ID: 1092712041

View in Genome Browser
Species Human (GRCh38)
Location 12:11349189-11349211
Sequence TTCCATCTTCTGTAATTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092712038_1092712041 21 Left 1092712038 12:11349145-11349167 CCTCCTTTGGAAATATCCTATGC 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1092712041 12:11349189-11349211 TTCCATCTTCTGTAATTTAGTGG 0: 1
1: 0
2: 2
3: 33
4: 316
1092712039_1092712041 18 Left 1092712039 12:11349148-11349170 CCTTTGGAAATATCCTATGCTTC 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1092712041 12:11349189-11349211 TTCCATCTTCTGTAATTTAGTGG 0: 1
1: 0
2: 2
3: 33
4: 316
1092712040_1092712041 5 Left 1092712040 12:11349161-11349183 CCTATGCTTCTCTAGATTTCTAA 0: 1
1: 0
2: 6
3: 15
4: 212
Right 1092712041 12:11349189-11349211 TTCCATCTTCTGTAATTTAGTGG 0: 1
1: 0
2: 2
3: 33
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092712041 Original CRISPR TTCCATCTTCTGTAATTTAG TGG Intergenic
900810493 1:4798124-4798146 TTTCATCCTCTGTGATTTATTGG + Intergenic
900922374 1:5681536-5681558 TTCCTTCTTCTCTAATTTCTAGG + Intergenic
902082764 1:13832599-13832621 TTTCATCTCCTCTAAATTAGGGG + Intergenic
902858964 1:19230885-19230907 TTCCATCTTCTTCTATTTGGTGG - Exonic
903854970 1:26331679-26331701 TTCCCTCTTCTGTATCTCAGGGG - Intronic
904653962 1:32028374-32028396 TCCCATCTTCTATAATTTTAAGG - Intronic
905741601 1:40375871-40375893 TTCCATGTGCTGTATTTTATTGG - Intronic
908742756 1:67345270-67345292 TTCCATCTTCTGTGGTTTGAGGG - Intronic
909274412 1:73666262-73666284 ATACATCTTCTGAAATCTAGGGG - Intergenic
909481541 1:76132454-76132476 GTCCTTCATCTCTAATTTAGGGG + Intronic
909947403 1:81679056-81679078 ATCTGTCTTTTGTAATTTAGAGG - Intronic
910395908 1:86793631-86793653 TTCCATCCTCTTGTATTTAGAGG - Intergenic
911840498 1:102675743-102675765 ATACATCTTCTGAAATCTAGGGG + Intergenic
912236734 1:107859615-107859637 TTTAGTTTTCTGTAATTTAGGGG - Intronic
913026762 1:114850975-114850997 TTCCTTCCTATGTAACTTAGTGG + Intergenic
914933647 1:151958821-151958843 TTCCATTTTTAGTAATTCAGTGG - Intergenic
915984254 1:160447842-160447864 TTTCATCTTGTGTAAAGTAGAGG - Intergenic
917098612 1:171424231-171424253 TCCCATCCTCTGTAATTCAGCGG - Intergenic
919322817 1:196064860-196064882 TTCCATCTTTTGGAAAGTAGTGG - Intergenic
919944200 1:202307847-202307869 TTACATCCTATGTAATTTAAAGG - Intronic
920752456 1:208692546-208692568 TGCCAACTTCTGAAATTTTGTGG - Intergenic
920876028 1:209836829-209836851 TTCCAACTTCTGAAACTTAGAGG - Exonic
921795018 1:219332830-219332852 TTCCATCTGGTTTAATTTGGGGG - Intergenic
922649108 1:227321485-227321507 TTCCATCGTCTGTGATATAGAGG - Intergenic
1063067526 10:2624209-2624231 TTCTATTTTCTTTAATTTTGGGG + Intergenic
1063741469 10:8826188-8826210 ATCAATATTCTTTAATTTAGTGG - Intergenic
1065447250 10:25815652-25815674 TTTCATCTTTTGTAAGTTGGAGG + Intergenic
1065887302 10:30090054-30090076 TGCCATCATCTTTAGTTTAGAGG + Intronic
1068091631 10:52439620-52439642 TTCCAGCTTATCAAATTTAGGGG + Intergenic
1068879072 10:62029585-62029607 TTTCCTCATCTGTAAATTAGGGG - Intronic
1069182442 10:65378655-65378677 TTCCATCTTTTAAAATTTTGGGG - Intergenic
1070449133 10:76540418-76540440 TTAAATCTTTTGTATTTTAGAGG - Intronic
