ID: 1092685125

View in Genome Browser
Species Human (GRCh38)
Location 12:11034625-11034647
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 2, 1: 0, 2: 8, 3: 70, 4: 475}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092685125_1092685129 8 Left 1092685125 12:11034625-11034647 CCTTTATTGGCCAGGCAGGGTAG 0: 2
1: 0
2: 8
3: 70
4: 475
Right 1092685129 12:11034656-11034678 CATAATCCCAACATTTTGTAAGG 0: 3
1: 7
2: 88
3: 1337
4: 14110
1092685125_1092685131 13 Left 1092685125 12:11034625-11034647 CCTTTATTGGCCAGGCAGGGTAG 0: 2
1: 0
2: 8
3: 70
4: 475
Right 1092685131 12:11034661-11034683 TCCCAACATTTTGTAAGGCTGGG 0: 3
1: 1
2: 25
3: 409
4: 2813
1092685125_1092685130 12 Left 1092685125 12:11034625-11034647 CCTTTATTGGCCAGGCAGGGTAG 0: 2
1: 0
2: 8
3: 70
4: 475
Right 1092685130 12:11034660-11034682 ATCCCAACATTTTGTAAGGCTGG 0: 3
1: 2
2: 42
3: 660
4: 4024
1092685125_1092685133 14 Left 1092685125 12:11034625-11034647 CCTTTATTGGCCAGGCAGGGTAG 0: 2
1: 0
2: 8
3: 70
4: 475
Right 1092685133 12:11034662-11034684 CCCAACATTTTGTAAGGCTGGGG 0: 4
1: 46
2: 1360
3: 18658
4: 130003
1092685125_1092685136 28 Left 1092685125 12:11034625-11034647 CCTTTATTGGCCAGGCAGGGTAG 0: 2
1: 0
2: 8
3: 70
4: 475
Right 1092685136 12:11034676-11034698 AGGCTGGGGCAGGAGCACCCAGG 0: 3
1: 1
2: 105
3: 291
4: 1028
1092685125_1092685135 18 Left 1092685125 12:11034625-11034647 CCTTTATTGGCCAGGCAGGGTAG 0: 2
1: 0
2: 8
3: 70
4: 475
Right 1092685135 12:11034666-11034688 ACATTTTGTAAGGCTGGGGCAGG 0: 3
1: 0
2: 42
3: 1151
4: 15388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092685125 Original CRISPR CTACCCTGCCTGGCCAATAA AGG (reversed) Intronic
900807897 1:4779855-4779877 CCACCGTGCCTGGCCTAAAACGG - Intronic
900961664 1:5925900-5925922 CCACCGTGCCTGGCCAGGAATGG + Intronic
901219675 1:7576295-7576317 CCACCGTGCCAGGCCAATTAAGG + Intronic
901346703 1:8550833-8550855 CCACCGTGCCCGGCCACTAAAGG + Intronic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902360237 1:15938401-15938423 CCACTGTGCCTGGCCAGTAACGG + Intronic
902548601 1:17206041-17206063 TTTCCCTACCTGGCCACTAAGGG + Intronic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
903307725 1:22425060-22425082 CCACCATGCCTGGCCCATGAGGG - Intergenic
904112249 1:28135255-28135277 CCACCGTGCCTGGCCAGAAAAGG - Intergenic
904564396 1:31419538-31419560 CCACCATGCCTGGCCATTAGGGG - Intronic
905130338 1:35750678-35750700 CCACCCTGCCCGGCCCAAAAAGG + Intronic
905230577 1:36512666-36512688 CCACCCTGCCTGGCTAATTTGGG - Intergenic
906302556 1:44693741-44693763 CTACCATGTCTGGCCCATCATGG + Intronic
907142331 1:52199348-52199370 CCACCGTACCTGGCCAATCACGG + Intronic
907174535 1:52506103-52506125 CTACTGCGCCTGGCCAATGAGGG + Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907799147 1:57747520-57747542 CCACCGTGCCTGGCCTACAATGG - Intronic
907845147 1:58198657-58198679 TGACCCAGCCTGGCCAATTAGGG + Intronic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908441106 1:64155661-64155683 CTCACCTGCCTGGCAAACAAAGG - Intronic
908754354 1:67454465-67454487 CCACCACGCCTGGCCAAGAAGGG + Intergenic
909053893 1:70800148-70800170 CCACCGTGCCTGGCCAACATTGG + Intergenic
909146216 1:71936084-71936106 CCACCATGCCCGGCCTATAAGGG + Intronic
910983168 1:92978507-92978529 CCACCGTGCCCGGCCAATAAGGG + Intergenic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
911004987 1:93210987-93211009 CCACCATGCCCGGCCAATTAAGG - Intronic
912619052 1:111136964-111136986 CCACCGTGCCCGGCCAATCATGG - Intronic
913423650 1:118702096-118702118 CCACCATGCCTGGCCTATCAGGG + Intergenic
913664364 1:121033956-121033978 CCACCATGCCCGGCCCATAATGG - Intergenic
914015755 1:143817235-143817257 CCACCATGCCCGGCCCATAATGG - Intergenic
914162028 1:145143773-145143795 CCACCATGCCCGGCCCATAATGG + Intergenic
914400056 1:147310663-147310685 CCACTGTGCCTGGCCAACAATGG - Intergenic
914421311 1:147530890-147530912 CCACCACGCCTGGCCAATATGGG - Intergenic
915192916 1:154166968-154166990 CTACCACGCCCGGCCTATAATGG + Intronic
915717844 1:157961379-157961401 CCACCGTGCCTGGCCAATTTTGG - Intergenic
917742188 1:177971365-177971387 CCACCATGCCTAGCCACTAATGG + Intronic
917931934 1:179828621-179828643 CAGCCCTGCCTGGCCACTCAGGG - Intergenic
918124893 1:181574737-181574759 CCACCATACCTGGCCAACAATGG - Intronic
918644739 1:186890566-186890588 CCACCATGCCCGGCCAGTAACGG - Intronic
919070622 1:192751091-192751113 CCACCGCGCTTGGCCAATAAAGG + Intergenic
919648995 1:200126802-200126824 CCACTCTGCCTGGCCTATGAAGG + Intronic
919694322 1:200558240-200558262 CTACCATCCCTGGCCAAGGATGG + Intronic
919824468 1:201493709-201493731 CAACCAGGCCTGGCCAATGAGGG + Intronic
919959729 1:202454644-202454666 CTACCATACCTGGCCAAGAAGGG - Intronic
921055190 1:211537893-211537915 GAAACCAGCCTGGCCAATAATGG + Intergenic
