ID: 1092686353

View in Genome Browser
Species Human (GRCh38)
Location 12:11051604-11051626
Sequence TGGACGTTGCGTATTACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092686353_1092686356 29 Left 1092686353 12:11051604-11051626 CCTCCTGTAATACGCAACGTCCA 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1092686356 12:11051656-11051678 TTCTTTATACTTTACCAACTAGG 0: 1
1: 4
2: 9
3: 22
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092686353 Original CRISPR TGGACGTTGCGTATTACAGG AGG (reversed) Intronic
902530128 1:17085587-17085609 TGGACGTTCTGTCTTACAGATGG + Intronic
914331065 1:146671306-146671328 TGGATGTTGGGGATTACAGAGGG - Intergenic
922134966 1:222815342-222815364 TGGAGGTTGCGGATGACACGGGG + Intergenic
1066663286 10:37757167-37757189 TGGACGTTGTGTATGATAGATGG + Intergenic
1080136645 11:28862844-28862866 TAGATGTAGCCTATTACAGGAGG - Intergenic
1084911559 11:72393777-72393799 TGCACGTTGGGTTTTACAGTTGG + Intronic
1089671376 11:120059171-120059193 TGGAAGTTGGGTCTTAGAGGAGG + Intergenic
1092686353 12:11051604-11051626 TGGACGTTGCGTATTACAGGAGG - Intronic
1115118928 14:29916270-29916292 TGGAGGTTGCTTTTTACAAGCGG - Intronic
1115428893 14:33293105-33293127 TGGACATAGTGTAGTACAGGTGG - Intronic
1120433313 14:84447123-84447145 TGGACCTTCCATATTCCAGGTGG + Intergenic
1139876139 16:70147650-70147672 TGGAAGTTGCTCGTTACAGGTGG - Intronic
1140002488 16:71039598-71039620 TGGATGTTGGGGATTACAGAGGG + Intronic
1140359651 16:74333448-74333470 TGGAAGTTGCTCGTTACAGGTGG + Intergenic
1142375592 16:89705332-89705354 TGGACGATGCTGAGTACAGGAGG - Intergenic
1159508862 18:69369996-69370018 TGGAGGTTGGGTCTGACAGGAGG - Intergenic
926045156 2:9704651-9704673 TGGATTTTGCACATTACAGGGGG - Intergenic
929493566 2:42419527-42419549 TGGGCGTGGTGGATTACAGGTGG - Intronic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
1174436126 20:50508404-50508426 TGGACGTTGTGAATTCCAGGAGG - Intergenic
995671253 5:114605841-114605863 TAGACGTTCCGTTTTACTGGAGG + Intergenic
998628732 5:143875049-143875071 TGGCAGTTGAGGATTACAGGTGG + Intergenic
1027865701 7:83643516-83643538 TGGATGTTGCATTTTACAGTGGG - Intronic
1028887458 7:95949797-95949819 TGGATGTTGCTTTTTAAAGGAGG - Intronic
1035133403 7:156676173-156676195 TGGATGTTGCTTATCACAGGTGG + Intronic
1043621287 8:82195618-82195640 TGGAGGTTGCATATTACTGCTGG - Intergenic
1047141297 8:122142590-122142612 TGGACCTTGGGGAGTACAGGTGG - Intergenic
1198613253 X:138425371-138425393 TGGACGTTGGGGACTACAGTTGG + Intergenic