ID: 1092677040

View in Genome Browser
Species Human (GRCh38)
Location 12:10931408-10931430
Sequence GAACACTCCTTGTTCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092677034_1092677040 22 Left 1092677034 12:10931363-10931385 CCTTTCCTCAAACTCAAAGACTC 0: 1
1: 0
2: 1
3: 29
4: 247
Right 1092677040 12:10931408-10931430 GAACACTCCTTGTTCAGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 87
1092677036_1092677040 0 Left 1092677036 12:10931385-10931407 CCCATTTATTTAAAGTTTTACCT 0: 1
1: 0
2: 0
3: 55
4: 647
Right 1092677040 12:10931408-10931430 GAACACTCCTTGTTCAGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 87
1092677035_1092677040 17 Left 1092677035 12:10931368-10931390 CCTCAAACTCAAAGACTCCCATT 0: 1
1: 0
2: 0
3: 27
4: 198
Right 1092677040 12:10931408-10931430 GAACACTCCTTGTTCAGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 87
1092677037_1092677040 -1 Left 1092677037 12:10931386-10931408 CCATTTATTTAAAGTTTTACCTG 0: 1
1: 0
2: 3
3: 40
4: 537
Right 1092677040 12:10931408-10931430 GAACACTCCTTGTTCAGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092677040 Original CRISPR GAACACTCCTTGTTCAGGAC AGG Intronic
909089508 1:71207783-71207805 GAACATTCCTACTTCAAGACTGG + Intergenic
911860216 1:102937653-102937675 GGTCCCTCCTTGTTCAGGCCCGG + Intronic
913373282 1:118124649-118124671 GAACGGTCCTTGTCCAGCACAGG - Intronic
914974514 1:152348896-152348918 CAACATTCTTTGTTCAGGATGGG + Exonic
920296241 1:204958878-204958900 GATCACTTCTCATTCAGGACAGG + Intronic
922590679 1:226773538-226773560 GAACCCTCCATGCTCAGGATGGG + Intergenic
923442455 1:234033977-234033999 GAACACTCCATGTTTATGGCTGG - Intronic
1069850943 10:71404641-71404663 CAACACTCCTTGTGCTGGAGCGG - Intronic
1069940535 10:71952325-71952347 GAACACTCCCAGGGCAGGACTGG - Intergenic
1070268019 10:74923594-74923616 GAACACTCCTTCTCCATGCCTGG - Intronic
1070488409 10:76952793-76952815 GAACAGTCCTTGTTTAGGAAGGG + Intronic
1076031070 10:127159011-127159033 GAACACTCCTTGGTCAAGGTAGG + Intronic
1077510330 11:2956756-2956778 GAACACTCATACTTCTGGACTGG + Intronic
1080674445 11:34411883-34411905 GAACATTCCTAGTTCAGTGCAGG - Intergenic
1082288392 11:50341117-50341139 GAACCCTCCTTATTAAAGACAGG - Intergenic
1084475624 11:69387047-69387069 GAGCTTTCCTTGTTCAGGAGGGG - Intergenic
1086538919 11:87884488-87884510 GAGCATTCTTTCTTCAGGACAGG - Intergenic
1091597139 12:1885719-1885741 GAACCTTCCTTATTCAGGACTGG - Intronic
1091948053 12:4566620-4566642 GAAAACTCCTTATCCAGGAAAGG - Intronic
1092677040 12:10931408-10931430 GAACACTCCTTGTTCAGGACAGG + Intronic
1099639849 12:85273049-85273071 GATCATTACTTGTTGAGGACAGG + Intergenic
1099752106 12:86788492-86788514 AAACAGTCCTTGTATAGGACAGG - Intronic
1103586599 12:121960950-121960972 GAAGCCTCCTCGTTCAGCACAGG - Intronic
1104466871 12:128997457-128997479 GGGCACTCCTGGTTCTGGACAGG - Intergenic
1106393333 13:29356863-29356885 AACCAATCCTGGTTCAGGACTGG - Intronic
1120267228 14:82266294-82266316 CAACAGCCCTTATTCAGGACTGG - Intergenic
1121078675 14:91090177-91090199 GAAAACACCTTGTTCCAGACAGG + Intronic
1121856459 14:97274587-97274609 GGACACTCCTTGTTCATGGAAGG + Intergenic
1125472653 15:40019862-40019884 CAAAACTTCTTGTTCAGGCCAGG + Intronic
1126189183 15:45861960-45861982 TAATACTCCTTGTTCAGAGCTGG + Intergenic
1132259878 15:100414298-100414320 AAACATTCCATGTTCATGACAGG + Intronic
1132411487 15:101581465-101581487 GAACACTCCTAGACCATGACAGG - Intergenic
1136654650 16:31702709-31702731 CAACACTCCCAGCTCAGGACTGG + Intergenic
1137630584 16:49940938-49940960 GAACACTCTTTGTCCTGGAACGG - Intergenic
1137930138 16:52579316-52579338 GCATACTCATTGTTCAGTACAGG + Intergenic
1141147193 16:81539532-81539554 AAACACTCCTTGTTCTGATCAGG + Intronic
1142255780 16:89013226-89013248 GAACATTCCGTGGGCAGGACAGG + Intergenic
