ID: 1092675089

View in Genome Browser
Species Human (GRCh38)
Location 12:10907888-10907910
Sequence ATGTGTTGAGAGAATTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 313}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092675089_1092675091 -6 Left 1092675089 12:10907888-10907910 CCCTCTCAATTCTCTCAACACAT 0: 1
1: 0
2: 1
3: 28
4: 313
Right 1092675091 12:10907905-10907927 ACACATCAGTATAGTAATAGTGG 0: 1
1: 0
2: 3
3: 17
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092675089 Original CRISPR ATGTGTTGAGAGAATTGAGA GGG (reversed) Intronic
901898149 1:12332909-12332931 ATGTGTTGAGACACTCAAGATGG - Intronic
904471843 1:30741040-30741062 ATCTGGTGGGAGAGTTGAGATGG - Intronic
906874210 1:49518354-49518376 ATTGGTTGAGTGAATGGAGAAGG - Intronic
906937759 1:50229287-50229309 ATGAGTTGTGGAAATTGAGATGG - Intergenic
907021548 1:51071341-51071363 ATGTGTAGAGGGAATTGGAAAGG - Intergenic
907114086 1:51953333-51953355 ATGTGGGGAGAGAAGTGAGGTGG + Intronic
909390676 1:75117593-75117615 CTGTGTTGAGACACTTAAGAAGG - Intergenic
909480824 1:76127849-76127871 ATGTGATGAGAGCAATGGGAGGG - Intronic
909836189 1:80258571-80258593 ATGAGTGGAGGGGATTGAGAGGG - Intergenic
910246938 1:85149058-85149080 GTGTGGTGAGAGAATGCAGAAGG - Intergenic
912387887 1:109281596-109281618 GTGAGTTGAGAGAGTTGAGTTGG - Intronic
912576928 1:110680618-110680640 AGGTATGGACAGAATTGAGAAGG - Intergenic
912674363 1:111663602-111663624 ATGTGGTGAGACCATTTAGATGG - Intronic
913966912 1:143384028-143384050 ATGTGTAGAGAGAATAGAAAGGG + Intergenic
914061288 1:144209635-144209657 ATGTGTAGAGAGAATAGAAAGGG + Intergenic
914117862 1:144756734-144756756 ATGTGTAGAGAGAATAGAAAGGG - Intergenic
915823088 1:159046699-159046721 ATTTGGGGACAGAATTGAGATGG - Intronic
917365363 1:174225831-174225853 AAGTGGTGAGAGAAAAGAGAGGG + Intronic
918436957 1:184524854-184524876 AAATGATGAGAGAATTGAGCAGG + Intronic
918685635 1:187411275-187411297 CTGTGTGGAGAGAAATAAGAGGG - Intergenic
919001048 1:191831840-191831862 ATGTGTTAAGATATTTAAGAAGG - Intergenic
920485137 1:206362873-206362895 ATGTGTTGAGAATATGAAGATGG + Intronic
921371180 1:214424493-214424515 CTGTGGTGAGACAATTGAGTGGG + Intronic
921601508 1:217111198-217111220 ATGTGTTGGAAGAAGTGATAAGG - Intronic
922000488 1:221472854-221472876 ATGAGTTAAGAGAAATGAGATGG + Intergenic
922143201 1:222910958-222910980 CTGTATTGAGATAAATGAGATGG + Intronic
922204583 1:223435361-223435383 ACGTGATGAGAAAATTGTGAAGG - Intergenic
923789999 1:237103868-237103890 AGGTGTTCAAAGAATTGACAGGG - Intronic
923933021 1:238724103-238724125 ATGTCTTTAGAGAATAGAAAAGG - Intergenic
924096038 1:240551814-240551836 ATGTGTTGAATTAATGGAGAAGG + Intronic
924689049 1:246327023-246327045 ATGTATTGTGTGCATTGAGAAGG - Intronic
1063313924 10:4983612-4983634 ATGGGTGGAGAGAATTAGGATGG - Intronic
1063327863 10:5123080-5123102 ATGGGTGGAGAGAATTAGGATGG - Intronic
1063812575 10:9729491-9729513 ATGTTTTGAGATAATAGAAATGG - Intergenic
1063980987 10:11451706-11451728 AAGTGGTGAGAGAACTCAGAGGG - Intergenic
1064004022 10:11686250-11686272 ATGTGTTTATAGATTTGAGGTGG - Intergenic