921235005 1:213117733-213117755 CCACCATGCCTGGCCAAGTAAGG - Intronic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922295027 1:224242618-224242640 CCACCATGCCTGGCCAATTTTGG + Intronic
922641193 1:227233644-227233666 CCACCGTGCCTGGCCCAAAATGG - Intronic
922773606 1:228204504-228204526 CTACTGTGCCTGGCCAGAAATGG - Intronic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG + Intronic
924653748 1:245953704-245953726 CCACCGTGCCTGGCCAAGTAGGG + Intronic
924756385 1:246945035-246945057 CAACCCAGCCTGGGCAATATAGG - Intergenic
924758077 1:246959711-246959733 CCACCGTGCCTGGCCCAAAATGG + Intronic
1063356730 10:5407537-5407559 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1063680010 10:8177997-8178019 CCACTGTGCCTGGCTAATAAAGG + Intergenic
1064050131 10:12052784-12052806 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1064212331 10:13370514-13370536 CTACTGTGCCTGGCCTAAAATGG + Intergenic
1064260798 10:13784699-13784721 CCACCGCGCCTGGCCAATTATGG - Intronic
1064525053 10:16246432-16246454 CAACCGTGCCTGGCCAAAATAGG + Intergenic
1064585257 10:16833560-16833582 CTGCCCAGCCTGGCCAGGAAGGG - Intronic
1064608825 10:17075369-17075391 CCACCGTGCCTAGCCAGTAAAGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1065977306 10:30853707-30853729 CCACCATGCCTGGCCATAAATGG - Intronic
1066045435 10:31590871-31590893 CTACCATGCCCGGCCTAAAAGGG - Intergenic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1066403090 10:35093624-35093646 GCACCCAGCCTGGGCAATAAAGG + Intergenic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1068448926 10:57162034-57162056 CCACTGTGCCTGGCCAATGAGGG - Intergenic
1069235389 10:66065131-66065153 TTACCCTGGGTGGCCAAAAAAGG + Intronic
1070304073 10:75227857-75227879 CCACCCAGCCCGGCCAATAATGG + Intronic
1070759086 10:79012231-79012253 CGTGCCTGCCTGGCCAAGAATGG - Intergenic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1071129242 10:82372156-82372178 CTACTCTTGCTGGCCAACAAAGG + Intronic
1072049493 10:91689305-91689327 CCACCGTGCCTGGCCTACAAAGG - Intergenic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072213191 10:93265484-93265506 CCACCGTGCCTGGCCTATAACGG + Intergenic
1072470673 10:95710115-95710137 CCACCGTGCCTGGCCTATCATGG - Intergenic
1074472040 10:113735998-113736020 CAAACCTGCCTGGCCAACAAGGG - Intergenic
1074625383 10:115178195-115178217 CCACCGTGCCTGGCCAAGGACGG + Intronic
1075598654 10:123750821-123750843 GTGCCCTGCCAGGCCAATGAGGG - Intronic
1076098212 10:127750911-127750933 ATTCCCTGCTTGGCCAACAAAGG - Intergenic
1078109373 11:8380270-8380292 CCACTGTGCCTGGCCAATAATGG - Intergenic
1079072339 11:17357988-17358010 CTACCATGCCTGGCCAACAGTGG + Intronic
1079606460 11:22375083-22375105 CCACCGTGCCTGGCCACAAATGG - Intronic
1079635542 11:22735248-22735270 ATACCAAGCCTGGCCACTAATGG - Intronic
1080518442 11:33045065-33045087 CCACCATGCCTGGCCAATCCTGG - Intronic
1080799056 11:35592620-35592642 CCACCGTGCCTGGCCAGCAATGG - Intergenic
1081054462 11:38391119-38391141 CCACCGTGCCTGGCCTATCAAGG + Intergenic
1081790755 11:45782208-45782230 CCACCATGCCTGGCCATAAATGG + Intergenic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082935352 11:58650969-58650991 CCACCATGCCTGGCCAGCAATGG + Intronic
1083275188 11:61593026-61593048 CCACCGTGCCTGGCCCACAATGG + Intergenic
1083641142 11:64146055-64146077 CCACCGTGCCTGGCCAAGAATGG + Intronic
1084073800 11:66756483-66756505 CCACCATGCCTGGCTAATTATGG + Exonic
1084152320 11:67294795-67294817 CCACCGTGCCTGGCCACTAAGGG + Intronic
1084388600 11:68860613-68860635 CTACCATGCCTGGCTAATTTTGG - Intergenic
1085282707 11:75341423-75341445 CCACCATGCCTGGCCGACAATGG + Intronic
1085284246 11:75349871-75349893 CTCCCCTCCCTGGCCCATGAGGG + Intronic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1089813162 11:121148118-121148140 CTACCCTGGCTCACCAGTAATGG + Intronic
1090059558 11:123452356-123452378 CCACCATGCCTGGCCAAGGAAGG - Intergenic
1090862472 11:130666302-130666324 ATACCATGGCTGGCGAATAATGG + Intergenic
1092685125 12:11034625-11034647 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092689816 12:11095541-11095563 CTACCCTGCCTGGCCAATAAAGG - Intronic
1093032157 12:14298185-14298207 CCACCGTGCCTGGCCAGGAATGG - Intergenic
1093884273 12:24441255-24441277 CTACACTGCGTGTGCAATAATGG + Intergenic
1096940214 12:55336161-55336183 CCACCCTGCCTTGCATATAATGG - Intergenic
1097003298 12:55896656-55896678 CCACTGAGCCTGGCCAATAATGG + Intergenic
1097583144 12:61482757-61482779 CCACTGTGCCTGGCCACTAATGG - Intergenic
1099338950 12:81402699-81402721 CCACCCTGCCTGGCTAATTTTGG - Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100597261 12:96082319-96082341 CCACCATGCCTGGCCAATTTTGG - Intergenic
1100602304 12:96122405-96122427 CCACCTTGCCTGGCCAATGTTGG + Intergenic