1146618619 17:34377804-34377826 GAACAGCTCTTGCTCAGGACAGG + Intergenic
1148053985 17:44782598-44782620 GAACCCTACCTGTTCAGGAATGG - Intergenic
1153575221 18:6513025-6513047 TAACACTCCCTGTTTAGGATTGG - Intronic
1155236512 18:23825184-23825206 GAGAACTCTTTGTTCAGGAAAGG + Intronic
1158671096 18:59474569-59474591 AAACCCTCCTTTTTCAGTACTGG + Intronic
1163430573 19:17264739-17264761 GACCACTGCCTGTTCAGGCCTGG + Exonic
1164478872 19:28596246-28596268 TAACCCTCCTTGGTCAGTACTGG - Intergenic
1168681547 19:58319560-58319582 GCACACACCTTGTACAGCACTGG + Intergenic
935889911 2:107665330-107665352 AAACACACCTTTATCAGGACAGG + Intergenic
937065235 2:119012438-119012460 GAAGACTCCTGGATCAGGGCTGG + Intergenic
942028235 2:171932205-171932227 TAAGACTCTTTGTTCATGACAGG + Intronic
1169205883 20:3740191-3740213 GGACACCCCCAGTTCAGGACTGG + Intronic
1169450957 20:5710545-5710567 GACCCCTCCGTTTTCAGGACAGG - Intergenic
1171234555 20:23513609-23513631 GAACAATTCTTTTACAGGACTGG + Intergenic
1172272125 20:33660564-33660586 GATCCCTCCTTGTCCGGGACTGG + Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173455070 20:43195333-43195355 GAACACGCCTAGTACAGGGCTGG + Intergenic
1173869309 20:46331690-46331712 GGACACTCCTTGGGCTGGACTGG + Intergenic
1174553999 20:51381143-51381165 GAACACTCTGTGATGAGGACAGG + Intergenic
1179250813 21:39669869-39669891 GCACACTCCTTGGGCAGGGCTGG - Exonic
1182325986 22:29513389-29513411 GAACACTCTTTTTTGGGGACAGG - Intronic
954257680 3:49417826-49417848 GTACCCTCCATGTTCAGGATGGG + Exonic
954459803 3:50619860-50619882 GTGCTCTCCTTGTTCTGGACTGG + Intronic
954620411 3:51992242-51992264 GATCACTCCTTTTTCATGGCAGG + Intergenic
964568577 3:158087637-158087659 GAACATTCCTGATTCATGACAGG - Intergenic
968280759 3:197474995-197475017 AAACACTCCTTGGTCTGGAGAGG - Intergenic
968776674 4:2545769-2545791 GAGCACTGCTTGAGCAGGACAGG - Intronic
973941654 4:55917039-55917061 GAACACTCCTCTTGCAGGACTGG + Intergenic
978292561 4:107161244-107161266 GAACACTCTTTTTTCAGTAATGG + Intronic
980134224 4:128844989-128845011 GAACTCTCTTTTCTCAGGACAGG - Intronic
980647129 4:135656411-135656433 CAACACTCCATTTTCAGCACTGG + Intergenic
983134527 4:164064284-164064306 GAACACTCCATGTTCATGGATGG - Intronic
985123769 4:186669934-186669956 GAATAGTCCTTGATCAGGAAAGG + Intronic
985939629 5:3124862-3124884 GAACACTCATTGTTCAGGCAAGG - Intergenic
986595607 5:9418578-9418600 GAACACTCCTATTGCAGGGCAGG - Intronic
986871318 5:12049949-12049971 GAAAAGTGCTTGTTCAGGAAAGG - Intergenic
995321592 5:110840602-110840624 CAGCACTCCTAGTCCAGGACTGG + Intergenic
1012046109 6:94275447-94275469 GAAAACTCTTTGTCCAGAACGGG + Intergenic
1013071484 6:106733158-106733180 CATTCCTCCTTGTTCAGGACTGG + Intergenic
1013130080 6:107224195-107224217 GATCACTCCTTATTGTGGACAGG + Intronic
1018169158 6:161130577-161130599 GAACACACCCGGTTCAGGTCAGG - Exonic
1018381348 6:163260787-163260809 GAACACTGCTTCTTCTGGGCAGG + Intronic
1019303788 7:322754-322776 GACCCCTCCTAGGTCAGGACAGG - Intergenic
1019738407 7:2661421-2661443 GAACTCTCCAGGCTCAGGACAGG - Intronic
1024534476 7:50418641-50418663 TTACACCCCTTGTTCAGGCCTGG - Intergenic
1026592104 7:71705969-71705991 AAAGGCTCCTGGTTCAGGACTGG + Intronic
1029448191 7:100626605-100626627 GAGCACTGCGTGTCCAGGACTGG + Intronic
1035120941 7:156566291-156566313 GAATTCTCCTTATTCAGGTCTGG - Intergenic
1043035608 8:75194267-75194289 GAACTCTCCAACTTCAGGACTGG + Intergenic
1044987899 8:97771145-97771167 GAACTCTCCTTGTCCATTACTGG - Intergenic
1045329683 8:101144362-101144384 GAACACTATTTGTTCAGTAACGG - Intergenic
1187522604 X:20026768-20026790 GAGTGCTGCTTGTTCAGGACAGG + Intronic
1198123614 X:133620541-133620563 GACCACTCCTTGCTCAGCCCAGG + Intronic
1198437799 X:136634365-136634387 AAACACTCCTTGTTTGGGCCAGG + Intergenic
1200408754 Y:2841179-2841201 AATCATTCCTTGTTCAGGATTGG - Intergenic