1064497580 10:15929651-15929673 ATGTGTTGACAGAATTGGGAAGG - Intergenic
1064766726 10:18682888-18682910 ATGTGTTGACAGAAGCCAGATGG - Intergenic
1066508485 10:36068863-36068885 ATCTTTTGAAAGAATTGAGGAGG - Intergenic
1069589556 10:69633334-69633356 AAGGATTGAGAGAATTGGGAAGG - Exonic
1070330972 10:75416852-75416874 CTGTGTTGAGAGTATAAAGAAGG - Intergenic
1072890975 10:99324424-99324446 ATCTATTGTGAGAATTAAGAGGG + Intergenic
1074047582 10:109852581-109852603 ATCTGTGGAGAGAGTGGAGACGG - Intergenic
1074575276 10:114663083-114663105 ATGTGTTGAGGGCATAGAGAAGG - Intronic
1077276231 11:1710690-1710712 AAGTGTTAAAAGAATTGAGAAGG + Intergenic
1077758168 11:5058904-5058926 ATGTGCTGAGGGACTTGAGTCGG + Exonic
1077959639 11:7061482-7061504 ATTGGTTAAGAGAATTGACATGG - Intronic
1078147333 11:8730721-8730743 ATGTGTGGAGAGAAGCGGGAGGG - Exonic
1078852156 11:15174071-15174093 ATGAGTTGAGAGCAATGAGGTGG - Intronic
1080044201 11:27791212-27791234 ATTTCTGGTGAGAATTGAGAAGG + Intergenic
1080920830 11:36707944-36707966 TTGTGTTAAGTGAATAGAGAAGG + Intergenic
1081380412 11:42407730-42407752 CAGTGGTTAGAGAATTGAGAAGG + Intergenic
1081502118 11:43677155-43677177 ATCTGATAAGAGAATGGAGAAGG + Intronic
1082986910 11:59176951-59176973 AAGTGTTGAGACAATAGACATGG - Intronic
1084711684 11:70847664-70847686 CTGAGTGGAGTGAATTGAGAGGG - Intronic
1085136213 11:74091232-74091254 TTATGTTTATAGAATTGAGATGG + Intronic
1085886366 11:80527030-80527052 ATGTGTTGAGAAAATAAAAATGG + Intergenic
1086069891 11:82788855-82788877 TGGTGGTGAGAGAATTGGGATGG - Intergenic
1086988622 11:93278181-93278203 CTGTTTTGGGATAATTGAGATGG - Intergenic
1089708390 11:120297511-120297533 AGGTGTGGAGACAAATGAGATGG + Intronic
1089780201 11:120868499-120868521 ATGTATTGAGAGAGCAGAGAAGG + Intronic
1091366033 11:135021540-135021562 ATATGTTGAGAGCATTGAAGTGG + Intergenic
1092675089 12:10907888-10907910 ATGTGTTGAGAGAATTGAGAGGG - Intronic
1093553712 12:20446342-20446364 ATGTGTTGAGTGTTTTGAGATGG + Intronic
1094707256 12:32926280-32926302 ATGTGTTGAGATAGATGAGCAGG + Intergenic
1095354085 12:41250722-41250744 ACGTGTTGAGAGGAATGAGCAGG + Intronic
1095445497 12:42278174-42278196 ATTTGTAGATAGAACTGAGAAGG - Intronic
1095566746 12:43633437-43633459 AAGTGTTGAGGGAGTTAAGAAGG - Intergenic
1097348015 12:58516749-58516771 ATATATTGAGAGAAGTAAGAGGG + Intergenic
1097429188 12:59482649-59482671 ATATCTTGAGAGAATGGGGAAGG - Intergenic
1098153645 12:67574325-67574347 ATGACTGCAGAGAATTGAGATGG - Intergenic
1099063134 12:77937752-77937774 AAATGTTAAGAAAATTGAGAAGG - Intronic
1100546054 12:95603560-95603582 GTGTGTTGGGAGAAGTGAAAAGG + Intergenic
1100862981 12:98826853-98826875 ATGTGTTTAGACAATCGAGTTGG - Intronic
1101553190 12:105782470-105782492 ATGTGTAGAGAAAAGAGAGATGG + Intergenic
1101699737 12:107161215-107161237 GAGAGTTGAGAGAATAGAGAAGG - Intergenic
1102645050 12:114398356-114398378 AAGGAATGAGAGAATTGAGACGG + Intronic
1103653246 12:122450018-122450040 AAGATTTGAAAGAATTGAGATGG + Intergenic
1103835750 12:123819467-123819489 AGGTGTTGAGAGAAGTGCCAAGG + Intronic
1103887972 12:124217049-124217071 ATGTATTGAGAGGACAGAGAGGG - Intronic