1072213721 10:93270719-93270741 TTCCCTCTTCTGTAAGTGAAGGG - Intergenic
1072430297 10:95365334-95365356 TTCCGTCTTGTGCAGTTTAGGGG + Intronic
1072785832 10:98281301-98281323 ATTCATCTTCTTGAATTTAGAGG + Intergenic
1073223561 10:101896764-101896786 CTCCAGCTTCTGTAATTTATAGG - Intronic
1073510176 10:104037931-104037953 TTTCTCCATCTGTAATTTAGGGG - Intronic
1074197301 10:111200759-111200781 CTACATCTTCTGAAATTTAGTGG + Intergenic
1074485624 10:113875332-113875354 TTCCCTGTACTGTAGTTTAGGGG + Intronic
1075032660 10:119035822-119035844 TGCCATTTTCTGGAATTTAAGGG - Exonic
1075543666 10:123337290-123337312 ATACATCTTCTGAAATCTAGTGG + Intergenic
1080151457 11:29056893-29056915 TTCCATCTTCTGAAATCTAGGGG - Intergenic
1080724315 11:34880363-34880385 TTCCAGCTTCTTTAAATAAGAGG - Intronic
1081397973 11:42610145-42610167 CTGCATTTTCTGTGATTTAGTGG - Intergenic
1082717386 11:56630966-56630988 TTCCATATGATGTAATTTATAGG - Intergenic
1086220443 11:84437094-84437116 TTTCATCCTATGTAATTTAAAGG + Intronic
1086535502 11:87839952-87839974 TTTCATCCTCTGTACTTTTGAGG - Intergenic
1089072852 11:115714722-115714744 TTTCCTCTTCTGTAAAGTAGAGG - Intergenic
1089402709 11:118173511-118173533 TTTCCTCATCTGTAATATAGGGG + Intronic
1091002940 11:131925860-131925882 TTCCACCTTTTGTAATTCAGGGG + Intronic
1092702460 12:11247433-11247455 TTCCATCTTCTGTCGTTTAGTGG + Intergenic
1092712041 12:11349189-11349211 TTCCATCTTCTGTAATTTAGTGG + Intergenic
1093189621 12:16059015-16059037 CTCCATTTTCTGTACTCTAGTGG + Intergenic
1093688382 12:22082385-22082407 TTCGATCTTCTGTAACTTGAAGG - Intronic
1093827198 12:23708041-23708063 TTCTATCTTCTCTCATTGAGAGG - Intronic
1094175973 12:27541775-27541797 TTCCATCTCCATTAATTTGGAGG + Intronic
1094782823 12:33812596-33812618 TTTCATCTTCTGAATTTTACAGG - Intergenic
1098580955 12:72098496-72098518 TTGCTGTTTCTGTAATTTAGAGG + Intronic
1099105439 12:78490344-78490366 TTCCATTTTATTTAATTTTGAGG - Intergenic
1099678675 12:85795206-85795228 TTCCGTCTCAGGTAATTTAGAGG + Intergenic
1099796690 12:87409293-87409315 ATACATCTTCTGAAATCTAGTGG - Intergenic
1101532914 12:105590769-105590791 TTGAATCTTCTCTAATTTATGGG + Intergenic
1101674720 12:106907553-106907575 TTTTCTCTTCTGTAAATTAGGGG - Intergenic
1102089861 12:110176914-110176936 TGCTATCCTCTGTAATATAGAGG - Intronic
1103211412 12:119169631-119169653 TTCCTAATTCTGTAATTTTGTGG - Intergenic
1103286810 12:119809504-119809526 TACAATCTTTTGTTATTTAGGGG + Intronic
1106021510 13:25920180-25920202 TTCCCTCTTCTGTAACTTACAGG + Intronic
1106953813 13:34913435-34913457 TTCAATCTCCTGTGATTTAAAGG + Intergenic
1107407754 13:40130508-40130530 TTTCATCACCTGTAAATTAGGGG - Intergenic
1109504164 13:63277566-63277588 TTCCTTCCTCTGTAATTTTTTGG - Intergenic
1110909317 13:80935674-80935696 TTCCCTCTTCTTTAATTTTGTGG + Intergenic
1112781346 13:102904310-102904332 TTCCATTTCTTGTAATCTAGTGG + Intergenic
1114704223 14:24709088-24709110 ATCCATCTGCAGAAATTTAGGGG + Intergenic
1114910369 14:27187121-27187143 TCTCATCTTTTGTAAATTAGTGG - Intergenic
1114921977 14:27343425-27343447 TTACATCCTCTGAAATCTAGGGG - Intergenic
1115881492 14:37924146-37924168 TTCCTTTTTCTGTAAGTTTGAGG - Intronic
1116508527 14:45715202-45715224 TGCCATCTTCTGTTATTTCAGGG - Intergenic
