ID: 1092694849

View in Genome Browser
Species Human (GRCh38)
Location 12:11159936-11159958
Sequence ATATAGTAGCTGACTGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092694849 Original CRISPR ATATAGTAGCTGACTGAAAG TGG (reversed) Intronic
901673271 1:10868077-10868099 CTAAAGCAGCTGCCTGAAAGAGG - Intergenic
902572362 1:17354894-17354916 AAATATTCACTGACTGAAAGAGG - Intronic
902752497 1:18526932-18526954 ATACAGAAGCTGATTGCAAGTGG - Intergenic
903938465 1:26912690-26912712 ATAGAAGAGATGACTGAAAGGGG - Intronic
903989223 1:27253635-27253657 ATATAGCAGATGCCTGAATGTGG - Intronic
906178310 1:43795811-43795833 AAATAGTAGCAGACAGATAGGGG + Intronic
906192526 1:43907003-43907025 AGATAGGAGCTGACTGATGGAGG - Intronic
906919805 1:50051360-50051382 AAATATTAGCTGAATGTAAGGGG + Intronic
907179691 1:52558543-52558565 GTAAATTAGCTGACTTAAAGGGG - Intergenic
910979602 1:92946363-92946385 TAAAAGTAGCTGACAGAAAGTGG + Intronic
910979753 1:92948196-92948218 AAAGTGTAGCTGACAGAAAGTGG + Intronic
913042417 1:115040288-115040310 TTATAGTTGCTGACTGCATGGGG + Intergenic
914331405 1:146673902-146673924 AAATAGCAGCTGACAGAAATAGG - Intergenic
916126183 1:161573518-161573540 ATATAGTAGCTCAGAGAAACAGG - Intergenic
916136101 1:161655358-161655380 ATATAGTAGCTCAGAGAAACAGG - Intronic
916897158 1:169177270-169177292 ATATAGAAGCCGACTGATACAGG - Intronic
919390914 1:196984803-196984825 ACATAGTAGCAGAGAGAAAGTGG - Intronic
919566271 1:199192934-199192956 ATTTTGTAGCTGCCTGAAAATGG + Intergenic
919890305 1:201967872-201967894 ATATAGAAGCAGCCTAAAAGAGG + Intronic
920059078 1:203215237-203215259 ATGTGGTGGCTGACTGGAAGAGG + Intronic
1064183652 10:13141507-13141529 ATTTAGGAACTGACTGAAAAGGG - Intergenic
1066147112 10:32572258-32572280 ATATAGTAACTGAGTTAAAATGG - Intronic
1067913167 10:50367782-50367804 ATAGAGAAGCTCAGTGAAAGTGG - Intronic
1071275274 10:84048596-84048618 CTATAGTAGCATTCTGAAAGTGG - Intergenic
1076094965 10:127725300-127725322 AGATAGTATCTTACTGAATGGGG + Intergenic
1080379708 11:31755694-31755716 ATATAGCAACTGAATGCAAGTGG + Intronic
1081408124 11:42721946-42721968 TCATAGTAGTTGACTCAAAGAGG - Intergenic
1085497673 11:76986553-76986575 ATATAGTAAGTGATTGAAAATGG - Intronic
1086242108 11:84707592-84707614 AGCTAGGAGCTGGCTGAAAGAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087922152 11:103878622-103878644 ATATAGTAGCTTCCTGACAAAGG - Intergenic
1088062667 11:105675047-105675069 TTATAGTAGCTGACAGGCAGAGG + Intronic
1091541019 12:1462664-1462686 TTATAGGAATTGACTGAAAGAGG + Intronic
1092694849 12:11159936-11159958 ATATAGTAGCTGACTGAAAGTGG - Intronic
1099082392 12:78201804-78201826 CTATTGTAGATGACTGAATGTGG - Intronic
1100178095 12:92053465-92053487 AAATGGTAGAGGACTGAAAGGGG - Intronic
1100460745 12:94796959-94796981 ACATAATAGTTGACTAAAAGAGG - Intergenic
1108028155 13:46200256-46200278 ATGTTGAAGCTGGCTGAAAGGGG + Intronic
1108992038 13:56671695-56671717 ATATTTTAGCTGATAGAAAGTGG - Intergenic
1109187593 13:59289092-59289114 ATATAGTATTTGAATGATAGGGG - Intergenic
1110657191 13:78014127-78014149 ACATAGTATCTGACTGCAATAGG - Intergenic