1104130511 12:125889126-125889148 ATGGCTTGAGAAAATTGAGATGG + Intergenic
1105029422 12:132872549-132872571 ATTTCTTGAGAGAATGGTGAGGG - Intronic
1105901824 13:24762011-24762033 AAGTGTGGAGAGAAATGTGAAGG + Intergenic
1106429249 13:29664236-29664258 ATGTGTTGTAAGATTTGAGATGG - Intergenic
1107221233 13:37983198-37983220 ATATTTTGAGAGAAAAGAGAGGG + Intergenic
1107355311 13:39559956-39559978 ATGCTGTGAGAGAATTGAGAGGG - Intronic
1107564803 13:41590945-41590967 ATATGTTGAAAGAATTAAAACGG - Intronic
1109243385 13:59921031-59921053 ATGTATTTAGAAAATTGAAAAGG + Intronic
1110474456 13:75897612-75897634 TTTTGTTCTGAGAATTGAGAAGG + Intergenic
1110688851 13:78407477-78407499 GTGTGTTGGGGGAATTGATAGGG - Intergenic
1110907460 13:80910336-80910358 ATATGTGCAGAGAATTGACACGG + Intergenic
1112125520 13:96462717-96462739 ATATATTGCTAGAATTGAGAAGG + Intronic
1112597793 13:100824723-100824745 GTGTGTTAAGAGACTTGAAAGGG + Intergenic
1113157462 13:107339955-107339977 ATATAATGAGAGAATTGAAAAGG - Intronic
1114067617 14:19077663-19077685 AAGTGCTGAAAGAATAGAGATGG - Intergenic
1114094640 14:19322363-19322385 AAGTGCTGAAAGAATAGAGATGG + Intergenic
1114757620 14:25278225-25278247 ATGTTTAGAGAGAAATGTGATGG + Intergenic
1116648140 14:47556313-47556335 ATGTCTGGAGAGAATTGAAGAGG - Intronic
1119052358 14:71382474-71382496 ACTTGTTCAGAGAATTAAGAAGG + Intronic
1119908169 14:78324227-78324249 ATCTGATGAGAGAATGGACATGG + Intronic
1119947802 14:78713304-78713326 ATGTGTGGCTAGAATAGAGAAGG - Intronic
1120379904 14:83763721-83763743 AAGTATTGAGAAAAATGAGAGGG + Intergenic
1120975192 14:90242157-90242179 ATGTTCTGAGGGAATAGAGATGG + Intergenic
1202832556 14_GL000009v2_random:52414-52436 ATGGGTGGGAAGAATTGAGATGG - Intergenic
1123472694 15:20566709-20566731 CTGTAATGAGAGAGTTGAGATGG - Intergenic
1123645312 15:22433644-22433666 CTGTAATGAGAGAGTTGAGATGG + Intergenic
1123666577 15:22613285-22613307 CTGTAATGAGAGAGTTGAGATGG + Intergenic
1123732999 15:23161700-23161722 CTGTAATGAGAGAGTTGAGATGG - Intergenic
1123751128 15:23359077-23359099 CTGTAATGAGAGAGTTGAGATGG - Intronic
1124283503 15:28382995-28383017 CTGTAATGAGAGAGTTGAGATGG - Intronic
1124299195 15:28528618-28528640 CTGTAATGAGAGAGTTGAGATGG + Intronic
1124320420 15:28707858-28707880 CTGTAGTGAGAGAGTTGAGATGG + Intronic
1124482094 15:30087552-30087574 CTGTAATGAGAGAGTTGAGATGG - Intronic
1124488552 15:30139652-30139674 CTGTAATGAGAGAGTTGAGATGG - Intronic
1124521496 15:30409651-30409673 CTGTAATGAGAGAGTTGAGATGG + Intronic
1124537165 15:30556568-30556590 CTGTAATGAGAGAGTTGAGATGG - Intronic
1124754976 15:32398670-32398692 CTGTAATGAGAGAGTTGAGATGG + Intronic
1124761486 15:32451023-32451045 CTGTAATGAGAGAGTTGAGATGG + Intronic
1124777147 15:32598045-32598067 CTGTAATGAGAGAGTTGAGATGG - Intronic
1124782381 15:32648615-32648637 ATGTGTTGATAGCCTTGAGGTGG - Intronic
1126694937 15:51317853-51317875 AAGTGTCAGGAGAATTGAGATGG - Intronic
1127713127 15:61621062-61621084 ATGTGTGGAGTGAATTGAACGGG + Intergenic
1127954491 15:63841248-63841270 CTGTGTTCGGAGAATTGATAAGG + Intergenic