1117018531 14:51545237-51545259 TTCAATGTTCTGTATTTTATGGG - Intronic
1117543393 14:56770450-56770472 TTCCATCTTCTAAACTTTTGTGG - Intergenic
1117815902 14:59597540-59597562 TTCCATGTACTGGAATTCAGTGG + Intronic
1117890222 14:60413278-60413300 TTCCATCCTCTTCAATTTTGGGG - Intronic
1117966159 14:61208938-61208960 TTCCAACTTATGAACTTTAGGGG - Intronic
1120013930 14:79448857-79448879 TTCCAGCTTCTACAATCTAGAGG - Intronic
1120954603 14:90070893-90070915 TTCCAGCTTCTAAAATTTCGTGG + Intronic
1121044385 14:90777368-90777390 TTCTCTCTTCTGTAAATTTGGGG + Intronic
1121672178 14:95719522-95719544 TTCCTTCTTCTGCAATTTTTTGG + Intergenic
1124424361 15:29551151-29551173 TTCCTTCTCCTGAAATGTAGAGG + Intronic
1124499654 15:30216247-30216269 TTTTATCCTCTGTAATTTAGGGG - Intergenic
1124743925 15:32322420-32322442 TTTTATCCTCTGTAATTTAGGGG + Intergenic
1125355144 15:38809718-38809740 TTTAAGCTTCTGAAATTTAGAGG - Intergenic
1126895715 15:53255209-53255231 TTCCATATTCTGTTCTTGAGAGG + Intergenic
1127306659 15:57712595-57712617 TTCCATCTTCTGCAGTACAGGGG + Intronic
1128338696 15:66804846-66804868 TTTCCTTTTCTGTAATATAGAGG + Intergenic
1128855333 15:71006796-71006818 TTTCATCTTCTTTGTTTTAGTGG + Intronic
1131201030 15:90396088-90396110 TGTCACTTTCTGTAATTTAGAGG + Intronic
1131470048 15:92688953-92688975 ATACATCTTCTGAAATCTAGGGG - Intronic
1131675999 15:94671349-94671371 TTCTATTTTCAGTAAATTAGGGG - Intergenic
1132538958 16:498809-498831 TTCCATTTTCTGTCATTTTAGGG + Intronic
1133320027 16:4907714-4907736 TTCCATTTTTTTTAATTGAGGGG - Intronic
1133613852 16:7457491-7457513 TTCTATCTTCTTTACTTAAGTGG + Intronic
1133831971 16:9331661-9331683 TTCTGTCTTCTGCAATTCAGTGG - Intergenic
1135259826 16:20971358-20971380 TTCCATCTTGTGTCATTTCTGGG + Intronic
1135544817 16:23358464-23358486 TTCCCTCCTCTGTAAAATAGGGG + Intronic
1136280761 16:29209531-29209553 TTTAATCTTCTTAAATTTAGTGG - Intergenic
1137272458 16:46911158-46911180 TTTCAACTTCTGGAAATTAGTGG - Intronic
1138853726 16:60661631-60661653 TACCACCTTCTGTTATTTTGAGG + Intergenic
1139941810 16:70610935-70610957 TTCCATCCTTTGTGATTTTGGGG + Intronic
1141216801 16:82032871-82032893 TTTCCTCTTCTGTAAATTGGCGG - Intergenic
1142085120 16:88175452-88175474 TTTAATCTTCTTAAATTTAGTGG - Intergenic
1143315480 17:6028931-6028953 TTTCATCTCCTAGAATTTAGTGG + Intronic
1143354912 17:6319705-6319727 CTCCATATTCTGGTATTTAGGGG + Intergenic
1145739524 17:27261337-27261359 TTCCATCTTCTTGAATCTAGAGG + Intergenic
1146618797 17:34379727-34379749 TTCCATTTACTATAATTCAGGGG - Intergenic
1147384308 17:40072445-40072467 TTCCAGCTTCTGTAAACAAGTGG + Intronic
1148031048 17:44621309-44621331 TTATATCTCCTGTGATTTAGAGG + Intergenic
1148832691 17:50444816-50444838 TTCCATCTTCTGTGACTTTGTGG + Intronic
1148922022 17:51045732-51045754 AGCCATCTTCTGTATTTTAGAGG - Intronic
1149332835 17:55604462-55604484 TTCCCTCTTCAGTACTTCAGAGG + Intergenic
1150830896 17:68518389-68518411 GTACATCTTCTGAAATCTAGGGG + Intronic
1152314034 17:79569657-79569679 TTCCATTTGCTGTTACTTAGCGG + Intergenic
1152320496 17:79606359-79606381 ATCCACCATCTTTAATTTAGGGG - Intergenic
1152529214 17:80907277-80907299 CTCCATCTTCTTTATTTTTGGGG - Intronic
1155260677 18:24039145-24039167 TTTCATCATCTGTAAAGTAGGGG - Intronic