1117053159 14:51882720-51882742 CTATAGTAGCAGACTGCAATTGG + Intronic
1118070334 14:62239803-62239825 AATTAGTATCTGACTGAAATGGG + Intergenic
1118297137 14:64580846-64580868 AAATATTAGCTTACTGAAATCGG - Intronic
1120492883 14:85199093-85199115 ATATACAAGCAGACTTAAAGGGG + Intergenic
1120591697 14:86382083-86382105 ATACAGTAGCTGAATGGAAATGG - Intergenic
1125060007 15:35408166-35408188 ATATAGCAGGTGAGGGAAAGAGG + Intronic
1127469504 15:59277588-59277610 ATACAGTTGCTGGCTCAAAGAGG - Intronic
1127706615 15:61553352-61553374 ATAGTGGAGGTGACTGAAAGTGG + Intergenic
1130889312 15:88119897-88119919 ATATCCGAGGTGACTGAAAGGGG - Intronic
1136625719 16:31461045-31461067 AAATAGTAGCTGAATGATGGGGG - Intronic
1143182472 17:4992125-4992147 TTATTGAAGCTGACTGAAAAGGG + Intronic
1145905711 17:28515003-28515025 ATATACTAGCTGAGTGAACTTGG + Intronic
1150752232 17:67875471-67875493 ATTTAGTAGTTGACTGAATGTGG + Intronic
1154493442 18:14938734-14938756 ATATTGAAGATGACTGTAAGAGG + Intergenic
1155913023 18:31526423-31526445 ATATAGTAGCTGTCAATAAGTGG - Intronic
1156681798 18:39598940-39598962 ATATGACAGCTGACTGAAAATGG + Intergenic
1156867877 18:41908834-41908856 GTAAAGGAGCTGACTGAAACTGG + Intergenic
1158753319 18:60291709-60291731 CTATGGTTGCTGACTGAAAAAGG - Intergenic
1159289829 18:66402264-66402286 ATATAGGAGCGGAATGAAAATGG - Intergenic
1164320548 19:24140490-24140512 ATATAGTAAGTGACTGAACCTGG - Intergenic
926417981 2:12669440-12669462 ATATAGTTGCTGACAAAGAGAGG - Intergenic
927422467 2:22947826-22947848 ATATGGTAGCTGGCTGAGGGAGG - Intergenic
931070369 2:58640955-58640977 ATATAGTCTCTGCCTGCAAGTGG - Intergenic
931650930 2:64468147-64468169 ATTTAGAAGCTGCCTAAAAGAGG - Intergenic
933406359 2:81865188-81865210 ATAGACTAGGTGACTGAAACAGG + Intergenic
935180144 2:100681856-100681878 ATATGGTGGATGACTGAAATGGG + Intergenic
937483310 2:122286737-122286759 AAATAGAAGTTGAGTGAAAGTGG + Intergenic
940112983 2:150175261-150175283 ATGTATTATCTGACTGACAGTGG + Intergenic
940369759 2:152888101-152888123 ATGTATTAGGAGACTGAAAGTGG - Intergenic
941977271 2:171419038-171419060 ATATAGGAGCCAACTGAAAGAGG - Intronic
944420539 2:199525371-199525393 ATATAGTTGCTGAAAGAAATAGG + Intergenic
1168873664 20:1153874-1153896 ATATAGTAGTGGAGTGACAGAGG + Intronic
1169373528 20:5047185-5047207 ATATACCAACTGGCTGAAAGAGG - Intergenic
1169979425 20:11366523-11366545 ATTTAGCATCTGACTGAAATAGG + Intergenic
1170421706 20:16199904-16199926 ATGTGGTAGCTGACTGAATCAGG - Intergenic
1173041449 20:39467668-39467690 AGGTAGAAACTGACTGAAAGGGG - Intergenic
1175365330 20:58450349-58450371 ATATAGTAGCAAACAGACAGAGG - Exonic
1175536727 20:59719980-59720002 ATATTGTAGATGCCAGAAAGTGG + Intronic
1178086807 21:29120464-29120486 TTACAGTAGCTGTCTTAAAGGGG + Intronic
1182646624 22:31815257-31815279 ATATAGTGGGTGACTGGAGGTGG + Intronic
949978033 3:9478388-9478410 AAATAGTTGCTGAATGAATGAGG - Intronic
951102587 3:18706350-18706372 ATATAGTATCATACTGAATGGGG + Intergenic
953809572 3:46100499-46100521 AAATAAAAGCTGACTGGAAGGGG - Intergenic
955185001 3:56706622-56706644 ATATAGTATCAGAATGAAAATGG + Intergenic
