ID: 1092712516

View in Genome Browser
Species Human (GRCh38)
Location 12:11353537-11353559
Sequence TTCTTGCCTCCTTGTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 8, 2: 16, 3: 40, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092712508_1092712516 1 Left 1092712508 12:11353513-11353535 CCTGGAGGTGGGGGACCCTGAGG 0: 1
1: 10
2: 3
3: 48
4: 484
Right 1092712516 12:11353537-11353559 TTCTTGCCTCCTTGTGGGGGTGG 0: 1
1: 8
2: 16
3: 40
4: 293
1092712503_1092712516 13 Left 1092712503 12:11353501-11353523 CCTTGTGGCTTTCCTGGAGGTGG 0: 9
1: 12
2: 18
3: 57
4: 318
Right 1092712516 12:11353537-11353559 TTCTTGCCTCCTTGTGGGGGTGG 0: 1
1: 8
2: 16
3: 40
4: 293
1092712499_1092712516 28 Left 1092712499 12:11353486-11353508 CCTTGTGGGGGTGGTCCTTGTGG 0: 26
1: 19
2: 7
3: 17
4: 192
Right 1092712516 12:11353537-11353559 TTCTTGCCTCCTTGTGGGGGTGG 0: 1
1: 8
2: 16
3: 40
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092712516 Original CRISPR TTCTTGCCTCCTTGTGGGGG TGG Intronic
901144237 1:7054264-7054286 TCCTTCCTTCCTTGTGGGGGAGG - Intronic
902579899 1:17401779-17401801 TGCTGGCCTGCTTGTGTGGGGGG + Intergenic
902603198 1:17554055-17554077 TAGGTGCTTCCTTGTGGGGGTGG + Intronic
903259502 1:22123791-22123813 TTCTTGGCTCCATATGTGGGAGG - Intronic
903409432 1:23128758-23128780 CCCTGGCCTCATTGTGGGGGAGG + Intronic
904192336 1:28755434-28755456 TTCTTGTATCCTTGTGAGGTAGG + Intronic
904254067 1:29243518-29243540 TTCTCACCTCGTGGTGGGGGTGG + Intronic
905003567 1:34692947-34692969 ATTTTACCACCTTGTGGGGGAGG - Intergenic
905201611 1:36320400-36320422 TTGTAGCCTCTTCGTGGGGGTGG - Exonic
905769862 1:40630593-40630615 TCCTGACCTCCTTGTGGGGAAGG + Intronic
907362990 1:53935604-53935626 TTCTGGCCTTTTTTTGGGGGTGG - Intronic
908356699 1:63329816-63329838 TTCTTGCCTCGTGATGTGGGAGG + Intergenic
909346914 1:74600890-74600912 TTCTGGCTTCTCTGTGGGGGAGG + Intronic
909599224 1:77443529-77443551 TTCTTTCCTTCTTGAGAGGGAGG + Intronic
910909056 1:92214664-92214686 TTCCTGCCGCCCTGTGGGGGAGG + Intergenic
912928162 1:113930782-113930804 TTCTTTCCTACTTGGGGAGGGGG + Intronic
913374297 1:118133534-118133556 TTCTTGCCTCCTTGTACCAGTGG - Intronic
915601569 1:156925727-156925749 TTCTTGCTTCATGGTGGCGGGGG + Intronic
915665557 1:157441093-157441115 TTCTTTCCTCCTTGTGAAGTAGG - Intergenic
916831597 1:168497847-168497869 GTCTTGCACCCTTGTGGGGCTGG - Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
919611786 1:199754290-199754312 TTCTTGAATCCTTGTTGTGGTGG - Intergenic
920498234 1:206470494-206470516 TCCCTGCCTCCTTGTGGCGGTGG - Exonic
923210775 1:231802354-231802376 TTCTTGCCACCTTGTGAAGAAGG + Intronic
923805793 1:237256490-237256512 TTCTTGCCTGCATCTGGGGCTGG + Intronic
924651251 1:245929439-245929461 TTCTTGCCTCCTTGAGTGAAAGG + Intronic
1063441879 10:6079392-6079414 TTCCTTCCTCCTGGTGGGGAGGG - Intergenic
1063930656 10:11025482-11025504 TTCTTGCCACCTTGTGAGGGAGG + Intronic
1067689696 10:48493809-48493831 TTCTTGACTCCCTGAGGTGGGGG + Intronic
1068458060 10:57285921-57285943 TTCCAACCTCCTTGTGGGGCAGG - Intergenic
1069582795 10:69576843-69576865 TTCCTGCCTTCTTGTCGGCGGGG + Intergenic
1069727855 10:70592808-70592830 TTCTGGCCTCCTGATGGGGCAGG + Intergenic
1069873031 10:71544675-71544697 TTCATGCCTGATTGTGGGAGGGG - Intronic
1069913994 10:71775986-71776008 TTCCAGCCTCCCTGTTGGGGAGG + Intronic