1102365913 12:112334505-112334527 CCACCGTGCCTGGCCGATTATGG - Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1103547205 12:121710783-121710805 CCACCATGCCTGGCCAGAAAGGG + Intergenic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1105219046 13:18308608-18308630 CTACCCTGCCTGGCTAATTTTGG - Intergenic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1107332288 13:39314148-39314170 CCACTATGCCTGGCCAATAAAGG - Intergenic
1107753747 13:43597309-43597331 CTACCATCCATGGCCAAGAAAGG + Intronic
1107883107 13:44850916-44850938 CTACCCTGGTGGGCAAATAAGGG - Intergenic
1108293699 13:48990035-48990057 CCACCGTGCCTGGCCCATAAAGG + Intronic
1108520552 13:51243565-51243587 CACCCCAGCCTGGGCAATAAGGG - Intronic
1110527047 13:76550436-76550458 CCACCGTGCCTGGCCAGTATAGG - Intergenic
1111555263 13:89872837-89872859 GTACATTGCCTGGCCAATATGGG + Intergenic
1111795874 13:92918968-92918990 CCACCGTGCCTGGCCACTAATGG + Intergenic
1111931910 13:94521381-94521403 CCACCGTGCCCGGCCACTAAAGG - Intergenic
1112117345 13:96370622-96370644 CCACCACACCTGGCCAATAATGG - Intronic
1112170535 13:96967981-96968003 CTAGCATGCCTTGCCATTAAAGG + Intergenic
1114209878 14:20605449-20605471 CTACCGTGCCCAGCCAATACAGG - Intronic
1114237795 14:20837354-20837376 CCACCGTGCCCAGCCAATAATGG - Intergenic
1114300906 14:21376918-21376940 CTACCATGCCTGGCTAATCCAGG - Intronic
1114419129 14:22565543-22565565 CTACCCTGCCTCCCCACCAATGG - Intronic
1115234946 14:31200356-31200378 CCACCGTGCCTGGCCAAGAAAGG - Intronic
1115989211 14:39134416-39134438 TTTTACTGCCTGGCCAATAATGG - Intronic
1116446448 14:45017594-45017616 CCACCACGCCTGGCCAAGAATGG - Intronic
1117469635 14:56029322-56029344 CTCCCCAGCCTGCCCCATAAAGG - Intergenic
1118272899 14:64360144-64360166 CACTCCTGCCTGGGCAATAAGGG - Intergenic
1119294391 14:73521242-73521264 CTGTCCTGCCTGGCTACTAAAGG + Intronic
1119516996 14:75256140-75256162 CTACCATGCCAGGCCTAAAATGG + Intronic
1119942829 14:78659389-78659411 CTACCATGCCCAGCCAAAAATGG - Intronic
1123432664 15:20231846-20231868 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1123446503 15:20334621-20334643 CCACCGTGCCTGGCCAATGTTGG + Intergenic
1123818802 15:24005668-24005690 CCACCGTGCCTGGCCAAGGATGG + Intergenic
1124984521 15:34593089-34593111 CCACCGTGCCCGGCCAATATTGG + Intergenic
1126133725 15:45370087-45370109 CAACCATGCCTGGCCAATAATGG - Intronic
1126391286 15:48156063-48156085 CCACCATGCCCGGCCCATAATGG + Intronic
1126788128 15:52195830-52195852 CACCCCAGCCTGGGCAATAAAGG - Intronic
1127087737 15:55440336-55440358 CCACCACGCCTGGCCAATGATGG + Intronic
1127424701 15:58844258-58844280 CCACCGTGCCCGGCCAACAATGG - Intronic
1127839054 15:62814093-62814115 CCACCAGGCCTGGCCAATATGGG + Intronic
1128659196 15:69485327-69485349 CTACCCTGCCTGGGCAAAGCGGG - Intergenic
1129510033 15:76114981-76115003 CCACTGTGCCTGGCCAACAAGGG - Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1129928507 15:79387078-79387100 CCACCATGCCTGGCTAATTATGG + Intronic
1130212046 15:81933213-81933235 CCACCGTGCCTGGCCCAGAAAGG + Intergenic
1131178913 15:90227332-90227354 CCACCATGCCTGGCCACTGAGGG + Intronic
1131509498 15:93041872-93041894 CCACCGTGCCCGGCCAAAAAAGG - Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132533317 16:464606-464628 CCACTGTGCCTGGCCCATAATGG - Intronic
1132979806 16:2731495-2731517 CCACCGCGCCTGGCCAAAAATGG + Intergenic
1133759429 16:8786433-8786455 CCACCGTGCCTGGCCATCAAAGG + Intronic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1134027089 16:10962769-10962791 ATACCATGCCTGGCCAATCTTGG - Intronic
1134060771 16:11198295-11198317 CCACCCTGCCTGGCGAATTTTGG - Intergenic
1134098768 16:11436879-11436901 CTACCATGCCTGGCCTGGAAAGG + Intronic
1134414834 16:14034324-14034346 CCACCATGCCTGGCCAAAGATGG - Intergenic
1134626403 16:15725758-15725780 TTACCCTGCCTTGCCACTCATGG - Exonic
1134642010 16:15836875-15836897 CTACCATGCCTGGCTAATTTTGG + Intronic
1134660896 16:15983706-15983728 CTACCATGCCTGGCTAATTTTGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135141445 16:19925518-19925540 CTACCCTGCCCAGCCTATAATGG + Intergenic
1136353799 16:29730020-29730042 CTACCATGCCTGGCCAATTTTGG - Intergenic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1136521297 16:30797868-30797890 CCACCTTGCCTGGCCAGTAATGG - Intergenic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137630182 16:49937775-49937797 CCACCATGCCTGGCCAATCCAGG + Intergenic
1137695913 16:50461969-50461991 CCACCGTGCCTGGCCAAGGATGG - Intergenic
1138500930 16:57443736-57443758 CCACCGTGCCTGGCCAATTTTGG + Intronic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139897307 16:70298004-70298026 CTACTGTGCCTGGCCAATCCTGG + Intronic
1140425261 16:74855876-74855898 CCACCACGCCTGGCCACTAAGGG - Intergenic
1141712320 16:85707197-85707219 CCACCATGCCTGGCCACAAATGG - Intronic
1141975908 16:87516318-87516340 CGTCCCTGCCTGGCCAGCAAAGG + Intergenic
1142704622 17:1686799-1686821 CCACCGTGCCAGGCCAAAAAAGG + Intergenic