1156777920 18:40816094-40816116 TTCCATGTTATCCAATTTAGAGG - Intergenic
1156878046 18:42040208-42040230 TTCCATCTTCTGTCATTTCCTGG - Intronic
1156972409 18:43172340-43172362 TTCAAAATTTTGTAATTTAGGGG - Intergenic
1157497016 18:48163304-48163326 TTCCCTCATCTGTAAAATAGTGG + Intronic
1158855924 18:61543221-61543243 TTTCTTCATCTGTAAATTAGGGG - Intronic
1159201884 18:65197133-65197155 TTCTATCTTCTGAAATTTTAAGG + Intergenic
1159495957 18:69205000-69205022 TTACTTCTTCTGCATTTTAGAGG + Intergenic
1159593008 18:70355153-70355175 TTCCACTTTCTGTCATTTAGTGG - Intergenic
1160130370 18:76219797-76219819 TGCCATCTTCTATTTTTTAGTGG - Intergenic
1160469872 18:79121033-79121055 TTCCCTTATCTGTAAATTAGAGG + Intronic
1164289301 19:23852936-23852958 ATCCAGCTTCTGTAACTCAGCGG + Intergenic
1166020449 19:40024170-40024192 TTGCATCATCTGAATTTTAGAGG + Intergenic
1166164223 19:40975829-40975851 TTCCATCTTCTGTACTGGAGTGG + Intergenic
1166186610 19:41143540-41143562 TTCCATCTTCTGTACTGGAGTGG - Intergenic
1168392124 19:56018044-56018066 TCCCATCTTCTGTATTTCTGTGG + Intronic
1168458669 19:56536330-56536352 TTTCATGTTCTGGAATGTAGAGG - Intergenic
925272145 2:2618921-2618943 TTTCATCTTCCTTAGTTTAGTGG - Intergenic
925523460 2:4773913-4773935 TTCTAGCTTCTGTTATTTACTGG - Intergenic
925862472 2:8193333-8193355 GGCCATGTTCTGGAATTTAGTGG - Intergenic
926952133 2:18254198-18254220 ATACATCTTCTGAAATCTAGGGG - Intronic
927195434 2:20543207-20543229 TTCCATCATCTGTGAATTGGAGG - Intergenic
927304470 2:21554805-21554827 TCCCATTTTCTCTAATTCAGTGG + Intergenic
929172501 2:38945849-38945871 TTCCTTCGTCTGTAAGGTAGGGG - Intronic
930257832 2:49111955-49111977 TTCCCTCTTCTATAAATTACGGG - Intronic
932254417 2:70272033-70272055 TGCCATTTTCTGGAATTTAAGGG - Intronic
936657011 2:114500051-114500073 TTCCCTCTTCTGTGTTTCAGAGG + Intronic
938209103 2:129450563-129450585 TTACTTCTTCTTGAATTTAGGGG - Intergenic
938278383 2:130048229-130048251 TTCTACCATCTGTAATTGAGGGG - Intergenic
938940985 2:136169461-136169483 TTCCATCTTCTGGTAATTAAAGG + Intergenic
939353021 2:141065711-141065733 TTCCTTTTTGTGTAATTTTGGGG - Intronic
939624717 2:144462630-144462652 TTCCATTTTCTTTAATTTTTTGG - Intronic
940607440 2:155944634-155944656 TTTCATTATCTGTAAATTAGAGG + Intergenic
941352179 2:164450406-164450428 TTCCATCTTTTGAGATTTAATGG + Intergenic
943518099 2:188911506-188911528 TTCCCTCTTTTGTAAATGAGAGG - Intergenic
943802419 2:192078232-192078254 TTCCATCATCTGTAATATGAGGG + Intronic
943983238 2:194583573-194583595 TTCCCTCTCCTGTAATTTCAGGG + Intergenic
944479390 2:200140190-200140212 TTTTATCTTCTGTAAAGTAGAGG + Intergenic
945128547 2:206540587-206540609 TTCCATCTCCTGAAATTTTATGG - Intronic
945601387 2:211869754-211869776 TTGCATCTTCTCTAATAGAGTGG + Intronic
945640490 2:212421653-212421675 TTCCATCTTCTTCCACTTAGTGG - Intronic
946910924 2:224459772-224459794 TTTTATCTCCTGTAATTTAGAGG + Intergenic
948173017 2:235921006-235921028 TTCCATCTTCTTTTAGTTACTGG + Intronic
1168853888 20:995387-995409 TTCCCTCTTCTGTAAGCTGGCGG + Intronic
1168856149 20:1010608-1010630 TTTCCTCTTCTGTAAACTAGGGG - Intergenic
1170621003 20:17995893-17995915 TTTCCTCATCTGTAATTTGGGGG + Intronic