1070626721 10:78056071-78056093 TTCTTCTCTCTTTGTAGGGGAGG + Exonic
1071423001 10:85520065-85520087 TTCTTGCTTTTTTTTGGGGGGGG + Intergenic
1072001532 10:91200127-91200149 TTTTTGCCTCACTGTGGGAGAGG + Intronic
1073372303 10:103001502-103001524 ATCTGGCATCCTTGTGGGGCTGG - Intronic
1073384982 10:103118900-103118922 TTCTACCCTATTTGTGGGGGAGG + Intronic
1073888573 10:108070223-108070245 TTCCTTCCTTCTTGTGAGGGTGG + Intergenic
1074222546 10:111452464-111452486 TTCTTGTCTCCCTGTCCGGGTGG + Intergenic
1074260796 10:111851424-111851446 TGTTTGCATCCTTGCGGGGGGGG - Intergenic
1074477210 10:113784292-113784314 TCTTTGCCTCATTGAGGGGGTGG - Intergenic
1075378391 10:121997934-121997956 TTCGTGCCTGCCTTTGGGGGTGG - Intronic
1075549904 10:123384468-123384490 ATCTTGCTTCTTTGTAGGGGTGG + Intergenic
1075777641 10:124998683-124998705 CCCTTGCATCCGTGTGGGGGTGG - Intronic
1079802578 11:24888874-24888896 TTCCTGCCTCCTTGTGAAGAAGG + Intronic
1080623017 11:34003249-34003271 TTCCTGCCACCTTGTGAAGGAGG + Intergenic
1081628889 11:44673942-44673964 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1081872145 11:46388052-46388074 CTCTTCCCTCCATGTGAGGGAGG + Intergenic
1085033679 11:73287720-73287742 TGTTTGTCTCCTTGTGGGAGAGG - Intronic
1085197006 11:74678865-74678887 TGCTTGACTCCATTTGGGGGTGG - Intergenic
1087509142 11:99068024-99068046 TTCTTGCCACCTTGTGAAGAAGG + Intronic
1087582690 11:100079000-100079022 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1089850086 11:121488178-121488200 CTCTTACCTGCTTGTTGGGGTGG - Exonic
1092139500 12:6173108-6173130 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1092672776 12:10882497-10882519 TGCTGGCCTCCTTGTTGGGGTGG + Exonic
1092672792 12:10882560-10882582 TGCTGGCCTCCTTGTTGGGGTGG + Exonic
1092676918 12:10930778-10930800 TGCTGGCCTCCTTGTTGGGGTGG - Exonic
1092704278 12:11267296-11267318 GGATTGCCTCCTGGTGGGGGTGG + Exonic
1092704296 12:11267356-11267378 TTGTTACCTTCTTGTGGGGGTGG + Exonic
1092704310 12:11267419-11267441 TTGTTGCCTCCTTGTGAAGGTGG + Exonic
1092704330 12:11267482-11267504 TGGTTTCCTCCTTGTGGGGGTGG + Exonic
1092704348 12:11267545-11267567 TTGTTGCCTCCTTGTGGGGGTGG + Exonic
1092704369 12:11267608-11267630 TGGTTTCCTCCTTGTGGGGGTGG + Exonic
1092704390 12:11267671-11267693 TGGTTTCCTCCTTGTGGGGGTGG + Exonic
1092704411 12:11267734-11267756 TGGTTTCCTCCTTGTGGGGGTGG + Exonic
1092704432 12:11267797-11267819 TGGTTTCCTCCTTGTGGGGGTGG + Exonic
1092704453 12:11267860-11267882 TGGTTTCCTCCTTGTGGGGGTGG + Exonic
1092704494 12:11267986-11268008 TGGTTTCCTCCTTGTGGGGGTGG + Exonic
1092708297 12:11308405-11308427 TTGTTGCCTTCTTGTTGGGGTGG + Exonic
1092708312 12:11308468-11308490 TTGTTTCCTTCCTGTGGGGGTGG + Exonic
1092708332 12:11308531-11308553 TGGTTACCTCCTTGTGGGGGTGG + Exonic
1092708352 12:11308594-11308616 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1092708371 12:11308657-11308679 TGGTTTCCTCCTTGTGGGGGTGG + Exonic
1092708410 12:11308783-11308805 TGGTTTCCTCCTTGTGGGGGTGG + Exonic
1092712429 12:11353231-11353253 TTGTTGCCTTCTTGTTGGGGTGG + Exonic
1092712442 12:11353294-11353316 TTGCTGCCTCCTTGTGCGGGTGG + Exonic
1092712460 12:11353354-11353376 TTGTTGCCTCCTTGTGGGGGTGG + Exonic
1092712482 12:11353417-11353439 TGGTTGCCTCCTTGTGGGGGTGG + Intronic