1142835913 17:2586597-2586619 GCACCGTGCCTGGCCAATGAGGG - Intergenic
1143236989 17:5411274-5411296 CCACCGTGCTTGGCCAATATTGG - Intronic
1143503038 17:7350036-7350058 CTACCCCGTGTGGCCAAGAATGG - Exonic
1144246534 17:13371729-13371751 CCATCATGCCTGGCCTATAAGGG - Intergenic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1145373999 17:22330763-22330785 CCACTGTGCCTGGCCAATAGAGG + Intergenic
1146590044 17:34121025-34121047 CCACCGTGCCTGGCCAGTACTGG + Intronic
1146898996 17:36569038-36569060 CCACCGTGCCTGGCCTACAAAGG + Intronic
1147404559 17:40201610-40201632 CCACCATGCCTGGCCAGGAAGGG - Intergenic
1147635757 17:41962878-41962900 CTGCCCTGCCTGGACCAGAAAGG - Intronic
1149505430 17:57190062-57190084 CCACTGTGCCTGGCCAATTATGG + Intergenic
1149707256 17:58706139-58706161 CCACCGTGCCTGGCCAGCAAAGG - Intronic
1149821936 17:59788602-59788624 CAGACCAGCCTGGCCAATAATGG + Intronic
1149931147 17:60756897-60756919 CCACCGCGCCTGGCCAAGAAGGG - Intronic
1150240951 17:63632198-63632220 CCACCATGCCTGGCCTTTAATGG - Intronic
1150254372 17:63732290-63732312 CTACCGCACCTGGCCAATAGTGG + Intronic
1151177426 17:72300330-72300352 CCACTCTGCCTGGCCCAAAATGG - Intergenic
1151273591 17:73015780-73015802 CCAGCCAGCCTGGCCAATATGGG - Intronic
1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG + Intronic
1151524071 17:74651767-74651789 CCACTGTGCCTGGCCAGTAATGG + Intergenic
1151796378 17:76349021-76349043 CCACCACGCCTGGCCAAAAATGG - Intronic
1151941131 17:77292644-77292666 CCACCATGCCTGGCCAATTTTGG + Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153208387 18:2730455-2730477 CCACCGTGCCTGGCCCACAAAGG + Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1154174045 18:12071765-12071787 CCACCGTGCCTGGCCACAAAAGG - Intergenic
1154384611 18:13881486-13881508 CTCCCATGCCTGGCCAAGACAGG + Intergenic
1155613076 18:27690791-27690813 CCACCATGCCTGGCCAGAAATGG + Intergenic
1155973430 18:32102916-32102938 CCACCATGCCTGGCCAATTTGGG + Intronic
1156466794 18:37352932-37352954 CTACCGCGCCCGGCCAAGAAAGG - Intronic
1156652295 18:39238619-39238641 CCACCGTGCCTGGCCGAAAATGG + Intergenic
1157373374 18:47139169-47139191 CCACCGTGCCCGGCCAACAAAGG - Intronic
1157480223 18:48049191-48049213 CAAGCCTGCCTGGCTAGTAAAGG + Intronic
1160753155 19:744604-744626 CCACCATGCCTGGCCATTACAGG - Intronic
1161312754 19:3603885-3603907 CTACCCCTCCTGGCCAATGCAGG - Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161662501 19:5555612-5555634 TTTCCCTGCCTGCCCAAGAAGGG - Intergenic
1162039943 19:7964545-7964567 CCACCATGCCTGGCCCAGAAAGG - Intronic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1163710840 19:18845805-18845827 CAAACCTACCTGGCCAAAAAAGG - Intronic
1163873431 19:19845323-19845345 CCACCCCGGCTGGCCAATATAGG - Intergenic
1164096361 19:22013167-22013189 CCACCATGCCCGGCCAATCATGG + Intergenic
1164103218 19:22077950-22077972 CCACCGTGCCTGGCCTAGAATGG - Intronic
1164115869 19:22217989-22218011 CCACCATGCCCGGCCAATGATGG + Intergenic
1164532890 19:29061525-29061547 CCACCATGCCCGGCCAATAGAGG - Intergenic
1165761472 19:38323879-38323901 CCACCTTGCCTGGCCAGGAAGGG + Intronic
1166239067 19:41477420-41477442 CCACCCTGCCTGGCCATCATGGG + Intergenic
1166515707 19:43445217-43445239 TCACCATGCCTGGCCAATAATGG - Intergenic
1166709167 19:44926155-44926177 CCACCATGCCTGGCCAATGCAGG + Intergenic
1167376089 19:49112898-49112920 CCACCTTGCCTGGCCGATACTGG - Intergenic
1167474974 19:49694851-49694873 CCACCATGCCTGGCCAAGGATGG - Intronic
1167628024 19:50605338-50605360 CCACCGTGCCTGGCCAATTTTGG + Intergenic
1167650415 19:50725548-50725570 CTTCCCTTCCTGGCCACGAATGG + Exonic
1167871566 19:52375022-52375044 CCACCATGCCTGGCCTAGAAGGG + Intronic
925964945 2:9055991-9056013 CCACCATGCCCAGCCAATAACGG - Intergenic
926243960 2:11108360-11108382 CTACCGCGCCTGGCCAATAAAGG - Intergenic
927913717 2:26920476-26920498 CCACCACGCCTGGCCAACAATGG - Intronic
928099495 2:28427741-28427763 CCACCATGCCTGGCCTAAAATGG + Intergenic
928237857 2:29560722-29560744 CTACCATGCCTGGCTAATTTTGG + Intronic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930116317 2:47721464-47721486 CCACCATGCCTGGCTAATTATGG + Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930394297 2:50800835-50800857 CCAGCATGCCTGGCCAATAATGG + Intronic
930794226 2:55370718-55370740 CCACCCTGCCTGGCCCCAAAGGG - Intronic
930832900 2:55764181-55764203 ATACCTTGCCTGGCCAAAAGTGG - Intergenic
930840305 2:55837959-55837981 CTACCATGCCTGGCCTAGAATGG + Intergenic
931500746 2:62863304-62863326 CCACCATGCCTGGACAACAATGG - Intronic
933429421 2:82156477-82156499 CCACCACGCCTGGCCAAGAATGG + Intergenic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
936247745 2:110843305-110843327 CCACCATGCCTGGCCAATGTAGG + Intronic
936906681 2:117544431-117544453 CTACCATGCCGGGCCTTTAAGGG - Intergenic
