ID: 1092708238

View in Genome Browser
Species Human (GRCh38)
Location 12:11308223-11308245
Sequence GTCATTGAATCCTAGATTAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 2, 2: 0, 3: 2, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092708236_1092708238 7 Left 1092708236 12:11308193-11308215 CCTGATGAATAATAAAGTGGAAT 0: 1
1: 0
2: 4
3: 34
4: 389
Right 1092708238 12:11308223-11308245 GTCATTGAATCCTAGATTACTGG 0: 1
1: 2
2: 0
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092708238 Original CRISPR GTCATTGAATCCTAGATTAC TGG Exonic
907234327 1:53031206-53031228 GTCATTGAATACTTCATTACTGG + Intronic
911362717 1:96899463-96899485 GTCATTAAATCCTGATTTACTGG - Intergenic
917153267 1:171966918-171966940 GTCATTGAGTCGTAGTTTTCTGG + Intronic
1066568113 10:36741903-36741925 GTCATTGTTTCCTAGGTTAGGGG + Intergenic
1068260417 10:54573759-54573781 GTGTTTAAATCCTAGATTAAAGG + Intronic
1068602849 10:58973963-58973985 GGCAATTAATCCTAGGTTACTGG - Intergenic
1069296472 10:66851337-66851359 GTGGTTGAATGCCAGATTACTGG - Intronic
1071203342 10:83245858-83245880 GACCTTAAATCCTAGATGACAGG + Intergenic
1078660225 11:13279397-13279419 GTCATTTAATAATAGATTAAAGG - Intronic
1079580854 11:22062667-22062689 CTCATTGAATCCTAGAATGTTGG - Intergenic
1080409434 11:32009884-32009906 GTCATGGAATTCTGGATTCCAGG + Intronic
1081034096 11:38119645-38119667 GTAATTGAATTCAAGATAACAGG + Intergenic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1090555019 11:127864738-127864760 CTCATGGAAACCTACATTACTGG + Intergenic
1092708238 12:11308223-11308245 GTCATTGAATCCTAGATTACTGG + Exonic
1092712383 12:11353076-11353098 GTCATTGAATCCTAGATGACTGG + Exonic
1092716119 12:11392796-11392818 GTCATTGAATCCTAGATGACTGG + Exonic
1094617633 12:32050157-32050179 GTCATAGCATACTGGATTACTGG + Intergenic
1098322267 12:69258078-69258100 GCCATGGAATCCTAGTTTCCAGG - Intronic
1100585928 12:95979186-95979208 GTCATTGATTTCTAGAGAACAGG - Intronic
1102019848 12:109674713-109674735 GACATTGGAACCTAGACTACTGG + Intergenic
1108032380 13:46247131-46247153 GTCATTGCTTCATTGATTACTGG + Intronic
1113434863 13:110283226-110283248 GTCATCGAATCAGAGATTTCAGG + Intronic
1115826712 14:37286515-37286537 ATCATTAAATATTAGATTACTGG - Intronic
1115979788 14:39037751-39037773 CTGATTGAATCCTGGATTAAAGG - Intronic
1119607487 14:76033207-76033229 TTCATAGTATCCTATATTACTGG - Intronic
1120415420 14:84213312-84213334 GTCATTGAACACTATCTTACAGG + Intergenic
1131686244 15:94771178-94771200 GTCATTTAATGCAAGATTCCTGG + Intergenic
1148286402 17:46396748-46396770 GTCATTAAATTCAAGATTTCAGG - Intergenic
1148308568 17:46614340-46614362 GTCATTAAATTCAAGATTTCAGG - Intronic
1151123455 17:71819098-71819120 GGCATTGAATCTTTGATTCCTGG + Intergenic
1156535567 18:37861417-37861439 GTCCTTGAATCCTAGATGTTTGG - Intergenic
1165717289 19:38054613-38054635 GTCTTTGAATCCAAGTTTAGGGG + Intronic
929256148 2:39813587-39813609 GTCAGTGGATCTTAGATTGCTGG + Intergenic
929256587 2:39817545-39817567 GTGATGGGATCCTAAATTACAGG + Intergenic
932553056 2:72791892-72791914 TTCAGTGAATTCAAGATTACAGG - Intronic
936826692 2:116590083-116590105 CTTATAGAATCCCAGATTACCGG - Intergenic
937857744 2:126684767-126684789 GCCATAGAATCCTAGAGTCCTGG + Intronic
938678336 2:133661926-133661948 GGAATTGAATCTTAGTTTACCGG - Intergenic