1092712498 12:11353477-11353499 GACTTGTCTCCTTGTGGGGGTGG + Intronic
1092712516 12:11353537-11353559 TTCTTGCCTCCTTGTGGGGGTGG + Intronic
1092712538 12:11353600-11353622 TGGTTACCTCCTTGTGGGGGTGG + Intronic
1092712554 12:11353660-11353682 GACTTGTCTCCTTGTGGGGGTGG + Intronic
1092712571 12:11353720-11353742 CTGTTGCCTCCTTGTGGGGGTGG + Intronic
1092712593 12:11353783-11353805 TGGTTACCTCCTTGTGGGGGTGG + Exonic
1092712610 12:11353843-11353865 GACTTGTCCCCTTGTGGGGGTGG + Exonic
1092712629 12:11353903-11353925 TTGTTGCCTCCTTGTGGGGGTGG + Exonic
1092712651 12:11353966-11353988 TTGTTGCCTCCTTGTGGGGATGG + Exonic
1092716165 12:11392951-11392973 TTGTTGCCTTCTTGTTGGGGTGG + Exonic
1092716180 12:11393014-11393036 TTGCTGCCTCCTTGTGGGGGTGG + Exonic
1092716198 12:11393074-11393096 TTGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716218 12:11393137-11393159 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716232 12:11393200-11393222 TTGCTGCCTCCTTGTGGGGGTGG + Exonic
1092716250 12:11393260-11393282 TTGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716272 12:11393323-11393345 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716288 12:11393386-11393408 TTGTTGTCTCCTTGTGGGGGTGG + Exonic
1092716305 12:11393446-11393468 TTGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716327 12:11393509-11393531 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716341 12:11393572-11393594 TTGTTGTCTCCTTGTGGGGGTGG + Exonic
1092716358 12:11393632-11393654 TTGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716376 12:11393695-11393717 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716393 12:11393755-11393777 GACTTGTCTCCTTGTGGGGGTGG + Exonic
1092716410 12:11393815-11393837 TTGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716430 12:11393878-11393900 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1093765715 12:22959656-22959678 TTCTTGCCACCTTGTGGAGAAGG + Intergenic
1094753317 12:33438992-33439014 GGCTTGGCTGCTTGTGGGGGCGG - Intronic
1096524508 12:52202552-52202574 TGCTCGCCTCCCTGTGGGAGAGG - Intergenic
1096586229 12:52621872-52621894 TTGTTACCTCCTGGTGGGGATGG - Intergenic
1098576077 12:72043638-72043660 TTCTTGCCTTATTCTGGGAGTGG + Intronic
1099373897 12:81872407-81872429 TTCCTGCCACCTTGTGAAGGAGG - Intergenic
1099386315 12:82017815-82017837 CTCTTGCCACCTTGTGAGGAAGG + Intergenic
1099681688 12:85837129-85837151 TTCTTTACTCCTTGAGGGGCAGG - Intergenic
1100209747 12:92388702-92388724 TTCTTGTTTCCTTCTGGGTGGGG - Intergenic
1102032980 12:109753586-109753608 TTCTTGCCCCCTTGTGGGTATGG - Intronic
1102874501 12:116439216-116439238 TTCTTGGTTCCTTTTGGGGTAGG - Intergenic
1104596605 12:130124532-130124554 CTCTTGACTCCATGTGGGAGAGG + Intergenic
1104992611 12:132634656-132634678 TTCTTTCGTCCTTGGGGGGTGGG - Intronic
1105465164 13:20633304-20633326 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1105825617 13:24120000-24120022 TTCTTGTCACTCTGTGGGGGTGG - Intronic
1106995345 13:35474884-35474906 TTTTTCTCCCCTTGTGGGGGTGG + Exonic
1110195367 13:72782167-72782189 TTCTGTCCTCCTTGCGGGTGCGG + Exonic
1110936611 13:81298320-81298342 TTCTTGCCACCTTGTGAAGAAGG + Intergenic
1111372490 13:87335630-87335652 TGCTTGCTTCCTTCTGGGTGGGG - Intergenic
1112265453 13:97919534-97919556 TTCCTGCCGCCTTGTGAGGAAGG + Intergenic