1128506106 15:68273888-68273910 ATGGGTGGGGAGAACTGAGAGGG + Intergenic
1129106764 15:73315018-73315040 TTGTGTTGAAAGAATTGGCAGGG + Intergenic
1129392517 15:75227628-75227650 ATCTGTTGAGAGGGTTGTGAGGG + Intergenic
1129800233 15:78408330-78408352 ATGTGCAGGGAGACTTGAGAAGG - Intergenic
1130696223 15:86134525-86134547 ACTTGTGGAGAAAATTGAGAGGG + Intergenic
1130940275 15:88502341-88502363 AATTGTTGAAAGAATAGAGAGGG - Intergenic
1132433292 15:101777622-101777644 CTGTAATGAGAGATTTGAGATGG + Intergenic
1134204677 16:12227483-12227505 AAATGTTGACAGAATTGAGTTGG - Intronic
1135028962 16:19022192-19022214 ATGTGTGGGGAGAATAGTGAAGG + Intronic
1135919814 16:26639495-26639517 ATGAGTTGAGAGAATATAAATGG + Intergenic
1136508486 16:30721493-30721515 CTGTGGTGAGGGACTTGAGATGG + Intronic
1143148143 17:4789725-4789747 ACGATTTGAGAGAATGGAGATGG - Intronic
1143914216 17:10276872-10276894 ATGTGTTCAGAGAAAGGTGAAGG - Intergenic
1144591292 17:16526117-16526139 ATGTGCTAAGAGAATTAAGCTGG + Intergenic
1144930620 17:18856091-18856113 AAGTGCTGAGAGAAAAGAGAGGG - Intronic
1149179231 17:53914510-53914532 AAGTGTTGAGAGTATTTGGAAGG + Intergenic
1149463912 17:56858827-56858849 AATTGTGGAGAGAATTTAGAGGG - Intronic
1150319080 17:64195464-64195486 ATGTGTTTAGCTAATTAAGAAGG - Intronic
1150358115 17:64505804-64505826 AGCTGTTGAGGGAGTTGAGAGGG - Intronic
1151055155 17:71022319-71022341 ATGTGAAGAGAATATTGAGATGG - Intergenic
1152053049 17:77997512-77997534 ATGTGTTGGGGGCATTGAGGAGG - Intergenic
1153807613 18:8723013-8723035 ATGTGAGGAGAGAACGGAGAGGG + Intronic
1154272665 18:12933333-12933355 ATGTGCTGCTAGAATGGAGAAGG - Intergenic
1155701214 18:28746177-28746199 ATGGTCTGAGAGTATTGAGAGGG + Intergenic
1156691447 18:39711901-39711923 AAGAATAGAGAGAATTGAGATGG - Intergenic
1157313968 18:46573116-46573138 AAGAGTTGAGGGAAATGAGAAGG + Intronic
1161761705 19:6178158-6178180 TTATGTTGAGAGAATGGGGAAGG - Intronic
1164396565 19:27869381-27869403 ATGCTTTGAGAAACTTGAGATGG - Intergenic
1164812856 19:31171785-31171807 ATGTGATGTCAGTATTGAGAAGG + Intergenic
1202640127 1_KI270706v1_random:75319-75341 ATGGGTGGGAAGAATTGAGATGG + Intergenic
1202700696 1_KI270712v1_random:161523-161545 ATGTGTAGAGAGAATAGAAAGGG + Intergenic
926404508 2:12537314-12537336 ATGTTTTGATAGAATTTGGAAGG - Intergenic
927525144 2:23733104-23733126 ATACATTGAGAGAATGGAGATGG - Intergenic
928068215 2:28188210-28188232 ATGTGTAGGTAGAATGGAGAAGG - Intronic
928133443 2:28670179-28670201 AGGGGTTGAGAGAAGAGAGATGG + Intergenic
928327440 2:30330788-30330810 CTGTGTGGGGAGAGTTGAGAAGG + Intergenic
930968538 2:57364300-57364322 ATATGGAGAGAGAATTGGGAGGG - Intergenic
933033387 2:77361194-77361216 ATGTGCTAAGAGAAGTGAGTGGG - Intronic
933846930 2:86334295-86334317 CTGTGTTGTGAGGATAGAGAGGG - Intronic
933973029 2:87485637-87485659 ATGTGTAGAGAGGATTGAAGGGG + Intergenic
934171622 2:89544995-89545017 ATGTGTAGAGAGAATAGAAAGGG + Intergenic
934281932 2:91619313-91619335 ATGTGTAGAGAGAATAGAAAGGG + Intergenic
934688522 2:96339270-96339292 AAGGGTGGAGAGAAATGAGAGGG - Intronic
936859049 2:116994187-116994209 CTATGTTGTGAGAATAGAGAAGG - Intergenic