936949335 2:117962332-117962354 GTACCCTGACTGACCAATTAAGG + Intronic
937364450 2:121250890-121250912 CCACCATGCCTGGCCAGTATTGG + Intronic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937408744 2:121654236-121654258 CCACCCTGCCTGGCCCAAAATGG - Intergenic
937926130 2:127168831-127168853 CCACCGTGCCTGGCCCAGAAAGG - Intergenic
938022144 2:127914857-127914879 CCACTCTGCCTGGCCAAAAGTGG - Intergenic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
938312722 2:130303742-130303764 CCACCGTGCCTGGCCAATGAAGG - Intergenic
938373124 2:130786342-130786364 CTTGCCTGCCTGGCCAATCAAGG - Intergenic
939492393 2:142892198-142892220 CCGCCATGCCTGGCCAATATTGG + Intronic
940129275 2:150362884-150362906 CTACCGTGCCCGGCCAAAAGGGG - Intergenic
940211346 2:151259102-151259124 CCAGCCTGCCTGGGCAATAGAGG + Intronic
942058350 2:172205872-172205894 GTACCCTGTCTGTCCAATATAGG + Intergenic
942113644 2:172706850-172706872 TTACCCTCACTGGCCAGTAATGG - Intergenic
943675119 2:190709189-190709211 CCACCATGCCTGGCCTGTAAAGG - Intergenic
943757265 2:191569622-191569644 CTACCGTGCCTGGCCTAGCAAGG + Intergenic
944799625 2:203226871-203226893 CCACCATGCCTGGCCAATGAAGG + Intergenic
944832162 2:203543757-203543779 CCACCGTGCCTGGCCCAAAAGGG - Intergenic
946256127 2:218443480-218443502 CCACCACGCCCGGCCAATAATGG + Intronic
947587630 2:231366408-231366430 CCACCGTGCCTGGCCCGTAATGG - Intronic
948011714 2:234654100-234654122 CCACCATGACTGGCCAAGAAAGG + Intergenic
948496835 2:238356207-238356229 CCACCATGCCTGGCCAGGAATGG - Intronic
949010331 2:241674679-241674701 CCACCATGCCTGGCCCATCACGG - Intergenic
1169310459 20:4534005-4534027 TTTCCCTGCCTGCCCAAGAAAGG + Intergenic
1169385220 20:5143129-5143151 CTACCATGCCCAGCCAAAAATGG + Intronic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1171963246 20:31510543-31510565 CTACCATGCCTGGCCACTCAAGG - Intergenic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172489244 20:35321565-35321587 CCACCTTGCCCAGCCAATAAGGG - Intronic
1173235229 20:41239294-41239316 CCACCGTGCCTGGCCAATAAGGG + Intronic
1173299633 20:41790360-41790382 CTACCATGCCTGGCCATCAATGG + Intergenic
1173367400 20:42399408-42399430 CTCCCCTGCCTTGGCACTAAGGG - Intronic
1173978336 20:47204168-47204190 CCACCATGCCTGGCCAATGTGGG + Intergenic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174327510 20:49791055-49791077 CCACCGTGCCTGGCCCACAAAGG + Intergenic
1175559397 20:59907957-59907979 CCACCGTGCCTGGCCAGGAATGG - Intronic
1176082393 20:63280443-63280465 CCACCATGCCTGGCCAGAAAGGG + Intronic
1177194140 21:17884527-17884549 CCACCGCGCCTGGCCGATAATGG + Intergenic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178322536 21:31616313-31616335 CCACCGTGCCTGGCCTGTAAAGG + Intergenic
1178549739 21:33526459-33526481 CCACCGTGCCTGGCCTGTAAAGG + Intronic
1179222258 21:39418785-39418807 CCACCATGCCTGGCCAGAAATGG + Intronic
1181293391 22:21815616-21815638 CCACCACACCTGGCCAATAAAGG + Intronic
1181302683 22:21892682-21892704 CCACCATGCCCGGCCAATATTGG - Intergenic
1181557466 22:23679628-23679650 CCACCGTGCCTGGCCACAAATGG - Intergenic
1181718124 22:24750289-24750311 CTGCCCTGGCTGGCCAAAAGTGG + Intronic
1181795318 22:25304348-25304370 CCACCATGCCTGGCCTTTAATGG + Intergenic
1181832953 22:25577460-25577482 CCACCGTGCCTGGCCCGTAAAGG + Intronic
1182049488 22:27301935-27301957 CCACCACGCCTGGCCAATATCGG + Intergenic
1182434798 22:30323676-30323698 CCACCATGCCTGGCCTGTAAGGG - Intronic
1182483538 22:30625749-30625771 CCACCCTGCTCGGCCTATAATGG + Intronic
1182517904 22:30869362-30869384 CTACCCTGCAAGGCCATTGAGGG + Intronic
1182894239 22:33845593-33845615 CCACCACGCCTGGCCTATAATGG + Intronic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183655980 22:39184925-39184947 CTCCCCTGCCTCTCCAATAGTGG - Intergenic
1183804491 22:40196514-40196536 CTACCCTGACTTCCAAATAAAGG - Intronic
1183918751 22:41146452-41146474 CCACTGTGCCTGGCCTATAATGG + Intronic
1184166287 22:42730338-42730360 CTACCCTGCCTGGCCAGTGATGG - Intergenic
1184191882 22:42900372-42900394 GTACCCTGCCTGGCCAAGTATGG - Intronic
1184334150 22:43843596-43843618 CCACCATGCCTAGCCAATGAGGG + Intronic
1184847245 22:47096532-47096554 CCACCGTGCCCGGCCAACAAAGG - Intronic
1184849201 22:47110190-47110212 CCACCGTGCCTGGCCAGAAAAGG - Intronic
949143723 3:668971-668993 CAACACTTCCTGGTCAATAAAGG + Intergenic
949312357 3:2714133-2714155 CAACACTGCCTGGCCAACAGGGG - Intronic
949584117 3:5421264-5421286 CCACCGTGCCCGGCCAAGAAAGG - Intergenic
950022854 3:9800710-9800732 CCACCATGCCTGGCCAGTAGAGG + Intronic
950056956 3:10032591-10032613 CCACCTTGCCTGGCCAGAAATGG + Intronic
950662455 3:14474951-14474973 CTACCCTGTCTCACCAAGAAAGG - Intronic
950670007 3:14520274-14520296 CTCCCCTGCCTGGCCAGGAGCGG - Exonic
952551808 3:34486969-34486991 CCACCATGCCTGGCCTAGAAAGG - Intergenic
953366136 3:42346851-42346873 CCACCGTGCCTGGCCGACAAGGG + Intergenic