1112738777 13:102450961-102450983 TTCTTGCCACCTTGTGAAGAAGG + Intergenic
1115268612 14:31527226-31527248 TTGCTGCCTCCCTGTGGGGCAGG - Intronic
1115318233 14:32049581-32049603 CTCTTTCCTCCTTCTGGTGGAGG - Intergenic
1116944187 14:50820705-50820727 TTCTTGGCCTCTTGTGGCGGGGG - Intronic
1117034002 14:51707996-51708018 TTCTTTCATCATTTTGGGGGTGG + Intronic
1117328490 14:54690132-54690154 TTCACCCCTCCTTGTGGGTGGGG - Intronic
1118303207 14:64633437-64633459 TGCTCGTGTCCTTGTGGGGGTGG + Intergenic
1120208555 14:81612105-81612127 TTCTGTCCACCTTGTGGGGGTGG + Intergenic
1122897916 14:104769502-104769524 TCCCTGACTCCCTGTGGGGGTGG - Exonic
1123438478 15:20272850-20272872 TCCTGGCCTTCTTGTGGGGCTGG - Intergenic
1124476461 15:30039183-30039205 TTCATGCCTCCTTGAGGTGGTGG - Intergenic
1129532007 15:76274968-76274990 TTCTTGACTCCTGCTGGGGAAGG - Intronic
1131601264 15:93851187-93851209 TTCTTGCCGCCTTGTGAAGAAGG + Intergenic
1134422038 16:14102480-14102502 TTCTTGAGTCCTTGAGAGGGGGG - Intronic
1136361763 16:29785148-29785170 TTCTTGCCTCCGTGGGTGGTTGG - Intergenic
1136362561 16:29790410-29790432 TTCTTGCCTCCGTGGGTGGTTGG - Intergenic
1137396423 16:48118634-48118656 TTCTTGCCTCTTTATTGGGAAGG - Intronic
1137722344 16:50634792-50634814 TGCTTGTCTCCTTTTGGGGCTGG + Exonic
1138221263 16:55252774-55252796 TTTAGGCCTCCTAGTGGGGGTGG - Intergenic
1138444256 16:57053532-57053554 TTCTTTCTTTTTTGTGGGGGAGG + Intronic
1140023603 16:71262896-71262918 TTCCTGCCTCTTTCTGGGGTAGG - Intergenic
1140270345 16:73459761-73459783 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
1140506761 16:75478499-75478521 TCCTTGCCTACTTGGGGAGGGGG + Exonic
1140925849 16:79582824-79582846 TCCTTCCCTTCTTGTGGGTGGGG + Intergenic
1141131801 16:81442591-81442613 TTGTTGCTTCCTTCTGTGGGGGG + Intergenic
1141142424 16:81505361-81505383 TTCTTGCTTCCATGTGGGCCTGG + Intronic
1141306259 16:82866760-82866782 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1143074346 17:4327712-4327734 TTCCTACCTCCTTGTGTGGCAGG + Intronic
1143831741 17:9657641-9657663 TTCCTGCCACCTTGTGAAGGAGG - Intronic
1144252649 17:13435170-13435192 TTATTGACTTTTTGTGGGGGTGG + Intergenic
1145110464 17:20156970-20156992 CTCTGGAGTCCTTGTGGGGGTGG + Intronic
1145866272 17:28243867-28243889 TTCCTGCCACCTTGTGAGGAGGG + Intergenic
1147149300 17:38504850-38504872 ATCTTGCCTCCCTGTGTGGATGG + Intronic
1147336360 17:39728911-39728933 TTATTTCCTCCTTGTGAGTGAGG + Intronic
1152633011 17:81419191-81419213 TTCTGGTCTCCTGGTGCGGGCGG + Intronic
1155195830 18:23472987-23473009 TTCTTGCAGACTTGTGGGGCAGG + Intronic
1156867656 18:41906739-41906761 CTCCTGACTTCTTGTGGGGGAGG + Intergenic
1157169291 18:45387339-45387361 TTTCTGCCTCCTTGTTTGGGGGG - Intronic
1157564779 18:48672630-48672652 TTCTTGCCTCCAGGTAGGGAGGG - Intronic
1157691195 18:49683190-49683212 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
1160169485 18:76541119-76541141 TTCTTGGCTCCCCGTAGGGGGGG - Intergenic
1160794419 19:938160-938182 TCCTAGCCTCCTTGTGGGGGTGG + Intronic
1161937025 19:7378457-7378479 TTTCTGCCTCGTGGTGGGGGAGG + Intronic
1164467871 19:28503347-28503369 TGCTTGCCTGCTTGTTGTGGGGG - Intergenic
1164501024 19:28820466-28820488 CTGTGGGCTCCTTGTGGGGGTGG + Intergenic
1164637559 19:29802539-29802561 TTCTTGCCTTTTTTTTGGGGGGG - Intergenic