939329334 2:140737382-140737404 ATCATTGACCCCTATATTACAGG + Intronic
943444474 2:187967089-187967111 GTCATTGAACCCTGAATCACGGG - Intergenic
944433749 2:199664902-199664924 GCCATTGATTCCTAGCCTACTGG - Intergenic
1175626675 20:60494260-60494282 TTCCTGTAATCCTAGATTACTGG - Intergenic
1177280977 21:18982863-18982885 GTCATTACATCATAGCTTACAGG + Intergenic
952450266 3:33425506-33425528 GGCATTGTAGCCTAGATTATTGG - Intronic
956407881 3:68947952-68947974 GTCATTATATTCTAGACTACTGG - Intergenic
960472945 3:118090360-118090382 ATCATAGAATCCTAGCATACCGG + Intergenic
962610437 3:137071765-137071787 GTCATTGAATTATAGAATTCTGG - Intergenic
965361058 3:167738566-167738588 GTCATGGAATCATGGATTATAGG - Intronic
971715863 4:30175927-30175949 GTCATTGTATCATAAATCACGGG + Intergenic
975503029 4:75108555-75108577 TTCTTTCAATCCTAGATTATTGG - Intergenic
976811670 4:89106393-89106415 GTCAATGAATCCCAGATCCCAGG + Intronic
977602597 4:98950307-98950329 GTCATGGAATGCTAAATAACAGG + Intergenic
980313846 4:131170089-131170111 GTCATTGAGTCTTATATTACTGG - Intergenic
984326347 4:178257050-178257072 GTCATTGAGTACTAGATATCTGG + Intergenic
989715229 5:44454833-44454855 GTCCTTGTATCCCTGATTACAGG + Intergenic
993115045 5:83710322-83710344 GTCATTCTTTCCTAGATTTCAGG - Intronic
994350169 5:98736357-98736379 GAAAATGAATCATAGATTACTGG - Intergenic
998752094 5:145333681-145333703 GTCAGTGAATCTTAGCTTGCTGG + Intergenic
998873772 5:146578610-146578632 TTCATTGATTTCTATATTACTGG + Intergenic
999029193 5:148271387-148271409 TTGATTGAATACTACATTACTGG - Intronic
1001876634 5:175207167-175207189 GCCCTTGAATCCAAGATTGCGGG + Intergenic
1006751930 6:36383820-36383842 GTCATGGAATCTAAGATGACAGG + Intronic
1009823326 6:68833767-68833789 ATCATTTAACCCTATATTACAGG + Intronic
1010389104 6:75316877-75316899 GTCATAGAACCATAGATTAGGGG + Intronic
1013867701 6:114718958-114718980 TACATTGATTCCTAGATTAAAGG + Intergenic
1018141032 6:160837499-160837521 GCCCTTGAATCCTACATTAAGGG + Intergenic
1024351753 7:48373238-48373260 GTCAAGGAGACCTAGATTACGGG + Intronic
1024907399 7:54402571-54402593 GTAATTGAAACGTAGATAACTGG - Intergenic
1029909658 7:104131922-104131944 ATAAATGAATCCTAGAATACAGG + Intronic
1029991601 7:104967481-104967503 GTGATTGAATCCCAGCTGACAGG + Intergenic
1033512758 7:142076702-142076724 CTCATTGAATGCTAAATTATTGG - Intronic
1035762042 8:2075872-2075894 GTCATTAGATCCTGAATTACAGG - Intronic
1036828755 8:12002910-12002932 GTGATCAAGTCCTAGATTACTGG + Intergenic
1037104852 8:15094618-15094640 CTCATAGCATCCTAGCTTACTGG - Intronic
1037696206 8:21226287-21226309 CTCATTAAATCCTTGATTCCTGG - Intergenic
1038505166 8:28077944-28077966 GTCACTGAATTCTGGAATACGGG + Intronic
1044893349 8:96861293-96861315 GTCATAAAATTCTAAATTACTGG - Intronic
1055290392 9:74777059-74777081 GTGATTGAAACATAGATGACTGG + Intronic
1059772318 9:117438972-117438994 CTCTTTGGATCCTAGAGTACAGG - Intergenic
1187006950 X:15241500-15241522 TTCAATGAATCCCAGAGTACTGG - Intronic
1194990727 X:100543999-100544021 CTCTTGGAATCCTAGATTCCAGG + Intergenic
1196326947 X:114416901-114416923 GTTATAGAATCTTAGGTTACCGG - Intergenic
1198056666 X:133002517-133002539 ATCATGTAATCCTAGAATACAGG + Intergenic
1198602772 X:138302319-138302341 GGATTTGAATCCTAGGTTACCGG - Intergenic
1201498234 Y:14613204-14613226 GCCATTGGATCTTAGCTTACTGG + Intronic