953440923 3:42916649-42916671 CTACCACGCCTGGCCAATCCAGG + Exonic
953442466 3:42930134-42930156 CCACCATGCCTGGCCATAAATGG - Intronic
953995922 3:47519984-47520006 CCACCGCGCCTGGCCAATGAGGG - Intergenic
954071801 3:48148437-48148459 CTACCATGCCCGGCCAAGAAAGG - Intergenic
954212735 3:49107408-49107430 CCACCATGCCTGGCCAAAGAAGG + Intergenic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
955079102 3:55641260-55641282 CCACCATGCCTGGCCTATATTGG - Intronic
955672015 3:61412038-61412060 CCACCGTGCCTGGCCCAGAATGG - Intergenic
956127538 3:66025249-66025271 CCACTGTGCCTGGCCAATCATGG - Intronic
956543645 3:70374199-70374221 CCAACGTGCCTGGCCAATGATGG + Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
959665101 3:108911816-108911838 CCACCATGCCCGGCCAAAAAGGG - Intronic
959689674 3:109185280-109185302 TGACCATGCCTGGCCAATGAGGG - Intergenic
960103918 3:113773223-113773245 CCACCGTGCCTGGCCAATATTGG + Intronic
960207955 3:114925811-114925833 CCACTGTGCCTGGCCAATTATGG + Intronic
960559617 3:119069213-119069235 CCACTGTGCCTGGCCAACAATGG + Intronic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960741902 3:120843275-120843297 CCAGCGTGCCTGGCCAATGATGG + Intergenic
960853496 3:122079561-122079583 CTTACCTGCCTGGCCATGAAAGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962328398 3:134455394-134455416 CCACCCTGGCTGGCCAATTTTGG + Intergenic
962496691 3:135946981-135947003 CCACTGTGCCTGGCCAATGAAGG - Intergenic
963090203 3:141476944-141476966 CCACCGTGCCTGGCCAATCTTGG + Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963282363 3:143397253-143397275 GTGCCCTGCCTGGGCAATTAGGG + Intronic
963984948 3:151581781-151581803 CCACCATGCCCAGCCAATAATGG - Intergenic
964750131 3:160046822-160046844 CCACCATGCCTGGCCAAGTAGGG + Intergenic
965534285 3:169809041-169809063 CTACCAGGCCTGGCACATAATGG - Intronic
966373815 3:179275439-179275461 CCACCGTGCCCGGCCAATACTGG - Intergenic
966426958 3:179790059-179790081 CCACCATGCCTGGCCCACAAGGG - Intergenic
966903999 3:184508641-184508663 CTATCCTGCCTGGAGCATAACGG + Intronic
968035877 3:195547503-195547525 CCACCGCGCCTGGCCAAGAAGGG - Intergenic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968218363 3:196913934-196913956 CCACTGTGCCTGGCCAAGAAAGG + Intronic
968401269 4:300173-300195 CCACCATGCCTGGCCACAAATGG - Intronic
968913928 4:3489014-3489036 CCACCCTGCCTGGGCAGGAAGGG + Intronic
969959749 4:10932658-10932680 CCACCGTGCCTGGCCAACAATGG - Intergenic
971352571 4:25866215-25866237 CCACCATGCCTGGCCCAAAATGG + Intronic
972284249 4:37633119-37633141 CCACCGTGCCTGGCCAAACATGG - Intronic
972431446 4:38986519-38986541 CCACCGTGCCTGGCCATGAATGG - Intronic
973812111 4:54581571-54581593 CCACCGTGCCTGGCCATGAAAGG - Intergenic
973916831 4:55642427-55642449 CCACCGTGCCCGGCCAATTAGGG - Intergenic
974435049 4:61846025-61846047 CCACCATACCTGGCCAAGAAAGG - Intronic
974987069 4:69041478-69041500 CACTCCTGCCTGGCCAACAAGGG + Intronic
975247272 4:72133975-72133997 CCACTCTGCCTGGCCAAGGATGG - Intronic
975533735 4:75427141-75427163 CTACCTTCCCTGGCCCATAGAGG + Intergenic
977579889 4:98713679-98713701 CCACCATGCCTGGCCGATTAGGG + Intergenic
977866561 4:102035359-102035381 CCACCGTGCCTGGCCAACATGGG - Intronic
978192292 4:105928324-105928346 CCACCACGCCAGGCCAATAATGG - Intronic
978866054 4:113512856-113512878 CCACCACGCCCGGCCAATAATGG + Intronic
979170072 4:117590542-117590564 CTCACCTACCTGGCCAAAAAGGG - Intergenic
979320408 4:119316649-119316671 CCACCCTGCTTGGCCAAAAGAGG - Intergenic
979477094 4:121171101-121171123 CCACCATGCCTTGCCAGTAAGGG + Intronic
979809913 4:125024400-125024422 CTACCCTGCATCACCAAGAAAGG - Intergenic
979821167 4:125173270-125173292 GTACCCAGCCTGGGCAACAAAGG + Intergenic
980906324 4:138951786-138951808 CTACTCCTCCTGGCCAATACAGG + Intergenic
980974312 4:139596396-139596418 CTTGCATGCCTGGCCAAGAAGGG - Intronic
981787775 4:148501108-148501130 CCACCCTGCCTGGCCTGTGAAGG + Intergenic
983084192 4:163423998-163424020 CTACCATGCCTGGCATACAATGG - Intergenic
983550966 4:169017086-169017108 CCACCGTGTCTGGCCAGTAAGGG - Intergenic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
984165935 4:176303331-176303353 CTATTCTGCCTTGCCAAGAATGG - Intergenic
985241653 4:187937143-187937165 CCACCTTGCCTGGCCTAAAATGG + Intergenic
985510713 5:311970-311992 CCACCATGCCTGGCCAACTATGG + Intronic
986363197 5:7002210-7002232 CCACTGTGCCCGGCCAATAAAGG - Intergenic
988637812 5:33006055-33006077 CCACCGCGCCTGGCCAAGAATGG - Intergenic
989154060 5:38327083-38327105 CCACCGCACCTGGCCAATAAGGG + Intronic
989577522 5:43002270-43002292 CCACCCTGCCTGGCCTACAAGGG - Intergenic
989581303 5:43035915-43035937 CTACCCCACCTGGCCCACAATGG - Intergenic
990248916 5:53892890-53892912 CTACTGTGCCTGGCCTATACTGG + Intronic
990326751 5:54684553-54684575 CTACCATGCCTGGCCACTGTAGG + Intergenic