1164816087 19:31204436-31204458 TTCTTTCCCCTTTTTGGGGGAGG + Intergenic
1165034450 19:33022750-33022772 TCCTGGCCTTCTTGTGGGGCTGG - Intronic
1168197732 19:54787900-54787922 TTCCTGCTTCTATGTGGGGGTGG - Intronic
928050966 2:27995094-27995116 TTCCTACCTCCTTGTTGGAGAGG + Intronic
928449688 2:31367195-31367217 TTCTTTCTTTGTTGTGGGGGTGG - Intronic
929027361 2:37617340-37617362 TTCTTGCCACCTTGTGAAGAAGG + Intergenic
930607628 2:53508963-53508985 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
932657033 2:73619173-73619195 TTCTGCTCTCCTGGTGGGGGCGG + Intergenic
933445607 2:82376727-82376749 TTCTTGCCACCATGTGGAGAAGG + Intergenic
933984253 2:87577484-87577506 TCCTTGCCTCCTGGTGCAGGAGG - Intergenic
934925093 2:98376681-98376703 TTCTTGCCTCCTTGTTAAGAAGG + Intronic
935597206 2:104888606-104888628 TTCCTTCCTTCTCGTGGGGGTGG - Intergenic
936309599 2:111373312-111373334 TCCTTGCCTCCTGGTGCAGGAGG + Intergenic
939703139 2:145419553-145419575 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
940852899 2:158705003-158705025 TTCCTGCCGCCTTGTGGAGAAGG + Intergenic
941031276 2:160514552-160514574 TTCTTGCTGCCTTGTGAGTGAGG + Intergenic
941653011 2:168113641-168113663 GTCTTGTCTCCTTGTTGGAGAGG - Intronic
942928231 2:181457939-181457961 CTCCTGCCTCCTTGGGAGGGAGG - Intronic
943463354 2:188197572-188197594 TTCTTGCCGCCTTGTGAAGAAGG - Intergenic
943541951 2:189226730-189226752 CTCTTTCCTCCTTGAGGGGGAGG - Intergenic
943829758 2:192445659-192445681 TTCTTGCATCCTAGTTGGAGTGG + Intergenic
943878654 2:193109009-193109031 TTCCTGCCACCTTGTGAAGGAGG + Intergenic
945758531 2:213881603-213881625 TTCCTGCCGCCTTGTGGAGAAGG - Intronic
947716216 2:232340122-232340144 TTCTTGCCTCTTTGTGGACTTGG - Intronic
948615490 2:239196135-239196157 ATTTTGCCTCTATGTGGGGGTGG + Intronic
948673835 2:239585344-239585366 TCCTTGCCTGCTTCTGTGGGGGG - Exonic
948897905 2:240935728-240935750 TGCTGGCCTCCCCGTGGGGGTGG + Intronic
1169082625 20:2806444-2806466 TACTTACCTCCTGCTGGGGGTGG - Intergenic
1169942307 20:10950454-10950476 TTCTTGCCTCCATGAGGAGCAGG - Intergenic
1171006296 20:21468442-21468464 TTCTCACCTCATTGTTGGGGGGG + Intergenic
1171148320 20:22804946-22804968 TACTTGGCTCCATGTGGGGATGG + Intergenic
1171504555 20:25623305-25623327 TTCTGGCCTCCCTGGCGGGGTGG - Intronic
1172331148 20:34077015-34077037 TTCTTGCCATCTTGAGGGGAAGG - Exonic
1172464038 20:35142215-35142237 TTCTTCCCTCCTGGAGGGTGAGG - Intronic
1174959954 20:55144646-55144668 TTCCTGCCGCCTTGTGAAGGGGG + Intergenic
1175689059 20:61052735-61052757 TTCTTGACTCCGTGGGTGGGGGG - Intergenic
1175785816 20:61711215-61711237 TTCCTGCCTTCTTGTGAAGGAGG + Intronic
1176073234 20:63237444-63237466 CTCATGCCTCCCTTTGGGGGTGG - Intronic
1176370881 21:6060781-6060803 TTCTGTCCTGCTGGTGGGGGAGG + Intergenic
1178468399 21:32869901-32869923 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1178755240 21:35343266-35343288 CTCTTCCCTCCTTGTGTAGGAGG + Intronic
1179019387 21:37624676-37624698 TGCTTGCCCCCATGTGGGTGTGG - Exonic
1179752638 21:43477760-43477782 TTCTGTCCTGCTGGTGGGGGAGG - Intergenic
1179964056 21:44790624-44790646 TTCTTGCCACCTTGTGAAGAAGG + Intronic
1181117946 22:20645570-20645592 TTCCTGGCTCCTTGTGGATGGGG + Intergenic
1181365364 22:22372372-22372394 TCCTTGCCTCCTTCTCAGGGCGG + Intergenic
1181404471 22:22673023-22673045 TTCTTGTATCCTTGTTGGGTGGG - Intergenic