956474468 3:69605536-69605558 CTATAGTACCTGACTAAAGGAGG - Intergenic
957439216 3:80221407-80221429 ATTAAATAGCTGACTGAAAGTGG - Intergenic
958699825 3:97574294-97574316 ATGTGGTAGTTGAATGAAAGAGG + Intronic
959260950 3:104078779-104078801 ATGTAGTTGCTGTCTTAAAGGGG + Intergenic
959265370 3:104130912-104130934 AAATAGTAGCAAACTGAAAAAGG - Intergenic
960213328 3:114998645-114998667 ATATGGTAGTTAACTGAATGTGG + Intronic
960670060 3:120146994-120147016 ATACGGAAGGTGACTGAAAGAGG + Intergenic
964597469 3:158451807-158451829 ATACAGTAGCTCACCTAAAGTGG - Intronic
965975674 3:174618259-174618281 ATATAGCAACTTACTAAAAGTGG - Intronic
966789785 3:183656529-183656551 ATATGGTAGCTAACTTAAACAGG + Intronic
970940307 4:21624945-21624967 ACAAAGTAGCTGACAGAATGTGG + Intronic
971725653 4:30308266-30308288 ATTTAGTAGCTGACTAGAAGAGG - Intergenic
978183442 4:105830469-105830491 ATCTAGTAGCTTGCTGAAAAGGG - Intronic
980211122 4:129789485-129789507 CTATAATAACTGATTGAAAGAGG - Intergenic
981249296 4:142580111-142580133 ATCTAGTAGCTGACACATAGAGG + Intronic
986071413 5:4288265-4288287 AGATAGCATCTAACTGAAAGAGG + Intergenic
986412670 5:7496491-7496513 ATATAATAGCTGAATGAATTCGG + Intronic
986574521 5:9198374-9198396 ATTTAGTAGCTGGCTGACATTGG - Intronic
988953451 5:36289673-36289695 ATATATTAGCTGACAACAAGTGG - Intronic
989974399 5:50566231-50566253 ACATAGCATCTGACTGAGAGTGG - Intergenic
990227954 5:53677638-53677660 ATATTATATCTGGCTGAAAGCGG - Intronic
990934682 5:61135381-61135403 ATATAGGAGCCAACTGGAAGGGG + Intronic
991023936 5:62009437-62009459 ATATAGTTGGTGGCTGAAAATGG + Intergenic
991613470 5:68471877-68471899 ATATAGTATTTGAGTGAATGTGG - Intergenic
992662679 5:78976897-78976919 AGATGGTAGCTGAGTGAATGAGG - Intronic
992704579 5:79377732-79377754 ATAAAGTAGCTCACTGAAACTGG + Intronic
992846030 5:80748936-80748958 ATATAGTATGCTACTGAAAGTGG - Intronic
996409186 5:123138487-123138509 ATATAGTTGCTGTGTGAAATAGG - Intronic
1000969156 5:167694770-167694792 CTATAGAAGCTCACTGAAACTGG + Intronic
1005688079 6:28274350-28274372 ATAAAGTAGCTGAAAGAAAGGGG + Intronic
1005787267 6:29257322-29257344 ATATAGTATCTCACTGAGAGGGG - Intergenic
1006526888 6:34613965-34613987 CTATAGTAGCAGAAAGAAAGTGG + Intronic
1006703689 6:35998171-35998193 ATAGAGAAGTTGACTGAAATGGG + Intronic
1008780527 6:55098451-55098473 ATAAAGTAGATGAGTAAAAGAGG + Intergenic
1009329346 6:62396940-62396962 AGATAGTATCATACTGAAAGTGG - Intergenic
1009697143 6:67121254-67121276 ATAGTGTAGCTGACTCATAGAGG + Intergenic
1010290165 6:74126958-74126980 AGACAGTAGGTGATTGAAAGAGG - Intergenic
1011173549 6:84534479-84534501 ATACACTGACTGACTGAAAGGGG + Intergenic
1011754244 6:90482995-90483017 ATATCGGTGGTGACTGAAAGAGG - Intergenic
1012010566 6:93779154-93779176 ATTTAGAAGCTGCCTGAAACAGG + Intergenic
1012587072 6:100936521-100936543 ATAGTGTATCTGACTGAAATTGG + Intergenic
1014310684 6:119797329-119797351 ATTTAACAGCTAACTGAAAGTGG - Intergenic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1014838513 6:126188719-126188741 ATATAGTGGCTGACTTAACAAGG - Intergenic
