ID: 1092703338

View in Genome Browser
Species Human (GRCh38)
Location 12:11257095-11257117
Sequence TGTCCCAGAGGGGCACCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092703338_1092703342 -10 Left 1092703338 12:11257095-11257117 CCGCTGGGTGCCCCTCTGGGACA No data
Right 1092703342 12:11257108-11257130 CTCTGGGACAAAGCTTCTAGAGG 0: 18
1: 441
2: 1031
3: 3425
4: 2175
1092703338_1092703344 0 Left 1092703338 12:11257095-11257117 CCGCTGGGTGCCCCTCTGGGACA No data
Right 1092703344 12:11257118-11257140 AAGCTTCTAGAGGAAGGAACAGG 0: 13
1: 511
2: 1832
3: 1545
4: 1968
1092703338_1092703343 -6 Left 1092703338 12:11257095-11257117 CCGCTGGGTGCCCCTCTGGGACA No data
Right 1092703343 12:11257112-11257134 GGGACAAAGCTTCTAGAGGAAGG 0: 14
1: 403
2: 864
3: 1364
4: 1344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092703338 Original CRISPR TGTCCCAGAGGGGCACCCAG CGG (reversed) Intergenic
No off target data available for this crispr