1171516873 20:25745352-25745374 TTCCATCTTCTGGACTCTATGGG + Intergenic
1172820897 20:37733281-37733303 TTCCATATTATGTACTGTAGGGG + Intronic
1174185341 20:48702423-48702445 GTCCCTCTTCTGTGATTTTGGGG + Intronic
1177429970 21:20979580-20979602 TTCCCTCTTCTTTAATTTTTTGG + Intergenic
1177464825 21:21463189-21463211 TTAAATCATCTGTAATTTACTGG - Intronic
1178012133 21:28300889-28300911 TCCCATGTCCTGTATTTTAGTGG - Intergenic
1179357396 21:40673292-40673314 TTCCATTTTTTGTATTTTGGGGG - Intronic
1179386109 21:40943875-40943897 TTACACCTTCTGGAATTTTGTGG - Intergenic
1182167215 22:28188275-28188297 TTCCATCTTCCAAAATTTTGTGG - Intronic
1182855449 22:33513281-33513303 GTCAATCTTCAGTAATTTAAGGG + Intronic
1184054748 22:42038040-42038062 TTCCTTGTTCTGTATCTTAGAGG + Intronic
949802994 3:7923548-7923570 TTTCTTCTTCTGTATATTAGAGG + Intergenic
951419952 3:22472267-22472289 TTCCAACATATGAAATTTAGGGG + Intergenic
951563729 3:23992182-23992204 TTCAGTCTTCTGTTATTTTGAGG - Intergenic
953525832 3:43689596-43689618 TGGTGTCTTCTGTAATTTAGAGG - Intronic
953565538 3:44028881-44028903 TTCCATCTTCTCTGGCTTAGAGG - Intergenic
955503077 3:59604396-59604418 TTCCCTCTTTAGTAATATAGGGG + Intergenic
956055417 3:65293449-65293471 TTTCCTCTTCTTTAGTTTAGGGG + Intergenic
956106572 3:65825020-65825042 TTCCCTCTTCTTTACTTTATGGG - Intronic
956490444 3:69766066-69766088 TTCCATTTTCTTATATTTAGTGG - Intronic
957806992 3:85160825-85160847 TTCCATCTTATGGGATGTAGAGG + Intronic
958139502 3:89543221-89543243 TTACAGCTTCTTTAATTAAGGGG + Intergenic
958671084 3:97205346-97205368 TTCTATCTTATGTAATTGAAAGG - Intronic
958711956 3:97727654-97727676 TTCCACCTTCTATAATACAGAGG + Intronic
958752490 3:98208814-98208836 TTCCCTCTTTTGCAATTAAGTGG - Intergenic
959364312 3:105437204-105437226 TTTCATCCTCTGTAATTTTGAGG + Intronic
959710399 3:109380171-109380193 TTGCATATTCTATAATTTATAGG + Intergenic
959754730 3:109883747-109883769 ATACATCTTCTGAAATCTAGGGG + Intergenic
959915863 3:111816083-111816105 ATACATCTTCTGAAATCTAGGGG - Intronic
960385807 3:117020542-117020564 TTCCTTCCTCTATAATTTGGGGG - Intronic
961592976 3:127994582-127994604 TTGCCTCTTCTGTCATTGAGAGG - Intergenic
961615812 3:128179996-128180018 TTCCCTCCTCTGTGTTTTAGTGG - Intronic
963815663 3:149828195-149828217 TTCCATTTTCCCTATTTTAGGGG - Intronic
964759711 3:160123293-160123315 TTTCCTCATCTGTAATCTAGAGG + Intergenic
965610368 3:170537225-170537247 TTCCAGCCTCTAGAATTTAGAGG + Intronic
967844720 3:194034660-194034682 TTTCTTCTTCTGTAATGCAGTGG - Intergenic
969136408 4:5032828-5032850 TTCTATTTTCTGTCCTTTAGAGG + Intergenic
969208659 4:5669301-5669323 TTCAATCTTCTGTAATCCTGTGG + Intronic
970133888 4:12901000-12901022 ATATATCTTCTGGAATTTAGAGG - Intergenic
971670608 4:29551347-29551369 TTGCAACTTGTGCAATTTAGAGG - Intergenic
973665332 4:53153273-53153295 ATACATCTTCTGAAATCTAGGGG + Intronic
974081517 4:57218629-57218651 TTCCCTAGTTTGTAATTTAGGGG + Intergenic
974420887 4:61671915-61671937 TTCCATCTTCTGTAAAATTGAGG + Intronic
975052560 4:69883740-69883762 ATACATCTTCTGAAATCTAGGGG + Intergenic
975068386 4:70099164-70099186 TTGCATCTTCTATAATTTTTTGG - Intergenic
975327401 4:73075149-73075171 TTCAATTTTCAGTAATTTAGTGG - Exonic
976337326 4:83905401-83905423 TTCCACCTTATGTGATTTTGGGG + Intergenic