1015447983 6:133330116-133330138 TTGTAGCAGCTGACTAAAAGTGG + Intronic
1015686281 6:135865803-135865825 ATATATGAGGTGATTGAAAGTGG + Intronic
1016805580 6:148208819-148208841 ATATAGAAACTGACTGAATACGG + Intergenic
1017253364 6:152306099-152306121 ATCTAGTAACTGATTGAAATTGG - Intronic
1018273981 6:162110442-162110464 ATGTAGGAGCTGATTTAAAGGGG + Intronic
1018504999 6:164456501-164456523 AAATAGCAGCTGAATGAATGAGG - Intergenic
1021242796 7:18225154-18225176 TTTTACTACCTGACTGAAAGTGG + Intronic
1021553705 7:21898820-21898842 GTGCAGTAGCTGCCTGAAAGTGG - Intronic
1030110952 7:106026559-106026581 ATACAGGGGTTGACTGAAAGAGG - Intronic
1032589519 7:133178582-133178604 TTATAGTAGCTTCCTGAAAATGG - Intergenic
1032980197 7:137273242-137273264 ATATAGTAACTGACTGACTATGG + Intronic
1033024887 7:137762573-137762595 TTATAGTTGCTGCCTGAATGTGG + Intronic
1033952757 7:146805544-146805566 GTAAAGTAGCAGAATGAAAGAGG + Intronic
1038528049 8:28294099-28294121 AGAGAGGAGCTGACTGCAAGGGG - Intergenic
1038964838 8:32560479-32560501 ATTCAGTAACTGACTGAATGAGG + Intronic
1041939686 8:63372986-63373008 AGAGAGTAGCTGACAGAAACTGG - Intergenic
1043359743 8:79458379-79458401 GTAGCCTAGCTGACTGAAAGTGG - Intergenic
1043419645 8:80085550-80085572 ATACAGCAGCTGGCTGGAAGGGG + Intronic
1043994119 8:86791486-86791508 ATTTAATAGCTGAATGTAAGTGG + Intergenic
1046966631 8:120174619-120174641 AGATAGTGCCTGCCTGAAAGTGG - Intronic
1047408434 8:124604612-124604634 ATACAGTAGCTGAATAAAACAGG - Intronic
1047467611 8:125133057-125133079 AGATAGAAGCAGAATGAAAGTGG - Intronic
1048076240 8:131074209-131074231 ATATATTAACTGAGTGACAGTGG + Intergenic
1048079846 8:131114238-131114260 AGATAGTATCTTACTGAATGGGG - Intergenic
1049045258 8:140145544-140145566 ATATAGTAGCAGATTGATTGAGG - Intronic
1050729408 9:8690664-8690686 AGATAGTAGGTAACTGACAGAGG + Intronic
1051217879 9:14818027-14818049 ATATACTAGCTGAATGAACTTGG + Intronic
1051896133 9:21990879-21990901 ATAAAATAGCTGAATGAAAGTGG + Intronic
1051936098 9:22445004-22445026 ATAAAGTAACTTACTAAAAGTGG + Intergenic
1052792001 9:32884066-32884088 GTATAATGGCTGAGTGAAAGGGG - Intergenic
1052999268 9:34568578-34568600 ATATTGTATCTGGGTGAAAGGGG - Intronic
1055698854 9:78918852-78918874 ATCTAGTATATGACAGAAAGAGG + Intergenic
1058735481 9:107890214-107890236 AGATAGTAGTAGACAGAAAGTGG - Intergenic
1061054750 9:128216489-128216511 ATACAGTGGCAGACAGAAAGAGG + Intronic
1188215159 X:27467397-27467419 ATATATTAGAAGACTGAATGTGG - Intergenic
1188657244 X:32713525-32713547 ATATAGTAGCTGAAAGGAAAGGG - Intronic
1189444842 X:41070932-41070954 TTATAGGAGCAGACTAAAAGTGG + Intergenic
1190952358 X:55158947-55158969 ATATAGTATCTCACAGAAAATGG - Intronic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1195336093 X:103856137-103856159 ATATAAGAGCCAACTGAAAGAGG - Intergenic
1195515054 X:105764312-105764334 ATATAATAGATGGATGAAAGGGG + Intronic
1196805987 X:119586607-119586629 ATACAGTAACCAACTGAAAGGGG + Intergenic
1197649671 X:129051038-129051060 ATATAGTAGGTGAGTGAAACAGG - Intergenic
1198177108 X:134167398-134167420 ATAAAGTAGCTCAGTAAAAGAGG - Intergenic