938485258 2:131700267-131700289 AAGTGCTGAAAGAATAGAGATGG - Intergenic
940108478 2:150124888-150124910 ATGTGTTGAGAAAATTGTATTGG + Intergenic
940500864 2:154492058-154492080 TTATGTTGAGAGAAATAAGACGG - Intergenic
941235472 2:162966747-162966769 CTGTGTTGTGAGAATTTTGACGG + Intergenic
941856038 2:170232002-170232024 AGGAGTGGAGAGAAATGAGACGG - Intronic
943786907 2:191887328-191887350 ATGTGATGAGAGCAATGGGAAGG + Intergenic
944385785 2:199163189-199163211 ATGGATTAAGAGAAATGAGAAGG - Intergenic
946477554 2:220023188-220023210 ATGAATTGTGAGAATTGAAAAGG + Intergenic
946673739 2:222134603-222134625 ATATGTCTAGACAATTGAGATGG + Intergenic
946887969 2:224243537-224243559 ATGTCTAAACAGAATTGAGAAGG - Intergenic
947198059 2:227588554-227588576 ATGTTTTAAGAGGAATGAGAAGG + Intergenic
1168738397 20:165414-165436 ATGGTTTAAGAGAAATGAGAAGG - Intergenic
1169039600 20:2482200-2482222 ATGTGTGGGGAGAATGGACAAGG - Exonic
1169179766 20:3553355-3553377 ATTTGGTGACAGAGTTGAGAGGG - Intronic
1169363657 20:4973211-4973233 TTGTGTTTAGTAAATTGAGAAGG - Intronic
1171468143 20:25347069-25347091 TAGTGTTCAGAGACTTGAGATGG + Intronic
1171769876 20:29314092-29314114 ATGTGTTGGGAGAAGTGTCAAGG + Intergenic
1176648454 21:9372905-9372927 ATGGGTGGGAAGAATTGAGATGG + Intergenic
1177768613 21:25489017-25489039 GTGTGTTGCAAGAATAGAGATGG - Intergenic
1178169137 21:30019135-30019157 ATATGTTGAAACAATTGAAATGG + Intergenic
1178706235 21:34875657-34875679 ATCTGTTAATAGAATAGAGAAGG + Intronic
1179772991 21:43637861-43637883 ATGCGTTTATAAAATTGAGAAGG - Intronic
1179786242 21:43731813-43731835 AGGTATTGAGAAAATAGAGAAGG + Intronic
1180361813 22:11906580-11906602 ATGGGTGGGAAGAATTGAGATGG - Intergenic
1180486092 22:15800233-15800255 AAGTGCTGAAAGAATAGAGATGG - Intergenic
1181293472 22:21816185-21816207 ATCTGTTTTGAGACTTGAGATGG - Intronic
1182565635 22:31196438-31196460 ATGGGTTGAGTGATTTGAGGGGG + Intronic
1182872874 22:33664073-33664095 ACGTGTTGAGACAATGGAGGTGG - Intronic
1183969696 22:41467776-41467798 ATGTGTTGAGGGGCTTGAGATGG - Intronic
1184912374 22:47544825-47544847 AAGGGTTGAGAGAAGGGAGATGG + Intergenic
949322055 3:2822357-2822379 ATGTGTTGATAGAATCAATAGGG - Intronic
950235694 3:11318391-11318413 ATAAGTTCAGAGAATTGATACGG + Intronic
951613313 3:24516632-24516654 ATGTGATGAGACCATTTAGAAGG - Intergenic
951767004 3:26211170-26211192 ATGTATTGAGATAATTGTGGGGG + Intergenic
951896073 3:27610848-27610870 ATGTGTAGACAGAATTGATAGGG - Intergenic
952471833 3:33662558-33662580 ATGTGTTGCGGGAAGTCAGATGG - Intronic
953581734 3:44163318-44163340 ATGTTTTGAAGGAATTGATATGG - Intergenic
954654067 3:52183220-52183242 GTGTGTTGAGAGAACTTAGGGGG - Intergenic
955459394 3:59163947-59163969 ATGTGCTAAGAGAAATCAGAAGG - Intergenic
955702452 3:61695390-61695412 ATGTCTTAAGAGCATTGAAATGG + Intronic
956141161 3:66148281-66148303 ATTTGTGGAGAGAAGTGAGCAGG + Intronic
958980379 3:100712139-100712161 ATCTGTTGAGAGCATGGTGAGGG + Intronic
959497647 3:107070068-107070090 GTGTGTTGATTGCATTGAGAAGG - Intergenic
960258285 3:115534077-115534099 ATGTGTTGAATGAATGAAGAAGG - Intergenic