976410403 4:84706766-84706788 TTCCCTCTCTTGTAATTTAGTGG - Intronic
978583140 4:110252248-110252270 ATCCATCTTCTAAAATTTATAGG + Intergenic
978726445 4:111975312-111975334 TTCAATTTTCTTTAATTTATTGG + Intergenic
979533135 4:121790374-121790396 TTGCATTTTTTGGAATTTAGGGG - Intergenic
980664838 4:135918089-135918111 TTCAAGTTTCTGTAGTTTAGAGG - Intergenic
982596123 4:157386137-157386159 TGCCATCTTCTGGAATTTAAGGG - Intergenic
983564455 4:169134577-169134599 TTCCATTTTCTGTTAGTGAGTGG + Intronic
985341359 4:188957816-188957838 TTCCTTTTTCTGCAATTCAGTGG - Intergenic
985582924 5:709216-709238 ATACATCCTCTGTAATCTAGGGG - Intergenic
987368146 5:17168516-17168538 TTGTATCTCCAGTAATTTAGTGG + Intronic
987508632 5:18806565-18806587 TTCCATGTCCTGTAATAAAGTGG + Intergenic
987933154 5:24428294-24428316 TGCCATCTTTTATAATGTAGTGG - Intergenic
987959241 5:24783518-24783540 TTTCATTTTATGTAATTTAATGG - Intergenic
990117991 5:52412961-52412983 TTCAATTTTCAGTAGTTTAGTGG + Intergenic
991119428 5:62994163-62994185 ATACATCTTCTGAAATCTAGGGG + Intergenic
991527845 5:67582134-67582156 TTTCATCTCCACTAATTTAGGGG - Intergenic
991700098 5:69309525-69309547 ATACATCTTCTGAAATCTAGTGG - Intronic
991945540 5:71895224-71895246 TTTCCTCTTCTGTAAATGAGTGG - Intergenic
991987960 5:72308939-72308961 TACCATCATCTCTAATTTATAGG + Intronic
993221553 5:85104699-85104721 TTCTATCTTTTATAATTAAGGGG - Intergenic
993222022 5:85111222-85111244 TTCCATTTTCTATAGTTTTGAGG + Intergenic
994691469 5:103025176-103025198 TTGCATCTTCTGCAATTCTGAGG - Exonic
994722707 5:103399591-103399613 TTCCATCCTCTGTTCTTTAGTGG + Intergenic
994730956 5:103490178-103490200 CTCCATCTTCTAAAATTTATAGG - Intergenic
994829673 5:104763279-104763301 TTCCATTCTCTGTTACTTAGAGG - Intergenic
995705180 5:114981394-114981416 TCACACTTTCTGTAATTTAGGGG + Intergenic
997575867 5:134976749-134976771 GTACATCTTCTGAAATCTAGGGG + Intronic
1000531455 5:162426456-162426478 TTTGATCTTCAGTAATTTACTGG - Intergenic
1001672175 5:173482815-173482837 ATCCATCCTCTATAATTTTGGGG + Intergenic
1002409521 5:179062534-179062556 TTCCATCTTCTGGGAGTTCGTGG + Intronic
1003826381 6:9957269-9957291 TTCCAATTTCTTTAATTTAGAGG - Intronic
1004984455 6:21065323-21065345 CTCCATATTTTGTAATTTAAGGG - Intronic
1007183471 6:39947755-39947777 TTCCTTCTTTTGTAATGCAGAGG - Intergenic
1008146349 6:47896181-47896203 TTTCATTTTCTGTACTGTAGTGG + Intronic
1008394756 6:50993509-50993531 TTCTCTCTTCTGTACTTTCGTGG - Intergenic
1008823238 6:55659180-55659202 TTCCAGCTTATGCAATTGAGTGG + Intergenic
1009654663 6:66525914-66525936 TTGCATTTTCTATAATTTAAAGG + Intergenic
1010012089 6:71059863-71059885 TTCCATCTTATGGAATTATGAGG + Intergenic
1010112016 6:72248024-72248046 TTCCATCTTCTGAGATTCAAAGG - Exonic
1010264801 6:73853878-73853900 TTTCTTCTTTTGTAATTTAGAGG + Intergenic
1010734921 6:79433374-79433396 TTCCATATTCTGTATTCTGGGGG + Intergenic
1012272530 6:97232077-97232099 TTCCCTTTTCTGTAAATTGGTGG + Intronic
1012384700 6:98666278-98666300 TTTCATCATCTGTAAAATAGGGG - Intergenic
1012417975 6:99030584-99030606 TTCCATCACCTGTGATTTTGAGG - Intergenic
1012504992 6:99934913-99934935 TTTCTTCTTCTGTAATGTAAGGG - Intronic
1012855521 6:104496824-104496846 TTTCATCTTCTGTACTTTCTTGG - Intergenic