1181413066 22:22738587-22738609 TTCTTGTATCCTTGTTGGGTGGG - Intronic
1181603377 22:23965511-23965533 TTCTTTCTTTTTTGTGGGGGAGG + Intergenic
1181605137 22:23975796-23975818 TTCTTTCTTTTTTGTGGGGGAGG - Intronic
1183121536 22:35733597-35733619 TTCTTCCCTTTTTGTCGGGGAGG - Intergenic
1183212814 22:36461465-36461487 CTCCTGCCTCCTTGTGGGGTGGG + Intergenic
1184161372 22:42699441-42699463 TTCTTGCCCCCTGGTGTGAGTGG + Intronic
950079826 3:10213410-10213432 TTCTTGGTTTCTAGTGGGGGTGG + Intronic
950102905 3:10369028-10369050 AACTGGCCTCCTTGTGGAGGGGG + Intronic
950554509 3:13687139-13687161 TTCCTTCCTCCTTGTGTGGAGGG + Intergenic
952936188 3:38400054-38400076 TTCTTCACTCCTGGTGGTGGTGG + Intronic
953666705 3:44930764-44930786 TTCTTGGCTCCTTGTGGGGCAGG + Intronic
954450286 3:50567849-50567871 TTCTAGGCTCCCTCTGGGGGTGG - Intronic
954710245 3:52501898-52501920 CTCTTGCTTCCTTGGGGGAGGGG + Intronic
957257416 3:77856132-77856154 TTCTTGCCTCCTTTTGAAGAAGG + Intergenic
957259165 3:77878021-77878043 TTCATGAATCCTTGTGGGGAAGG - Intergenic
960055810 3:113275710-113275732 TTCTTGCTTGTTTGTGGAGGTGG - Intronic
960865399 3:122194494-122194516 TTTTTGCCTTCTTGTTGGTGTGG - Intronic
961153146 3:124656819-124656841 TTCTTGTCTTTTTGTGGGGCTGG + Intronic
962450365 3:135509645-135509667 TTTTTGCCTTTTTTTGGGGGGGG - Intergenic
964903208 3:161686145-161686167 TTCCTGCCGCCTTGTGAGGAAGG + Intergenic
965898326 3:173606570-173606592 TTATAGCATCCTTGTGGGGCAGG + Intronic
969455039 4:7295702-7295724 TTGTTGCCACCATGTGGGGTGGG + Intronic
969564526 4:7970291-7970313 TTCCTGCTTCCTGCTGGGGGAGG + Intronic
969701728 4:8771356-8771378 TCCTGGCATCCTCGTGGGGGAGG - Intergenic
969874161 4:10123710-10123732 CGCATGCCTCCCTGTGGGGGAGG + Intergenic
970577581 4:17443266-17443288 TTCTTGCCACCTTGTGAAGAAGG - Intergenic
974125549 4:57691962-57691984 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
974125822 4:57693958-57693980 TTCCTGCCTCTTTGTGAGGAAGG + Intergenic
974183524 4:58414971-58414993 CTCTTGCCACCTTGTGAAGGAGG + Intergenic
977050860 4:92127698-92127720 TTTGTGTCTCCTTGTGGAGGAGG - Intergenic
977348203 4:95845104-95845126 TTCTTGCCACCTTGTGAAGAAGG - Intergenic
981749580 4:148081274-148081296 TTCTTGGGTCCTTCTGGGTGTGG + Exonic
982224424 4:153153040-153153062 TTTGTGGCTCCTTGTGGGGGAGG + Intronic
987274248 5:16345373-16345395 TTCTTGCCTCCTTGAAGGAAAGG + Intergenic
989092013 5:37743455-37743477 TATTTGGCTCCTTGTGGGAGGGG + Intronic
990099555 5:52164648-52164670 TTCTTGCCTACTTGGAGGAGGGG - Intergenic
990849934 5:60191470-60191492 TTCCTGCCTCCTTGTGAAGAAGG + Intronic
991020763 5:61977739-61977761 TTCTTTCCTCCTTGTGGCTCGGG + Intergenic
993800201 5:92324065-92324087 TTCTTGCTTCCCAGTGGGGTAGG - Intergenic
995022208 5:107379757-107379779 ATCTTGTTTCATTGTGGGGGTGG - Exonic
995753131 5:115474416-115474438 ATCTTGCCTCCATGAGGGTGGGG - Intergenic
996365927 5:122701456-122701478 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
996435139 5:123425601-123425623 TTCTTGCTGCCTTGTGAGGAAGG + Intergenic
997227357 5:132219073-132219095 CTGTTGCCTCCTTGTGGGCAGGG - Intronic
997698837 5:135882189-135882211 CTATTGCCTCCTGGTGGGAGAGG + Intronic
998246296 5:140508762-140508784 TTCTTTCTTTTTTGTGGGGGCGG - Intronic
998754389 5:145360120-145360142 TTCTGGCCTGCTTTTGGAGGAGG - Intergenic