962033422 3:131625271-131625293 TTGTTTAGAGAGAATGGAGAAGG - Intronic
962174154 3:133135336-133135358 AAGTGTTGAGAGCACAGAGAGGG + Intronic
963007256 3:140737822-140737844 TTGTGTTGAGGGACGTGAGATGG - Intergenic
963275323 3:143324286-143324308 ATGTGCTGTGGGAATGGAGAGGG - Intronic
965012561 3:163113627-163113649 ATTTATTGAAAGAATTGAAAAGG - Intergenic
965379738 3:167973720-167973742 ATGTGTTGCTACAATTCAGAAGG - Intergenic
966210318 3:177446412-177446434 ATGTATTTAGGGAACTGAGAGGG + Intergenic
966341031 3:178924819-178924841 ATGCTTTCAGAGTATTGAGAGGG + Intergenic
967319218 3:188179115-188179137 AGGTTTTGAGAGCATTGATATGG + Intronic
967350658 3:188510822-188510844 ATATGGCGACAGAATTGAGAAGG - Intronic
967414450 3:189200993-189201015 ATGTGATGGGAGAAATGAAAAGG - Intronic
967767137 3:193293388-193293410 ATGTGTTGTGGGAACTCAGAAGG - Intronic
968061450 3:195729203-195729225 ATGTGTGGAGAGAACTGGGTGGG - Intronic
1202738428 3_GL000221v1_random:32079-32101 ATGGGTGGGAAGAATTGAGATGG - Intergenic
969028138 4:4190892-4190914 ATGTGTAGAGAGAATAGAAAGGG - Intronic
970625189 4:17869494-17869516 ATGTGTTGTAAGAAGGGAGAAGG - Intronic
970862862 4:20723487-20723509 ATCTGCTGAGAAAATTGGGATGG + Intronic
971053320 4:22885607-22885629 GTGTGTTGAGAGGAAAGAGAGGG - Intergenic
971218113 4:24680687-24680709 AGGTGTTAAGGGAATGGAGAAGG + Intergenic
972060877 4:34871498-34871520 TTGTTTGGAGAAAATTGAGAAGG - Intergenic
972723701 4:41726992-41727014 ATGGGTTGAGAGAATTCTGATGG - Intergenic
973370367 4:49241675-49241697 ATGGGTGGGAAGAATTGAGATGG + Intergenic
973390661 4:49553746-49553768 ATGGGTGGGAAGAATTGAGATGG - Intergenic
974573802 4:63689804-63689826 ATGTGTTGTGAAATGTGAGAAGG + Intergenic
976121021 4:81781607-81781629 ATGTTTTGAGACAAATCAGAAGG - Intronic
976274609 4:83263470-83263492 CTGTGTTGAGAACATTGTGAAGG + Intronic
977414084 4:96708603-96708625 ATATGTTGATAGAATTGTGATGG + Intergenic
978114218 4:105000399-105000421 ATGTTTTGGGTGAATTGGGAAGG + Intergenic
978267464 4:106843564-106843586 ATGTGTCCATAGAAGTGAGATGG + Intergenic
980953255 4:139402518-139402540 AAGAGTAGAGAAAATTGAGAAGG - Intronic
982168670 4:152639931-152639953 ATGTGAGGAGAGATTTGGGATGG + Intronic
982462105 4:155683590-155683612 ATGTGTTTAGAGATTTGAAAAGG + Intronic
982484521 4:155951613-155951635 ATGGGTTTAGAGAATGGTGAAGG - Intronic
982488313 4:155996590-155996612 ATGTTTTGGGACAATTTAGATGG - Intergenic
983290843 4:165802591-165802613 ATGTGTAGATAAAATTCAGATGG - Intergenic
984536182 4:180978480-180978502 ATGCGGTGAGAGCATAGAGAAGG - Intergenic
1202767490 4_GL000008v2_random:161177-161199 ATGGGTGGGAAGAATTGAGATGG + Intergenic
986487033 5:8248041-8248063 ATATTTTGAGAGAATTGTTATGG - Intergenic
987164617 5:15182753-15182775 ATGTTTTGATAAAACTGAGAGGG - Intergenic
987351315 5:17024698-17024720 ATGTGTGCAGAGAATAAAGAAGG + Intergenic
989039877 5:37216565-37216587 ATGTGTGGAGTGAAGGGAGATGG + Intronic
990058421 5:51615684-51615706 TTGTGGGGAGAGAAGTGAGATGG + Intergenic
991522852 5:67519638-67519660 ACCTGGTGAGAGAATAGAGAAGG + Intergenic
991982839 5:72251257-72251279 CTGTCTTGAGAGGAATGAGAGGG - Intronic