1013332744 6:109121969-109121991 TTCTATCTACTGTATTTCAGTGG + Intronic
1013817019 6:114110799-114110821 TTGCATATTCTATAATGTAGTGG + Intronic
1013975175 6:116069190-116069212 TTCTATTTTCTGTTATTTTGGGG - Intergenic
1014034361 6:116747774-116747796 ATCCATCTTCTGTCATTCATTGG - Intergenic
1014200128 6:118600204-118600226 TTCCATATTCTGTTCTTTGGAGG - Intronic
1016334076 6:142984858-142984880 TTCTATTTTCTGTAGTTTATAGG + Intergenic
1016420012 6:143873576-143873598 ATACATCTTCTGAAATCTAGGGG + Intronic
1016684075 6:146861941-146861963 ATCCATCTTTTGAAATATAGGGG + Intergenic
1016837888 6:148497380-148497402 TTCCTTCTTGTGTAACTTTGTGG - Intronic
1017239557 6:152151927-152151949 ATGCCTCATCTGTAATTTAGAGG - Intronic
1017471613 6:154742961-154742983 TTCCATCTCCTGGGATATAGTGG + Intronic
1018266291 6:162028269-162028291 TTCTATCTTCTATAATGTGGAGG + Intronic
1018346164 6:162901123-162901145 ATCCATTTTCTGGTATTTAGAGG + Intronic
1018566866 6:165163513-165163535 ATACATCTTCTGAAATCTAGAGG + Intergenic
1020481401 7:8666566-8666588 TTCCAATTTCTTTAATTTATTGG + Intronic
1020683115 7:11261149-11261171 TTCAAACTTGTTTAATTTAGAGG + Intergenic
1021107691 7:16657552-16657574 TTACATCTTATGCAATTTAGTGG - Intronic
1021802542 7:24321788-24321810 ATCCATTTACTGTAATTTAGTGG - Intergenic
1021957812 7:25843734-25843756 TTCCATCCTATGGAATTTGGTGG - Intergenic
1022235937 7:28460393-28460415 TTTCCTCATCTGTAAATTAGGGG - Intronic
1023528272 7:41127980-41128002 TTCTCTCTTCTATAATATAGGGG + Intergenic
1024374879 7:48625934-48625956 TTTCATCATCTCTAATTAAGTGG - Intronic
1024705312 7:51951708-51951730 TTTTATTTTCTGTAATTTAAAGG - Intergenic
1028326908 7:89539567-89539589 GTCCATCTCCTGGCATTTAGAGG - Intergenic
1028619946 7:92814307-92814329 TTCCACATTCCTTAATTTAGAGG - Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1029645640 7:101854045-101854067 TTCCAGCTTCTGAGATTTTGGGG + Intronic
1030915490 7:115307048-115307070 TGCCATCTTATGTAATATAAGGG + Intergenic
1031653294 7:124319079-124319101 TTCAATCTTCTGTATTTTTTTGG - Intergenic
1031813933 7:126408482-126408504 TTACATCTTCTGTGATTTTTAGG + Intergenic
1033274480 7:139960908-139960930 TTCCATTTTCTGAAGTTTATGGG - Intronic
1036034963 8:5008602-5008624 TTGCATCTTGTCTAAGTTAGAGG - Intergenic
1036958119 8:13213445-13213467 TTCAAGATTCTGTAATTTATGGG - Intronic
1037288865 8:17329893-17329915 TTCCATCTTCTGTACATAATTGG - Intronic
1038346723 8:26739595-26739617 TTTCTTCATCTGTAAATTAGAGG + Intergenic
1038837869 8:31148472-31148494 TTTCAAATTCTGTAACTTAGAGG - Intronic
1038949131 8:32394557-32394579 TTCCTTCTTTTGGAATTTGGGGG + Intronic
1039870252 8:41539969-41539991 GTCCACCTTCTGTAAGTTAGGGG - Exonic
1039985442 8:42443804-42443826 TTCCATATTCTTAAATTTAATGG + Intronic
1042418246 8:68552638-68552660 ATCCTTGTACTGTAATTTAGGGG + Intronic
1043406297 8:79937538-79937560 TTCAACCTTCTGAAAATTAGAGG - Intronic
1045334030 8:101182261-101182283 TTTCATCATCTGTAAAGTAGGGG - Intronic
1045438918 8:102190816-102190838 ATACATCTTCTGAAATCTAGGGG + Intergenic
1045580131 8:103469643-103469665 TTCCATCTTCTTCAATTTTTTGG + Intergenic
1045599793 8:103699693-103699715 TTTCTTCTTTTGTAAATTAGGGG + Intronic
1045766488 8:105677552-105677574 TTCCATGATCTGTATTGTAGAGG + Intronic
