intergenic
1021905577 7:25329925-25329947 CATGGTGACCTCAGAGAAGGTGG + Intergenic
1026041291 7:66870369-66870391 CATTGTAACCTCAGACTCCTGGG + Intergenic
1028134653 7:87212702-87212724 CATTCTGAGCTCACAGTAGAAGG - Intronic
1029261786 7:99307646-99307668 CATTGTAACCTCAGACTCCTGGG - Intergenic
1030954274 7:115831825-115831847 CATTGTGACCTCAAACTCCTGGG + Intergenic
1032136733 7:129286086-129286108 CACTGTGACCTAAAACTAGTTGG - Intronic
1032954619 7:136956430-136956452 CACTCTGACCTAAGATTAGTGGG + Intronic
1033822169 7:145147924-145147946 CATTGTGATGTCAGAGTAAATGG + Intergenic
1035309868 7:157960101-157960123 CCTAGGGACCTCAGAGAAGTGGG - Intronic
1036384051 8:8262447-8262469 CATATTGACCTCAGAGTAGTTGG + Intergenic
1040360503 8:46659753-46659775 CATTGTTACCACAGCATAGTTGG - Intergenic
1042363726 8:67912083-67912105 CAGTGTGAACCCAGAGGAGTGGG - Intergenic
1042718872 8:71805469-71805491 AATAGTGACTTCTGAGTAGTGGG + Intergenic
1046288409 8:112126209-112126231 TCTGGTGGCCTCAGAGTAGTTGG + Intergenic
1046504583 8:115120872-115120894 CATGGTGGCTTCGGAGTAGTTGG + Intergenic
1046838174 8:118826143-118826165 TATGGTGATATCAGAGTAGTTGG + Intergenic
1047404863 8:124577028-124577050 CATTCTGAGACCAGAGTAGTGGG + Intronic
1052773257 9:32708583-32708605 CATTGTAACCTCAAACTACTGGG - Intergenic
1052891720 9:33706878-33706900 CATTGTGACATCAGAACAGAGGG + Intergenic
1055088683 9:72340250-72340272 TATTGTGTCCTCAATGTAGTTGG + Intergenic
1056043465 9:82691709-82691731 CACTGTGACCTCAGACTCCTAGG + Intergenic
1058620503 9:106878077-106878099 ATTTGTGACTACAGAGTAGTGGG + Intronic
1059285708 9:113169747-113169769 CATGGTGCCCTCAGAGCAGGTGG - Exonic
1187837464 X:23448386-23448408 CATGGTGGTCTCAGGGTAGTTGG + Intergenic
1189283422 X:39835195-39835217 CATAGTAACCTCAGGGTAGTTGG - Intergenic
1189600805 X:42623099-42623121 TATGGTAACCTCAGAGTAGTTGG - Intergenic
1193398801 X:81017892-81017914 CACTGTGCCCTGAGAGTGGTTGG + Intergenic
1193531910 X:82664976-82664998 GATTGTGACCTCAGAATAGAGGG - Intergenic
1193924643 X:87468589-87468611 CTTTGGGACCTCAGAGTGTTAGG - Intergenic
1194424830 X:93723273-93723295 CATGGTGACCTCAAACTAGAAGG - Intergenic
1194647351 X:96473609-96473631 CATTCTGACCCCAGAGTTGGGGG + Intergenic
1197896378 X:131319862-131319884 CATGGTGACTTCAGGGTAATTGG + Intronic
1199443397 X:147894794-147894816 CATTGTGACCTGACAGTGATAGG + Intergenic
1199655793 X:149994235-149994257 CATGGTGACCTCAGGGTGGTTGG + Intergenic
1199872471 X:151912240-151912262 CACTGTGACCTCAGGGGACTAGG + Intergenic
1199885944 X:152022121-152022143 CATGGTGATCTCAGGGTGGTTGG - Intergenic
1201744886 Y:17361095-17361117 CATTGTGACCTCAAATTCCTGGG + Intergenic