992619060 5:78574491-78574513 ATTTGGTTAGAGAATGGAGATGG - Intronic
992706359 5:79398222-79398244 ATTTTTTGAGAGAACAGAGAGGG + Intronic
993189050 5:84657532-84657554 ATGAGTCCAGAGAATTGAAAAGG + Intergenic
994584397 5:101687147-101687169 ATTTCTAGTGAGAATTGAGATGG - Intergenic
995358713 5:111269238-111269260 CTGATTGGAGAGAATTGAGAAGG + Intronic
995425075 5:112012023-112012045 TTGTGCTAAGGGAATTGAGAGGG + Intergenic
997396594 5:133564893-133564915 ATGTGTGTTGAGAAGTGAGAGGG - Intronic
998494339 5:142574305-142574327 ATGTGGTGAGATAAATGAGCAGG - Intergenic
999279387 5:150354994-150355016 ATGTGGAGAGAGAAGAGAGATGG - Intergenic
1000649254 5:163796014-163796036 ATGTATTGACTGAGTTGAGAGGG - Intergenic
1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG + Intronic
1002355273 5:178623415-178623437 ATCTGTTGATAGAAATGAAAAGG + Exonic
1003911151 6:10744983-10745005 ATGTGGAGTGAGAAATGAGAGGG - Intergenic
1004689867 6:17984003-17984025 ATGTGATGGGAGCATTGAGGAGG - Intronic
1004917498 6:20345640-20345662 ATGTCTTCAAAGAATTGAGAGGG + Intergenic
1006846757 6:37067557-37067579 GTGTGTTGAGAGGAATGAGCAGG - Intergenic
1007077528 6:39077459-39077481 ATGTGCTGAGAGAACTCAGAAGG - Intronic
1008775618 6:55033859-55033881 ATCTGTTGAGAAAAATGAGATGG + Intergenic
1011271975 6:85589050-85589072 ATGTTTTTAGAGAAATGAAACGG - Intronic
1011981596 6:93386117-93386139 ATGTGTTGTGAAATTTGAGAAGG - Intronic
1013180613 6:107714094-107714116 ATGTGGTGAGAGAGATGAGAGGG + Intronic
1015942069 6:138462614-138462636 TTGTGTTTGGAGATTTGAGAAGG + Intronic
1018335053 6:162777915-162777937 ATGTTTTGGGAGAAAGGAGATGG - Intronic
1021925287 7:25528609-25528631 AGGTGTTGAAAGCCTTGAGATGG - Intergenic
1023186936 7:37541908-37541930 AGTTGCTGAGAGAATTGTGAGGG + Intergenic
1023321280 7:39000502-39000524 GTATGTTGAGAAAATGGAGAGGG - Intronic
1023459626 7:40381082-40381104 ATGTGTTGAGAAGAATAAGAGGG + Intronic
1025109575 7:56202804-56202826 ATCTGTGGACAGAATAGAGATGG - Intergenic
1026284890 7:68954619-68954641 ATGTGTGGGAAGAATGGAGAGGG + Intergenic
1027861308 7:83585603-83585625 AATTGTTAAGAGAATTCAGAAGG - Intronic
1028850573 7:95533041-95533063 ATCTGTTAAGTGAAGTGAGAAGG - Intronic
1030937869 7:115608201-115608223 ATTTGGTGTGGGAATTGAGAAGG - Intergenic
1031072988 7:117182991-117183013 ATTTGTGGAGAGAATGGAGTGGG + Intronic
1031237271 7:119192119-119192141 ATGTGAGGACAGAATTCAGAAGG - Intergenic
1031378450 7:121056514-121056536 ATGTGGAGAGAGAATGGAAAAGG - Intronic
1031408164 7:121410294-121410316 ATGTGTTAAGAGAAATGATGAGG - Intergenic
1032297746 7:130657280-130657302 ATGTGTTGAGAAAATGAAGAAGG + Intronic
1032446411 7:131987611-131987633 ATGTGTAGAGAGAAGTGTGCAGG + Intergenic
1032977456 7:137241938-137241960 CTGTGTTGAGAGAGGTGAGGGGG - Intronic
1034030986 7:147763371-147763393 TGGTGTTGGGAGAAATGAGAGGG + Intronic
1034559717 7:151872233-151872255 CTGTGATGAGAGAATGCAGAAGG - Intronic
1037057928 8:14467521-14467543 ATGTGTTGAGGGCTCTGAGATGG + Intronic
1037181528 8:16012704-16012726 ATGTTTTGAGCAAATTGAAACGG + Intergenic
1038682795 8:29685005-29685027 GTGTGTTGAGAGAACAGAGTGGG + Intergenic