992472473 5:77071780-77071802 CTACCATGCCCAGCCAAGAATGG + Intergenic
992791967 5:80221857-80221879 CCACCGTGTCTGGCCATTAAAGG - Intronic
993491568 5:88557937-88557959 CTCCCCTCCCTCTCCAATAAAGG - Intergenic
993638814 5:90377922-90377944 CTACCATGCCTGGCCAAGTACGG + Intergenic
994839599 5:104905736-104905758 CCACCGTGCCTGGCCAGGAAAGG + Intergenic
995232200 5:109780030-109780052 CAACCATGACTGGCCAATAATGG - Intronic
996554554 5:124764309-124764331 CCACCGCGCCTGGCCAATATGGG + Intergenic
996895682 5:128479335-128479357 CTACCCTGCATTGCTGATAAAGG - Intronic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997313807 5:132915049-132915071 CCACCGTGCCTGGCCAGAAATGG - Intronic
998153100 5:139768433-139768455 CCACCATGCCTGGCCAAGGAAGG - Intergenic
999015863 5:148104606-148104628 CCACCGTGCCTGGCCAGAAATGG - Intronic
999453333 5:151694746-151694768 CTACCGTGTCTGGCCCACAAAGG + Intergenic
999983156 5:156977127-156977149 CCACCGTGCCTGGCCAACAATGG - Intergenic
1001636946 5:173217109-173217131 CCACCGTGCCTGGCCAACCATGG + Intergenic
1002208209 5:177578958-177578980 CCACCGTGCCCGGCCAATAGAGG - Intergenic
1002390016 5:178903258-178903280 CTACCATCACTGGCCAATATGGG - Intronic
1002803932 6:553202-553224 CAACCGTGCCTGGCCAGAAAGGG + Intronic
1003384012 6:5650762-5650784 CCACCCTGCCTGGCCAAAGTGGG + Intronic
1004101466 6:12616491-12616513 CTACCGTGCCAGGCCCATAAAGG + Intergenic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004371173 6:15053740-15053762 CCGCCGTGCCTGGCCAAGAATGG - Intergenic
1004396887 6:15253348-15253370 CCACCGTGCCTGGCCAAATAAGG + Intronic
1004621996 6:17338997-17339019 CCACCGTGCCTGGCCCATATTGG - Intergenic
1005145577 6:22686211-22686233 CTTCCCTGCCTGAAAAATAAAGG - Intergenic
1005638045 6:27769754-27769776 CCACCGCGCCTGGCCAAAAATGG - Intergenic
1006130168 6:31864361-31864383 CCACCATGCCTGGCCTCTAATGG + Intronic
1006216351 6:32446641-32446663 CCACCGCGCCTGGCCAAAAACGG - Intergenic
1006646160 6:35515692-35515714 CCACCGTGCCTGGCCAAGGAAGG + Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1007357135 6:41329169-41329191 CCACTGTGCCTGGCCAAAAAGGG - Intergenic
1009357655 6:62771481-62771503 CCACCATGCCTGGCCTATTATGG - Intergenic
1009386931 6:63096308-63096330 CCACCATGCCTGGCCCATATGGG - Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1010218593 6:73427771-73427793 CCAGCCTGCCTGGGCAACAAAGG + Intronic
1010254357 6:73740876-73740898 CCACTGTGCCTGGCCAAGAAAGG + Intronic
1010966079 6:82210536-82210558 CCACTATGCCTGGCCAATAAAGG - Intronic
1011201971 6:84846688-84846710 CCACCGTGCCTGGCCAAGAAAGG - Intergenic
1011287004 6:85735570-85735592 CCACCATGCCTAGCCAATACTGG + Intergenic
1011598202 6:89036649-89036671 CCACCGTGCCCGGCCAATGATGG - Intergenic
1011662503 6:89606566-89606588 CCACCATGCCAGGCCAAAAAAGG - Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1013283267 6:108658709-108658731 CCACCGTGCCTGGCCAACATTGG + Intronic
1014750994 6:125256059-125256081 CCACCGTGCCTGGCCCCTAATGG - Intronic
1014867757 6:126552574-126552596 CCACCGTGCCTGGCCAGTGATGG + Intergenic
1015194975 6:130515821-130515843 CCACCATGCCAGGCCAAAAATGG - Intergenic
1015344417 6:132139026-132139048 CCACCATGACTGGCCAATACGGG - Intergenic
1017849813 6:158295600-158295622 CCACCATGCCTGGCCAATGCTGG - Intronic
1018198044 6:161371924-161371946 CCACCATGCCTGGCCCAGAAGGG + Intronic
1019266460 7:119941-119963 CTTCCCTGCCCTGCCAATGATGG - Intergenic
1019855366 7:3600833-3600855 CCACCGTGCCTGGCCAATGTAGG + Intronic
1020095691 7:5367713-5367735 CCACCGTGCCTGGCCAACCAAGG + Intronic
1020972751 7:14966589-14966611 CCACCATGCCTGGCCTTTAAGGG + Intronic
1022858654 7:34342378-34342400 CCACCCTGCCTGGCCACCTATGG + Intergenic
1023440247 7:40177948-40177970 GAAACCAGCCTGGCCAATAATGG - Intronic
1024577741 7:50778601-50778623 CTACCCTGACAGGGAAATAATGG + Intronic
1024863581 7:53876462-53876484 CCACCAAGCCTGGCCAGTAAGGG - Intergenic
1025188498 7:56879236-56879258 CCACCATGCCTGGCCAGAAAAGG + Intergenic
1025683431 7:63697684-63697706 CCACCATGCCTGGCCAGAAAAGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1025987955 7:66472538-66472560 CCACCGTGCCTGGCCACTAATGG + Intergenic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026279074 7:68905564-68905586 CCACCGCGCCTGGCCAATATTGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027047720 7:75002211-75002233 CCACCATGCCTGGCCAGGAAAGG + Intronic
1027372506 7:77521084-77521106 CCACCACGCCTGGCCAAAAATGG + Intergenic
1028515404 7:91672765-91672787 CTACCATGCCTGGCCCAGACTGG - Intergenic
1029924098 7:104297568-104297590 CCACCGCGCCTGGCCAAAAAGGG - Intergenic
1030208499 7:106973523-106973545 CCACCCCGCCTGGCCTAAAAAGG + Intergenic
1030307083 7:108029830-108029852 CCACCACGCCTGGCCAAGAAAGG - Intronic
1030872837 7:114778448-114778470 CTATCGCGCCTGGCCAAAAATGG + Intergenic
1032219115 7:129980593-129980615 CCACCCTGCCTGGCCTACAAGGG + Intergenic