1046459504 8:114514803-114514825 TTCTCTCTTCTGTAATTTTTTGG - Intergenic
1046690375 8:117277374-117277396 TTCCATCTTCTATCATTTTCTGG - Intergenic
1047090727 8:121572849-121572871 TTCCTTATTATGTAATTTTGGGG + Intergenic
1047639808 8:126806017-126806039 TTCCCTCTTCTGTTATTTTTTGG + Intergenic
1048516168 8:135113665-135113687 ATACATCTTCTGAAATCTAGGGG - Intergenic
1048606463 8:135973692-135973714 TCCCATCTTCTGTCTTTTACCGG + Intergenic
1049173312 8:141175438-141175460 TTCCACCTTCAGAAATATAGAGG + Exonic
1050296298 9:4208771-4208793 TTCCATCTCCAGGCATTTAGAGG - Intronic
1051476738 9:17516963-17516985 TTCCATCTCCTGGAATGCAGTGG + Intergenic
1052418747 9:28213379-28213401 TTTCATTTTCTGTATTTTTGTGG - Intronic
1054852462 9:69862202-69862224 TTCTATCTTATTTGATTTAGGGG + Intronic
1055628304 9:78196650-78196672 TACCATCTGCTGAAATCTAGAGG - Intergenic
1057497634 9:95573432-95573454 TTCCCTCTTCTGTAAAATATGGG - Intergenic
1058094012 9:100838404-100838426 TTTCTTCTTCTGTATTTTAAAGG + Intergenic
1058136382 9:101312559-101312581 TTCAGTCTTTTGTAATCTAGTGG - Intronic
1058257036 9:102779419-102779441 TTCCTTCCTCTGTAAGTTACAGG + Intergenic
1058537048 9:105972441-105972463 TTGTTTCTCCTGTAATTTAGAGG + Intergenic
1059549017 9:115208789-115208811 TTCCATCTTCATTAAGTTAGTGG + Intronic
1059642049 9:116226946-116226968 TTCCTTCTTCTGAAAATAAGAGG - Intronic
1059660428 9:116394674-116394696 TTCCATCCTCTGTGACTTTGTGG - Intronic
1059739659 9:117137307-117137329 TTCCATCTTCTGGAAACTAGTGG + Intronic
1060436414 9:123596878-123596900 TTTCATCATCTGTAAAATAGGGG + Intronic
1062641987 9:137523475-137523497 TTCCATCTTCTAGAAATTGGTGG + Intronic
1185940004 X:4307116-4307138 TTCCATCTGCTAAAATTTTGAGG + Intergenic
1185992354 X:4905739-4905761 TTGCATCATCTAAAATTTAGGGG + Intergenic
1187393757 X:18902990-18903012 TTCTAGCTTCTGTAGTTCAGTGG - Intronic
1188215999 X:27477720-27477742 CTGCATCTACTGTATTTTAGGGG + Intergenic
1188533227 X:31165164-31165186 TTCCAGCTACTTTAATTCAGTGG + Intronic
1188963858 X:36526795-36526817 TTCCTTCTGCTGAAATTGAGGGG - Intergenic
1190137473 X:47809677-47809699 ATCCATCTTCTGTAATTTTCAGG + Intergenic
1192609541 X:72554056-72554078 TTACATTTGCTGTAATTTTGGGG + Intronic
1193995319 X:88359810-88359832 TTCCAACTTATCTATTTTAGGGG - Intergenic
1194065281 X:89253350-89253372 TTCCATCTGCTGTTCTTAAGTGG - Intergenic
1194077077 X:89409377-89409399 ATTCATCTTCTGTAATTTAAGGG + Intergenic
1194345987 X:92766355-92766377 TTCCATCTCTTGCAGTTTAGTGG + Intergenic
1194868985 X:99103734-99103756 TTCCCTCTTCTTTAAATAAGAGG + Intergenic
1196326161 X:114405775-114405797 TTCAATCTTCTGGAATGTATTGG + Intergenic
1197324251 X:125072398-125072420 TGCCATCTACTGTAATTTGTCGG + Intergenic
1197433678 X:126398614-126398636 TTCTATCATCTGTAAACTAGGGG + Intergenic
1200429722 Y:3064912-3064934 ATTCATTTTCTGTAATTTAAGGG + Intergenic
1200654332 Y:5883004-5883026 TTCCATCTCATGCAGTTTAGTGG + Intergenic
1201558881 Y:15293597-15293619 TTGTTTCTTCTGGAATTTAGAGG - Intergenic
1201723292 Y:17127658-17127680 TTCCATCTGCTAGAATTTTGAGG + Intergenic
1201914661 Y:19169345-19169367 TTCAATATTCTGTAATTAATTGG + Intergenic
1202088365 Y:21162859-21162881 TTCTATCTTTTGTAATTTCCTGG + Intergenic