998771802 5:145554201-145554223 TTCTAGCCTCGTTGTTGGGCAGG - Intronic
999302320 5:150498858-150498880 TTCATGCCTCCTTTTTGGGGAGG + Intronic
1001751718 5:174136507-174136529 TTCTAGCCTCCATGTTAGGGTGG + Intronic
1002695588 5:181086267-181086289 TTCCTGCCTGTGTGTGGGGGAGG - Intergenic
1003436568 6:6094308-6094330 TTGTTGCCTCCTTGTGAGTATGG - Intergenic
1003497497 6:6677298-6677320 TTCCTGCCACCCTGAGGGGGAGG - Intergenic
1004270210 6:14188440-14188462 TTCTTGAATCCTTGTGTGGAAGG - Intergenic
1005254054 6:23981148-23981170 TTCTGAGCTCCTTGTGTGGGAGG + Intergenic
1008724075 6:54394612-54394634 TTCTTGCCATCTTGTGAGGAAGG + Intergenic
1009391290 6:63146704-63146726 TTCTTGCCACCTTGTGAAGAAGG + Intergenic
1012541433 6:100366431-100366453 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1013465271 6:110412511-110412533 TTCTGGCCTCCTGCTGAGGGTGG + Intronic
1014581119 6:123138235-123138257 TTCTTGCCACCTTGTGAAGAAGG + Intergenic
1016548015 6:145246105-145246127 TTCTTGAATCCTTGTGAGGTAGG + Intergenic
1016870148 6:148808411-148808433 CTTTTGCCTGCTTGTGAGGGGGG + Intronic
1018515964 6:164580637-164580659 TTCTTGCCACCTTGTGAAGAAGG - Intergenic
1019551208 7:1603588-1603610 ATCCTGCCTCCTGGTGGGGAAGG + Intergenic
1019842032 7:3456877-3456899 TTCTGGCCTGCTTTTGTGGGTGG + Intronic
1020211849 7:6163716-6163738 TTCTTCCCTCCTCGTAGGGAGGG + Exonic
1021058194 7:16076973-16076995 TTCTTGCCGCCTTCTGAAGGAGG - Intergenic
1021890472 7:25181189-25181211 TTCCTGCCCCCTTGTGGAGAAGG + Intergenic
1021925603 7:25530940-25530962 ATGTTGCCTCCTTTTGGGGATGG - Intergenic
1022800685 7:33774553-33774575 TTCTTGCCTCCATGTGAAGAAGG + Intergenic
1023793617 7:43772697-43772719 TTCTTGCCACCTTGTGAAGAAGG - Intronic
1024407486 7:48999054-48999076 TTATTGCCCTCTTGTGGGTGGGG + Intergenic
1028041630 7:86060975-86060997 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1031881656 7:127205497-127205519 TAGTTGTCTCCTTGTGGGGCAGG + Intronic
1032636389 7:133713767-133713789 TTCTTGCCTCCTTGTGAAGAAGG + Intronic
1033492351 7:141855723-141855745 TTCCTGCCTCTGTGTGGGGAAGG - Intergenic
1034497410 7:151431090-151431112 CTGTTGCCTCCTTCTGGGGTGGG + Intronic
1034978592 7:155461717-155461739 TACTTCCCTCCTTGGTGGGGAGG - Intronic
1035722708 8:1803938-1803960 TTCAAGCCTCCCTGTGGAGGTGG + Intergenic
1035961369 8:4141872-4141894 TTCTTTCCTCCTTGTAGGATTGG - Intronic
1036543450 8:9742164-9742186 TTTTTACCTCATTGTGAGGGTGG + Intronic
1037162276 8:15788235-15788257 TTCTTCCATTCTTGTGGGGGAGG + Intergenic
1037838989 8:22230926-22230948 TGCGTGCCTTCTTGTGGAGGTGG - Intronic
1039912068 8:41833801-41833823 TGCTTGCCCCGTTGTGGTGGTGG - Intronic
1040566714 8:48573912-48573934 GTCTTGCCTCCTTTTGTGGGAGG + Intergenic
1041836623 8:62223636-62223658 TGCTGGGCTCCTTGTGGGTGGGG - Intergenic
1042882075 8:73504617-73504639 CTTTTGCCACCTAGTGGGGGAGG + Intronic
1043321197 8:78988870-78988892 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1043644222 8:82497838-82497860 TTCTTGCCACCTTGTGAAGAAGG + Intergenic
1043882597 8:85562351-85562373 TTCTTGACTCATTGTGTGGAGGG - Intergenic
1044005523 8:86932395-86932417 TGCTTGTCTCCTTCTGGGTGGGG + Intronic
1044056072 8:87570657-87570679 TTCTTGCCTCCTTGTGAAGAAGG + Intronic
1044628075 8:94254066-94254088 TCCTTACCTCCCTCTGGGGGAGG + Intronic
1045815570 8:106272184-106272206 TTCTTGCTTCCTTGTTTTGGTGG - Intronic