1032499268 7:132387871-132387893 CTAATCTGCTTGGCCATTAAGGG + Intronic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033130002 7:138737732-138737754 CTACCATGCCTGGCTAATTTTGG + Intronic
1033160009 7:138987127-138987149 CCACCACGCCTGGCCAAAAAAGG - Intergenic
1033588359 7:142790921-142790943 CAACCCTGCCTGGCCAGGATTGG - Intergenic
1035918708 8:3653594-3653616 CCACCCTGCCTGGCCAGTTATGG + Intronic
1036956247 8:13191217-13191239 CCACTGTGCCTGGCCAATAAGGG - Intronic
1039043695 8:33431257-33431279 CCACCGTGCCTGGCCAACTAGGG - Intronic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039982963 8:42424466-42424488 CCACCGTACCTGGCCAATTAAGG + Intronic
1040432292 8:47355241-47355263 CCACCATGCCTGGCCGATGAAGG + Intronic
1040513815 8:48118253-48118275 CTACCATGCCTGGCCAGCACTGG + Intergenic
1042258369 8:66830141-66830163 CCACTGTGCCTGGCCAAAAATGG + Intronic
1043872319 8:85447607-85447629 CCATCGTGCCTGGCCAATACTGG - Intronic
1045503007 8:102757783-102757805 CTACCCTGACTGGCTAATCTTGG + Intergenic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1046131099 8:109969557-109969579 CCACCGTGCCCGGCCCATAATGG - Intronic
1049179779 8:141216253-141216275 CTGCCCTGCCAGGCCAATCTGGG + Intronic
1049856638 8:144866256-144866278 CCACCATGCCTGGCCAGGAATGG + Intergenic
1049866268 8:144939316-144939338 CAACCGTGCCTGGCCCACAATGG - Intronic
1050430270 9:5555125-5555147 CCACCGCACCTGGCCAATAATGG - Intronic
1050557907 9:6806205-6806227 CCACCATGCCTGGCCAATTTGGG - Intronic
1050765571 9:9129235-9129257 CTACCATGCCTGGCTAATTTTGG - Intronic
1051459797 9:17298954-17298976 CCACCATGCCCGGCCAATAAAGG - Intronic
1051741782 9:20259484-20259506 CTACCCTGCCCAGCCAAGATAGG + Intergenic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052926174 9:34018574-34018596 TGACCGTGCCCGGCCAATAATGG - Intronic
1053515357 9:38725901-38725923 CCACCATGCCCGGCCACTAAGGG + Intergenic
1054767244 9:69052442-69052464 CTGCACTGCCTGGCCCAGAAAGG + Intronic
1054916201 9:70497402-70497424 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1056557364 9:87700786-87700808 CCACCATGCCTGGCCAATTTTGG + Intronic
1056983188 9:91336342-91336364 CCACCATGCCTGGCCAATCCAGG - Intronic
1057890014 9:98862901-98862923 CCACCGTGCCTGGCCACCAACGG + Intergenic
1058037047 9:100264328-100264350 CCAACATGCCTGGCCAATTAAGG - Intronic
1058145422 9:101405786-101405808 CCACCGTGCCTGGCCTAAAATGG - Intronic
1058198497 9:102008788-102008810 CTAGCCTGCCTGGCTACTAGTGG - Intergenic
1059156694 9:111995810-111995832 CCACCATGCCTGGCCTCTAAAGG - Intergenic
1060294480 9:122333882-122333904 CCACTGTGCCTGGCCAACAATGG - Intergenic
1061097863 9:128470341-128470363 CCACCACGCCTGGCCAAGAAGGG - Intronic
1061346078 9:130026339-130026361 CCACCCTGCCTGGCTAATTTTGG - Intronic
1061446567 9:130641772-130641794 CCACCGTGCCCGGCCAATGAGGG + Intergenic
1061469427 9:130812075-130812097 CCACTCTGCCTGGCCCTTAATGG - Intronic
1062645133 9:137543960-137543982 CCACCCTGCCTGGCCTGTGAGGG + Intronic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1185866364 X:3627749-3627771 CCACTGTGCCTGGCCAAAAAGGG + Intronic
1186148747 X:6651808-6651830 CTAGCTTTCCTGGCCTATAATGG - Intergenic
1186551794 X:10513794-10513816 CCACTGTGCCTGGCCAACAATGG + Intronic
1187163084 X:16782181-16782203 CCACCGTGCCTGGCCAGAAATGG + Intergenic
1187166692 X:16810965-16810987 CTACCGTGCCTGGCCAATAGTGG + Intronic
1187407667 X:19018408-19018430 CTACCTTGCCTGGTCCAGAAGGG + Intronic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1189035439 X:37490107-37490129 CTGCCATACCTGGCCAATGAGGG + Intronic
1189380121 X:40496733-40496755 CAACCCTGCCTGGCAACTGATGG + Intergenic
1189456813 X:41198897-41198919 CCACCGTGCCCGGCCTATAATGG - Intronic
1190549266 X:51562486-51562508 CCACCGTGCCTGGCCTAAAATGG - Intergenic
1191633418 X:63350448-63350470 CTCCACTGCCTTGCCAATCAGGG + Exonic
1192445502 X:71208095-71208117 CCACCGTGCCCAGCCAATAAGGG + Intergenic
1193883700 X:86959561-86959583 CTACACTGCCTCTCCAACAAAGG - Intergenic
1194659486 X:96614130-96614152 CCACCGTGCCTGGCCAGTAGTGG - Intergenic
1194711454 X:97241583-97241605 CCACCACGCCTGGCCAGTAATGG + Intronic
1195081818 X:101378369-101378391 CCACCGTGCCTGGCCAGTAAAGG + Intronic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1197200896 X:123747665-123747687 CCACCATGCCTGGCCATAAAAGG + Intergenic
1197391048 X:125865145-125865167 CTACCCTTCCTGGCCTTGAAGGG - Intergenic
1197659320 X:129152613-129152635 CCACCATGCCTGGCCTAGAATGG + Intergenic
1197974808 X:132155467-132155489 CCACCATGCCTGGCCAATTTAGG + Intergenic
1197990354 X:132310862-132310884 CCACTGTGCCTGGCCAATGATGG - Intergenic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1201953401 Y:19591258-19591280 CCACCATCCCTGGCCAATAAAGG + Intergenic
1202575956 Y:26324995-26325017 CTACCATACCTGGCCAAGAAGGG + Intergenic