1039632649 8:39129717-39129739 ATATTTTGAAAGAATTGTGAAGG + Intronic
1040698182 8:50027833-50027855 ATGAATTGAGAGAGTAGAGAAGG - Intronic
1043809956 8:84727053-84727075 GTGTGTTTAGAGAATGAAGAGGG + Intronic
1046222838 8:111237803-111237825 ATGTGTTAAGAATCTTGAGATGG - Intergenic
1046597640 8:116280156-116280178 ATGTGTTAAGTGAATTTTGAGGG - Intergenic
1046631236 8:116624963-116624985 ATGTGACGAAAGATTTGAGATGG - Intergenic
1046961598 8:120119305-120119327 ATGTGCTGGGAGAACTGATATGG - Intronic
1050093195 9:2036722-2036744 ATTTGATCAGAAAATTGAGAGGG - Intronic
1050570009 9:6928037-6928059 AAGTGGTGAGAAAATAGAGATGG - Intronic
1050570026 9:6928169-6928191 ATGTGTTGCAAGGATGGAGAGGG - Intronic
1051632318 9:19151632-19151654 ATGTGGTGATGGAATTCAGAAGG + Intergenic
1052317026 9:27125844-27125866 ATGTGTTGAGAGAGGTGGGATGG - Intronic
1052545822 9:29877014-29877036 CTGAGATGAGAGAATTGATACGG + Intergenic
1052621109 9:30911350-30911372 AGGTGTTGAGAAAAGGGAGATGG - Intergenic
1053911892 9:42914963-42914985 ATGGGTGGAAAGAGTTGAGATGG - Intergenic
1055196569 9:73601436-73601458 ATGTGTTGATTGAATTAAAAAGG - Intergenic
1055816067 9:80208597-80208619 ATGTGTTGAGAGATAGGAGTGGG + Intergenic
1055881187 9:81005810-81005832 ATGTCTTGAAAGAAGTAAGAAGG + Intergenic
1056519404 9:87386131-87386153 ATGTCTTGTCAGAATTGGGAAGG - Intergenic
1057895794 9:98907746-98907768 ATCTGTAGAGAGGATTGAGCTGG - Intergenic
1058486287 9:105446339-105446361 ATGGATTCAGAGAATTGGGAGGG - Intergenic
1059384698 9:113955066-113955088 AGGTGATGAGTGAATAGAGAAGG - Intronic
1059471755 9:114510228-114510250 ATGTGTTGAGTGATTGCAGAGGG + Intergenic
1059645491 9:116262676-116262698 CTGGGTGGGGAGAATTGAGAGGG + Intronic
1059798178 9:117722531-117722553 ATGTGTAGAGAGGACTCAGAAGG - Intergenic
1060116022 9:120941543-120941565 ATGAGGTCAGAGAAGTGAGAGGG - Intergenic
1061497263 9:130982074-130982096 AGGTGGTGAGATAATTGAGGAGG + Intergenic
1203707159 Un_KI270742v1:62526-62548 ATGGGTGGGAAGAATTGAGATGG - Intergenic
1203548245 Un_KI270743v1:146050-146072 ATGGGTGGGAAGAATTGAGATGG + Intergenic
1187076570 X:15941309-15941331 ATGTTTTGAGAGAATATAGCAGG + Intergenic
1188076846 X:25787572-25787594 ATGTGTTTAGAGAACGGTGAAGG + Intergenic
1188632650 X:32385637-32385659 TTGAGTTGAGCGAAGTGAGATGG + Intronic
1189726742 X:43975095-43975117 ATTTCTTGGGAGAAATGAGAAGG - Intergenic
1191715083 X:64188666-64188688 TTGTGTTGGGAGGCTTGAGAAGG + Exonic
1192301037 X:69903208-69903230 TTTTGTTGAGAGAATTCAAATGG - Intronic
1192560014 X:72121741-72121763 GTGTGTGGAGAGAATTTAGAGGG + Intergenic
1194854616 X:98914359-98914381 ATAAGTTTAGAGCATTGAGAGGG - Intergenic
1195208049 X:102624312-102624334 ATATTTTCAGAGCATTGAGAGGG - Intergenic
1196634079 X:117979535-117979557 ATTTGTTGAGTAAATTGAAAGGG + Intronic
1197267523 X:124391299-124391321 ATGTGTTGAAAGAATAGATTTGG + Intronic
1198564163 X:137886309-137886331 ATGTGTTGAGTTAATTGAAAAGG - Intergenic
1199167887 X:144699149-144699171 ATTTGTTGATAGAGTTGATATGG - Intergenic
1200974042 Y:9188349-9188371 ATGTGGTGGGAGGAATGAGATGG + Intergenic
1202136837 Y:21675277-21675299 ATGTGGTGGGAGGAATGAGATGG - Intergenic