1046772841 8:118134100-118134122 TGCTTGCCTACTTTTGGTGGAGG + Intergenic
1047273417 8:123384566-123384588 TTCTTGCCTCTGGGTTGGGGAGG - Intronic
1048355359 8:133649350-133649372 ATCTTGGTTCCTTGTGGGTGGGG - Intergenic
1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG + Intergenic
1050330876 9:4544885-4544907 TTCCTGCCACCTTGTGAAGGAGG - Intronic
1051417377 9:16856206-16856228 TTGCTGCTTCCTTATGGGGGAGG - Intronic
1051622377 9:19064941-19064963 TCCTTACCTTCTTGTGGTGGTGG - Intronic
1051668733 9:19489364-19489386 TTCCTGCCACCTTGTGAAGGTGG + Intergenic
1051873238 9:21763369-21763391 TTTCTTCCTACTTGTGGGGGTGG - Intergenic
1052554329 9:29994484-29994506 TTCCTGCCACCTTGTGAAGGAGG - Intergenic
1053283628 9:36837056-36837078 TTCTTGCCTGATTGTGGGTCTGG + Exonic
1054931911 9:70643923-70643945 TTCATGCCTCCTTATATGGGAGG + Intronic
1055394783 9:75862562-75862584 TTCTGTGATCCTTGTGGGGGCGG - Intergenic
1055983912 9:82036280-82036302 TCCTTGCTTCCTTCTGTGGGAGG + Intergenic
1059199472 9:112400746-112400768 TTCTTCCCAGCTTCTGGGGGTGG + Intronic
1059404750 9:114092734-114092756 TTCTTGGTACCTTGTGGGGTAGG - Intronic
1060301873 9:122378695-122378717 TTCTTGCCTCCTCCTGGGTTGGG - Intronic
1062674547 9:137732811-137732833 TTGTTGCCTCCCTGTGGGAGGGG + Intronic
1186013587 X:5165808-5165830 TTCTTTCTTCCTTCTGGGTGTGG - Intergenic
1186024457 X:5293666-5293688 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1186054569 X:5635268-5635290 TTCTTGCCGCCTTGTGAAGAAGG + Intergenic
1186472599 X:9833060-9833082 TTCTCGCGTCCTTGTGGAGAAGG + Intronic
1188343075 X:29029053-29029075 TTCTTGCCACCTTGTGAAGAAGG - Intronic
1188606889 X:32042380-32042402 TTCTTGCCACCTTGTAAAGGAGG - Intronic
1188619394 X:32201477-32201499 ATATGGCCTCCTTGTTGGGGGGG - Intronic
1189232747 X:39465247-39465269 TTCTTGCCCTCTGGTGGGAGGGG - Intergenic
1189370328 X:40422980-40423002 TTTTTCCTTCCTTGTTGGGGAGG + Intergenic
1192482854 X:71500075-71500097 TTCTTGTTTCCTTCTGGGTGGGG + Intronic
1192668445 X:73112702-73112724 TTCTTGCCTACTTGGAGGAGGGG - Intergenic
1193379891 X:80807127-80807149 TTTTTGCCTCTTTTAGGGGGAGG + Intronic
1193534654 X:82698976-82698998 TTCTTGCCACCTTGTGAAGAAGG + Intergenic
1195113059 X:101666409-101666431 TTAAGGCCTCCTGGTGGGGGTGG - Intergenic
1195242969 X:102971539-102971561 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1195300795 X:103528190-103528212 TTCTTGCCGCCTTGTGAAGAAGG - Intergenic
1195552476 X:106184898-106184920 TGCTTGCTTCCTTCTGGGTGGGG + Intronic
1196135186 X:112201115-112201137 TTCTTGCCGCCTTGTGAAGAAGG - Intergenic
1196306431 X:114108408-114108430 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1196616148 X:117769236-117769258 TAGTTGCCTCCCTGTGGGGCAGG + Intergenic
1197467255 X:126820396-126820418 TCCTTGCTGCCTTGTGGAGGTGG + Intronic
1198215459 X:134550567-134550589 TTGTTGCATCCTGTTGGGGGTGG + Intergenic
1198376796 X:136048786-136048808 TTCTTGCCTTCTAGCAGGGGGGG + Intergenic
1199061696 X:143363311-143363333 TTCTTGCCACCTTGTGAAGAAGG + Intergenic
1199338172 X:146643580-146643602 TTCTTGCCACCTTGTGAAGAAGG + Intergenic
1200696246 Y:6363563-6363585 TTCTTGCCTTCTTCTGTGTGGGG - Intergenic
1201037868 Y:9801137-9801159 TTCTTGCCTTCTTCTGTGTGGGG + Intergenic
1201407593 Y:13664233-13664255 TGCTTGCTTCCTTCTGGGTGGGG + Intergenic